ID: 1118227080

View in Genome Browser
Species Human (GRCh38)
Location 14:63911766-63911788
Sequence TTTCACATCCAGAATATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118227076_1118227080 -2 Left 1118227076 14:63911745-63911767 CCTATTCAATCCATAGCAAGTTT 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG 0: 1
1: 0
2: 0
3: 34
4: 361
1118227075_1118227080 4 Left 1118227075 14:63911739-63911761 CCTTAACCTATTCAATCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG 0: 1
1: 0
2: 0
3: 34
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118227080 Original CRISPR TTTCACATCCAGAATATGGA GGG Intronic
900785028 1:4644050-4644072 TTTCACATCTAGAGAATGGGAGG - Intergenic
901728256 1:11259440-11259462 TTTCTTATCCAGAATATTAAAGG - Intronic
902830648 1:19010227-19010249 TCTCACATCCAGAACAGGCAGGG - Intergenic
903268971 1:22176085-22176107 TTCCACATCCAGAACAAGGAGGG - Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
903717391 1:25377942-25377964 ATTCATATCCAGGATATGTAAGG + Intronic
904068074 1:27770883-27770905 TTTGACATCCAGTATTTGCAAGG + Intergenic
905757771 1:40525917-40525939 ATTCATATCCAGAATATACAAGG + Intergenic
909263961 1:73532692-73532714 TCTCATATCCAGAATCTGTAAGG - Intergenic
909357924 1:74730614-74730636 TTTCTCATCCATAAAATGGATGG - Intronic
909836759 1:80264897-80264919 TCTCATATCCAGAATCTGTAAGG + Intergenic
911444230 1:97970749-97970771 TTTCACTTCTAGAGTATGAATGG - Intergenic
911905474 1:103562990-103563012 TTTGACATCCATAATATAAATGG - Intronic
912267118 1:108169109-108169131 TGACAAATCCAAAATATGGATGG + Intronic
913176838 1:116281105-116281127 ATTAACATCCAGAATATGCAAGG - Intergenic
913707387 1:121440269-121440291 ATTAACAACCAGAATATGTAAGG + Intergenic
915705436 1:157839204-157839226 TTCCACCTCCAGAATTTAGAAGG - Intronic
916051046 1:161037372-161037394 TTTTTAATTCAGAATATGGAGGG - Intronic
916354524 1:163889936-163889958 GTCCATATCCAGAATATGTATGG + Intergenic
916388904 1:164308630-164308652 TGTCAGTCCCAGAATATGGAGGG - Intergenic
916503304 1:165405580-165405602 TTTTGCATCCAGATGATGGAAGG - Intronic
917300111 1:173564581-173564603 TTTCATAACCAGAATATATAAGG - Intronic
918152951 1:181814298-181814320 GGCCCCATCCAGAATATGGAGGG + Intergenic
919034442 1:192288593-192288615 ATTAATATCCAGAATATAGAAGG + Intergenic
921853167 1:219952074-219952096 TTTCACATCCACAAACTGGCAGG - Intronic
922075253 1:222237299-222237321 TTTCACATCTAGAGTTTTGAAGG - Intergenic
923448181 1:234092059-234092081 TTTCACTTCCAGGAGCTGGAAGG + Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924105494 1:240645156-240645178 TTTCAGTTCCAGAACAAGGAGGG + Intergenic
924592594 1:245417868-245417890 TTTCTCATCTAAAATTTGGAGGG - Intronic
1063981650 10:11457440-11457462 TTTCACTTCCACAGCATGGAGGG + Intronic
1064361968 10:14674360-14674382 ATTAACATCCAGAATATACAGGG + Intronic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1066581659 10:36888387-36888409 TCTTACATCCAGAAAAGGGAGGG + Intergenic
1066700600 10:38123605-38123627 GTTCACAACCAGAATATATAAGG + Exonic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1068072697 10:52215651-52215673 TTTCAAATCATGAATTTGGATGG + Intronic
1069395885 10:67987287-67987309 TTTTACCTCGAGAAAATGGAAGG - Intronic
1069656161 10:70090579-70090601 TTTCACCTACAGTATATGTAAGG + Intronic
1070652726 10:78249641-78249663 TTTAACATACAGAATAGGGTAGG - Intergenic
1071027782 10:81136863-81136885 GATCACTTCCAGAATATGTACGG + Intergenic
1072084022 10:92060625-92060647 ATTCATAACCAGAATATGTAAGG + Intronic
1073780130 10:106828485-106828507 TTTGCCATCTGGAATATGGAAGG - Intronic
1074042504 10:109805400-109805422 TTTAACATCCAGAATCTGTAAGG + Intergenic
1077343954 11:2037915-2037937 TTTCCCATCCAGATTCTGGCAGG - Intergenic
1081647002 11:44797069-44797091 AGGAACATCCAGAATATGGAAGG - Intronic
1082864989 11:57890971-57890993 GTTAACATCCAGAATATGTAAGG - Intergenic
1083784689 11:64937243-64937265 TTTCTCATCCAGAAAATGAGGGG - Intergenic
1086208209 11:84285608-84285630 TTTCACATCTGGAAGAAGGAAGG - Intronic
1086666078 11:89484022-89484044 TCTCTCATCCATAGTATGGAAGG - Intronic
1087251895 11:95910753-95910775 GTTCACAATCAGAATATAGAAGG - Intronic
1087358685 11:97129330-97129352 TTTAATATCCAGAATATATAAGG - Intergenic
1087602717 11:100337320-100337342 GATCACTTCCAGAATATGTATGG - Intronic
1087804009 11:102536074-102536096 TTTGATATCCAGAATATATAAGG - Intergenic
1088453306 11:110005671-110005693 TTTAATATCCAGAATATATAAGG + Intergenic
1088483824 11:110321614-110321636 TTTCCCATCTGGAATATGGAGGG + Intergenic
1089418361 11:118312661-118312683 TTTCAGATCCAGGATACTGAGGG - Exonic
1089444227 11:118538983-118539005 ATTAATATCCAGAATATGCAAGG - Intronic
1089814709 11:121162136-121162158 GTGCACATCCAGAAGATGCAGGG + Exonic
1090252998 11:125264176-125264198 TTCCTTATCCAGAAAATGGATGG - Intronic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1091260106 11:134226922-134226944 TTTTAAAGCCAGAATATGAAAGG + Intronic
1202826940 11_KI270721v1_random:93104-93126 TTTCCCATCCAGATTCTGGCAGG - Intergenic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092075364 12:5668426-5668448 TTTAATATCCAGAATCTGCAAGG - Intronic
1092668491 12:10834476-10834498 ATTCATATCCAGACTATAGAAGG - Intronic
1093232816 12:16568363-16568385 ATCCACATCCAGAGTATGGAGGG - Intronic
1093359882 12:18210935-18210957 AATCACATCCAGAATAGTGAGGG + Intronic
1093717072 12:22394830-22394852 TTTCACATCCAGACTGTATAAGG - Intronic
1094027902 12:25978306-25978328 TCTCACTTCCAGAATATATAAGG - Intronic
1094450292 12:30576751-30576773 TTTCCCATCCAGATTAAGGGTGG - Intergenic
1094759157 12:33509816-33509838 TTTAAAATCCAAAATATAGAAGG + Intergenic
1096150502 12:49307553-49307575 GTTAATATCCAGAATATGTAAGG - Intergenic
1096745736 12:53725779-53725801 TTTCAGAGCTAGAATATGGCTGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097609517 12:61801871-61801893 TCTAATATCCAGAATATGCAAGG + Intronic
1098713094 12:73792376-73792398 GTTAATATCCAGAATATGTAAGG - Intergenic
1099391385 12:82083939-82083961 GTTAACATCCAAAATATGTAAGG - Intergenic
1099530557 12:83774863-83774885 ATTAATATCCAGAATATGTAAGG + Intergenic
1099664607 12:85611938-85611960 TCTAACATCCAGAATCTGTAAGG - Intergenic
1099809391 12:87561473-87561495 TTTAACATCCAGAATCTACAAGG + Intergenic
1101573276 12:105974908-105974930 TTTCAGTTCTAGAAAATGGATGG - Intergenic
1102061113 12:109931743-109931765 TTTCACATTCAGAACAAGAAGGG + Exonic
1102443415 12:112981097-112981119 TTTAATATCCAGAATATACAAGG - Intronic
1102709361 12:114912179-114912201 ATTAACATCCAGAATATATAAGG + Intergenic
1105514930 13:21080842-21080864 TTTCACCCCCAAAATCTGGAAGG + Intergenic
1106283006 13:28293557-28293579 TTTTACAGCCTGAATTTGGAGGG + Intronic
1107608808 13:42091686-42091708 ATTAATAACCAGAATATGGAAGG + Intronic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1108037195 13:46303509-46303531 ATTCATATCCAGAATATATAAGG + Intergenic
1108932254 13:55839830-55839852 TTTGACATACAGAAAATGTAGGG - Intergenic
1109482962 13:62980610-62980632 GTTCACATCCTGAACATGGTGGG - Intergenic
1109574960 13:64243281-64243303 TTTCACAACCAGAGGAAGGAAGG - Intergenic
1109815989 13:67585554-67585576 ATTAACATCCAGAATATACAAGG - Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110324925 13:74202704-74202726 TTCCATATCCAAATTATGGAAGG + Intergenic
1110797941 13:79661423-79661445 TTTCACACCCAGGCTGTGGAGGG + Intergenic
1110872926 13:80473634-80473656 TTTCCCATGCAGAGTATTGATGG - Intergenic
1111105052 13:83634298-83634320 TTTCTTATACATAATATGGAAGG - Intergenic
1111549620 13:89789880-89789902 TTACAAATTCATAATATGGAAGG - Intergenic
1111613764 13:90639150-90639172 TCACACATCCAGAAAATGCAAGG + Intergenic
1111899583 13:94184400-94184422 TCTAACATCCAGAATCTAGAAGG + Intronic
1113064155 13:106357115-106357137 TTTCACATCGATAATATTGTAGG + Intergenic
1115600585 14:34952031-34952053 CTCCACATACAGAATATTGAAGG + Intergenic
1116358796 14:43966417-43966439 TTTAATATCCAGAATATGTAAGG - Intergenic
1116448278 14:45037521-45037543 TACCACATCCAGAATAAAGAGGG + Intronic
1117529799 14:56649026-56649048 CTTCAAATCCAGAGAATGGAGGG - Exonic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1119687421 14:76643777-76643799 ATTCACATCCTGCATATTGAAGG + Intergenic
1120748664 14:88177092-88177114 TTTCACATGAAGAACATGTATGG + Intergenic
1121371827 14:93365801-93365823 TTTCAGATAGAGAAAATGGAAGG + Intronic
1123586800 15:21768102-21768124 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123623439 15:22210667-22210689 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123910465 15:24960755-24960777 TTTGGTATCCAGAATATGTAAGG - Intronic
1125153389 15:36559766-36559788 ATTAAAAACCAGAATATGGAAGG - Intergenic
1126272891 15:46843444-46843466 GTTAACACCCAAAATATGGAAGG - Intergenic
1127000134 15:54493518-54493540 TTTCAAAACCGGAATATAGAGGG - Intronic
1127369321 15:58322523-58322545 ATTCACATCCAGAATATACAAGG - Intronic
1128531691 15:68455342-68455364 GTTCATATCCAAAATATGTAAGG + Intergenic
1129642913 15:77399926-77399948 ATTAACAACCAGAATATAGAAGG + Intronic
1131669320 15:94602441-94602463 TTACACATCCAGCAAATGGAAGG - Intergenic
1134111386 16:11517473-11517495 TTCCTCATCCAGAATGTGGGTGG - Intronic
1135831154 16:25774789-25774811 TTTCACCTTCAGAATCTTGATGG + Intronic
1137484232 16:48878273-48878295 TTTCTCATCCAGAAAATGAGGGG - Intergenic
1137829656 16:51531824-51531846 TTCCACATCCATAATAAAGAAGG - Intergenic
1138356338 16:56383979-56384001 TTTCAGAGCCAGAACATGCAGGG - Intronic
1138556072 16:57771941-57771963 TTTCACACTCAGAATAGGGTGGG - Intronic
1138582383 16:57950054-57950076 TTCCACATTCAGGATATAGAGGG - Intronic
1138634750 16:58328898-58328920 TTTAAAATCCAGACTAAGGAAGG + Intronic
1138637222 16:58350319-58350341 GTTCATATCCAGAATATATAAGG + Intronic
1138827883 16:60342614-60342636 TTTCAAATACAGAATATGAGTGG - Intergenic
1138880221 16:61004488-61004510 TTTCACAAAGAGAAAATGGAGGG + Intergenic
1138922726 16:61552266-61552288 GTTCAAATCCAGACTATGAATGG - Intergenic
1140554295 16:75903601-75903623 TTTAATATCCAGAATAAAGAAGG - Intergenic
1140678562 16:77360618-77360640 TTCCAAATTCAGAATATGAATGG + Intronic
1140679587 16:77371880-77371902 GTTAATATCCAGAATATGTAAGG + Intronic
1140744055 16:77965512-77965534 TTTCCCATCCAGACAGTGGAGGG - Intronic
1141044110 16:80700436-80700458 AGTAACATCCAGAATATGTAAGG + Intronic
1141685204 16:85566192-85566214 TCTCAAATCCAAGATATGGACGG - Intergenic
1203113444 16_KI270728v1_random:1466932-1466954 TTTCTCATCCAGGGGATGGAAGG + Intergenic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1146168061 17:30607248-30607270 TTTCAAATAAGGAATATGGAAGG - Intergenic
1146215184 17:30973239-30973261 TTTGATATCCAGAATATAGAAGG - Intronic
1150014555 17:61540520-61540542 TCTAATATCCAGAATATGTAAGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150949153 17:69782969-69782991 GTTGATATCCAGAATATGGAAGG + Intergenic
1153284635 18:3446840-3446862 TTTCACTTCCAGTCTCTGGAAGG - Intronic
1153395040 18:4609920-4609942 TTTCACTAGCAGAATATGAATGG - Intergenic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1155124694 18:22861060-22861082 TGACACATCCAGAATATACAAGG + Intronic
1156169940 18:34470466-34470488 TTTAATATCCAGAATCTGTAAGG - Intergenic
1156715318 18:40001976-40001998 TCTCACATCCAGCATCTGTAAGG + Intergenic
1156957462 18:42986008-42986030 GTTCATATCCAGAATATGTATGG + Intronic
1157175910 18:45452028-45452050 TTTCAAATCAAAAATATGGGGGG + Intronic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1159723662 18:71925715-71925737 TGTCATATCCAGAATCTGTAAGG + Intergenic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1165260285 19:34609203-34609225 ATTCATATCCAGAATATACAAGG - Intronic
1165271992 19:34717191-34717213 ATTCATATCCAGAATATATAAGG + Intergenic
1165999227 19:39868078-39868100 ATTAACATCCAGAACATGGCCGG + Intronic
926958193 2:18325153-18325175 TTTCACATCCATCAGATGGACGG - Intronic
929385087 2:41396807-41396829 ATTAATATCCAGAATATGCAAGG - Intergenic
929729143 2:44468113-44468135 TTTAATATCCAGAATATACAAGG + Intronic
929923473 2:46190478-46190500 TTTCTCATCTAGAATGTGGTTGG - Intergenic
929931979 2:46264441-46264463 TTTGACATCCAGAAAATGCCAGG + Intergenic
930918948 2:56727595-56727617 TTTAAGATCCAGAATATATAAGG - Intergenic
932152184 2:69383399-69383421 CTTCATATCCAGTATATGTAAGG + Intronic
932983382 2:76697882-76697904 TTTCCCTTCCACAATGTGGAAGG - Intergenic
933316090 2:80717140-80717162 TTTCAGGTGGAGAATATGGAGGG - Intergenic
933332225 2:80908468-80908490 ATTAACATCCAGAATATATAAGG - Intergenic
933471691 2:82734033-82734055 TTTCACATATAGAATATAAATGG - Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
933819466 2:86096980-86097002 CTTAATATCCAGAATATGTAAGG + Intronic
934690670 2:96356371-96356393 TTTCTCATCCATAAAATGCAAGG + Intronic
935357581 2:102218041-102218063 GTTAATATCCAGAATATAGAAGG + Intronic
935436028 2:103033714-103033736 TTTAATATCCAAAATATAGAAGG - Intergenic
935629241 2:105198761-105198783 ATTCATAACCAGAATATGTAAGG + Intergenic
935889361 2:107659024-107659046 TATCACATTTACAATATGGAAGG + Intergenic
936405985 2:112203250-112203272 ATTCTCAGCCAGAATATTGAAGG + Intergenic
936603268 2:113921353-113921375 ATTAACATCCAGAATATATAAGG - Intronic
937173732 2:119904183-119904205 TTTCTCATTCAGATTATGAATGG - Intronic
937587508 2:123570874-123570896 TTTCACATGCAGTATATAGTAGG + Intergenic
938011180 2:127830251-127830273 TCTCACATCCAGCAATTGGAGGG + Intergenic
939097137 2:137845966-137845988 ATTCATATCCAAAATATGTAAGG - Intergenic
940640469 2:156341000-156341022 TTTTACAGCCAGAATATGACAGG + Intronic
940758550 2:157711082-157711104 ACTAACATCCAGAATATAGAAGG + Intergenic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
941862929 2:170303387-170303409 TTTTACACCCATAAGATGGATGG - Intronic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
944361436 2:198862078-198862100 TTTCACACACAGAATATGGCTGG - Intergenic
945774527 2:214088538-214088560 ATTCACTTCCAAAATATGAAAGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
945905642 2:215589685-215589707 TAACACATCAAGAAAATGGAGGG - Intergenic
946005723 2:216523132-216523154 TTCCACATCCAGAAAATCTAGGG - Intronic
946805531 2:223467573-223467595 ATTCATATCCAGAATATATAAGG - Intergenic
948986124 2:241525102-241525124 TTTAATATCCAGAATATATAAGG + Intergenic
1169249191 20:4047116-4047138 TTTCTCATCCATAAAATGGGTGG + Intergenic
1169792216 20:9423442-9423464 TTTCTCATCCATTATATGGGTGG + Intronic
1170919019 20:20658113-20658135 TTTCAGATTCACAAAATGGATGG + Intronic
1170996853 20:21369748-21369770 TTTAATAACCAGAATATGTAAGG - Intronic
1171499558 20:25583236-25583258 TCTAATATCCAGAATATAGAAGG + Intronic
1172693996 20:36809194-36809216 TTGCACATCCAGAGTGTGGCAGG - Intronic
1173714454 20:45190203-45190225 TTTCCCATCCACAAGATGGGGGG - Intergenic
1174711645 20:52712462-52712484 TATCACATAGAGTATATGGAAGG + Intergenic
1176703020 21:10081027-10081049 TTTAATATCCAGAATATATAAGG + Intergenic
1181825038 22:25508112-25508134 TTCCACATCTATAAAATGGAAGG - Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951445508 3:22775122-22775144 ATTCACATCCAGAAAAATGATGG - Intergenic
951845077 3:27076706-27076728 TTTCACACCCAGTATCTAGATGG + Intergenic
952011805 3:28908305-28908327 TTTCACTTCCTGCAGATGGATGG - Intergenic
952233773 3:31458178-31458200 ATTAATATCCAGAATATGCAAGG + Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
955117036 3:56016085-56016107 TCTAATATCCAGAATATGCAAGG - Intronic
957895776 3:86420001-86420023 TTTTAAATCCAGAAGATGGAGGG - Intergenic
957915043 3:86677602-86677624 TTTAATATCCAGAATCTGTAAGG - Intergenic
959346516 3:105201674-105201696 TTTCACATTCAGAAACTGAAAGG - Intergenic
959613422 3:108320287-108320309 TTTCACATGCAGAAAATAAAAGG - Intronic
960235575 3:115278317-115278339 ATTAACAGCCAGAATATAGAAGG - Intergenic
961422033 3:126814045-126814067 TATTACACCCAGAATATTGATGG + Intronic
962055407 3:131866130-131866152 TTCCACATACAGGATCTGGATGG + Intronic
962055699 3:131869203-131869225 TATCACTTCCAGAAAATGAAGGG + Intronic
962657184 3:137559275-137559297 TCTAACATCCAGAATCTGTAAGG + Intergenic
962768328 3:138588339-138588361 GTTCATATCCAGAATATATAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963405307 3:144855751-144855773 TTTCACAATCAGAAATTGGAGGG - Intergenic
963950381 3:151193272-151193294 TTTCTCATCTACAAAATGGAGGG + Intronic
966265397 3:178035553-178035575 ATTAACATCCAGAATATATAAGG - Intergenic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
968010971 3:195275153-195275175 TTTAATATCCAAAAAATGGAGGG + Exonic
970186041 4:13454988-13455010 TCTCAGACCCAGAATATTGATGG + Intronic
970327997 4:14948192-14948214 TTTCACATCCAGAATCTACAAGG - Intergenic
971489555 4:27197180-27197202 TTTAACATCCAGAATTTACAAGG + Intergenic
971511831 4:27436195-27436217 TTTTACAGCATGAATATGGAAGG + Intergenic
971735588 4:30445593-30445615 ATTCATTTCCAAAATATGGAAGG + Intergenic
972205452 4:36766510-36766532 TTTCTCATCTATAAAATGGAAGG - Intergenic
973929672 4:55779155-55779177 GATCATATCCAGAATATGTAAGG + Intergenic
974249738 4:59370079-59370101 TATCACAACAAGTATATGGAAGG + Intergenic
974254109 4:59427539-59427561 TTTCATATCCAGAATATATAAGG - Intergenic
975275862 4:72500492-72500514 TTTCATATCCAGAATCTATAGGG - Intronic
975431750 4:74300661-74300683 TTTCACACCCACAGTATGAAAGG - Intronic
976255369 4:83094885-83094907 TTTCAGATTCAGAGTTTGGATGG + Intronic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
980311913 4:131142121-131142143 TTTTATATCCAAAATATGTAAGG + Intergenic
980375211 4:131937401-131937423 TTTAATATCCAGAATATATAAGG + Intergenic
980939310 4:139258374-139258396 TTTAACAACCAGAATAATGAAGG - Intergenic
982304542 4:153916494-153916516 TTTCCCATCTTAAATATGGATGG + Intergenic
982318214 4:154052733-154052755 ATTAACATCCAAAATATGCAAGG - Intergenic
982803207 4:159730244-159730266 TTGCACATCTAGTATATGGCAGG + Intergenic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985296507 4:188442666-188442688 TATCACTTCCAGATAATGGAGGG - Intergenic
986081714 5:4401222-4401244 TGTCACTTCCAGCAAATGGATGG - Intergenic
987817657 5:22923839-22923861 TTTCACAGCCATTATATGGTGGG + Intergenic
988247920 5:28712695-28712717 TTTAATAACCAGAATATGCAAGG + Intergenic
989312535 5:40036987-40037009 TTTATCATCCAGAATGTGAAGGG + Intergenic
989526250 5:42456729-42456751 TTCCACATCCAGAAAAGAGACGG + Intronic
990330112 5:54717294-54717316 TTTAACATCCAAAATATATAAGG + Intergenic
990388187 5:55289358-55289380 TTTCACATCAACAAAATGAAAGG - Exonic
990874033 5:60464220-60464242 TGATTCATCCAGAATATGGATGG + Intronic
991019640 5:61966774-61966796 GTTTACATCCTGCATATGGAAGG + Intergenic
991600165 5:68343998-68344020 TTTGACCTCCATAATAGGGAAGG - Intergenic
992578602 5:78147452-78147474 TTTCTCATCTTGAATATGAATGG - Intronic
992763471 5:79972459-79972481 TTGCAGGTCCAGAATATGGCAGG - Intergenic
992857706 5:80880054-80880076 TTTCACACCAAGGATATGGGTGG + Intergenic
993057926 5:83003736-83003758 TGTCACATGCACAACATGGAAGG - Intergenic
993564071 5:89451263-89451285 TTTCAAATCTAGAATATTTATGG + Intergenic
994252760 5:97556147-97556169 TTGCAAATCCATAATATGGTAGG - Intergenic
994415849 5:99469287-99469309 TGTCACATTCGGACTATGGAAGG + Intergenic
994464121 5:100105829-100105851 TGTCACATTCGGACTATGGAAGG - Intergenic
995853090 5:116567176-116567198 TATCACACCCAAAACATGGAAGG - Intronic
996286260 5:121796732-121796754 TGGCACATCCAAAATCTGGAGGG + Intergenic
996561833 5:124838235-124838257 TTTCACACCCTCAATATGGGTGG - Intergenic
997773047 5:136571281-136571303 TTTAACATCCAGAATCTATAAGG - Intergenic
998035775 5:138914654-138914676 TTTCACCTCCAGCCTTTGGAGGG + Intronic
998266017 5:140668442-140668464 CTCCACATCTAGAACATGGATGG - Exonic
999139978 5:149354143-149354165 TTTAAAAACCAGAAAATGGAAGG - Exonic
999569351 5:152901264-152901286 TTTCACATTAAGAATATGAAAGG + Intergenic
1000271790 5:159692184-159692206 ATTAATATCCAGAATATGTAAGG + Intergenic
1000967050 5:167670202-167670224 TTTCACATCAAAAAGATGGATGG + Intronic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1006933672 6:37702774-37702796 CTTCACATCTATAAAATGGAGGG - Intergenic
1008360100 6:50607107-50607129 TTTCTCATCCATAAAATGAAAGG + Intergenic
1008440750 6:51529495-51529517 TTTCAGATCCTGCATTTGGATGG - Intergenic
1009004325 6:57763833-57763855 TTTCAGTTCCAGAAATTGGATGG + Intergenic
1009645520 6:66396079-66396101 TTTCACATCCACCATTTGGTGGG - Intergenic
1010544223 6:77129965-77129987 TCTAACATCCAGAATCTGTAAGG + Intergenic
1010550749 6:77220189-77220211 TCTAACATCCAGAATGTGTAAGG + Intergenic
1011048273 6:83111749-83111771 TTTAATATCCAGAATATATAAGG - Intronic
1011221415 6:85058154-85058176 TTACACATACAAATTATGGAAGG - Intergenic
1013670377 6:112395850-112395872 ATTAACATCCAGAATATACAAGG - Intergenic
1013771190 6:113629922-113629944 TTTGACATATTGAATATGGAGGG - Intergenic
1014641772 6:123920499-123920521 TCTCACATGGAAAATATGGAAGG - Intronic
1015735518 6:136395443-136395465 ATTAACAACCAGAATATGTAAGG - Intronic
1015862192 6:137692540-137692562 ATTCATATCCAGAATAAGTAAGG - Intergenic
1017105210 6:150880968-150880990 GTTAACATCCAGAATATATAAGG - Intronic
1017320157 6:153082315-153082337 TTGAACTTCCAGAATTTGGAAGG - Intronic
1017599243 6:156062742-156062764 TATCACATGCAAAATATGGCAGG + Intergenic
1018519736 6:164634755-164634777 TTTCATATCCAGAATTTGTTTGG + Intergenic
1018644763 6:165937217-165937239 TGTCTAATCCTGAATATGGAAGG + Intronic
1019054344 6:169212646-169212668 TTTAAAATCCAGAATAAGTATGG + Intergenic
1019264447 7:105536-105558 ACTCATATCCAGAATATGTAAGG + Intergenic
1020732696 7:11903645-11903667 ATTAATATCCAGAATATGTAAGG + Intergenic
1021667003 7:22993510-22993532 TCTCATATCCAGAATATATAAGG + Intronic
1022068590 7:26886928-26886950 TTTCAGTTCTGGAATATGGATGG + Intronic
1022408756 7:30119179-30119201 TTTCCCATCTAGAAAATAGAAGG + Intronic
1026542594 7:71293570-71293592 ATTAATATCCAGAATATGCAAGG - Intronic
1027730911 7:81871423-81871445 TTTTCCATCCAGCATCTGGATGG + Intergenic
1027858717 7:83547516-83547538 TTTCACAGCCTAAATAAGGAAGG + Intronic
1028346142 7:89785508-89785530 TCTCATATCCAGAATCTGTAAGG + Intergenic
1029329395 7:99839373-99839395 GTTCACATACTGAATATGCATGG - Intronic
1029607128 7:101605901-101605923 TTTCACAGCCAGGACATGGCTGG - Intergenic
1030694304 7:112568291-112568313 TTTCACATCTATATTATGGCTGG + Intergenic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1031154989 7:118099358-118099380 TTTCACATCAAGTAGAAGGATGG - Intergenic
1031209890 7:118809869-118809891 TTTAACATCCAAAATATATAAGG + Intergenic
1031529709 7:122861479-122861501 TTTAATATCCAGAATATGCAAGG - Intronic
1031772399 7:125861020-125861042 TTTAATATCCAGAATCTGTAAGG - Intergenic
1031807162 7:126321177-126321199 TTTCAGGTCAAAAATATGGAGGG + Intergenic
1032215079 7:129951788-129951810 TGTCATACCCACAATATGGAGGG + Intronic
1033845422 7:145426360-145426382 ATTCACATCCAAAATCTGTAGGG - Intergenic
1035348185 7:158221841-158221863 TTTAATATCCAGAATCTGTAAGG + Intronic
1035823918 8:2624020-2624042 GCTAACATCCAGAATATGTAAGG + Intergenic
1036261462 8:7244002-7244024 TTCCACATGCAGAAGATTGAAGG - Intergenic
1036313502 8:7702546-7702568 TTCCACATGCAGAAGATTGAAGG - Intergenic
1037496975 8:19449971-19449993 CTTAAAATCTAGAATATGGAAGG + Intronic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1040671499 8:49697012-49697034 TTTCACATCAATCTTATGGATGG + Intergenic
1041239553 8:55837903-55837925 TTTCACATAATGAAAATGGAAGG - Intergenic
1041505034 8:58587257-58587279 TTTCTGATCCAGAAGCTGGAAGG - Intronic
1041827065 8:62107892-62107914 TTTAACATCCAGAATCTATAAGG + Intergenic
1042018573 8:64344745-64344767 ATACACTTCCAGAAAATGGAGGG + Intergenic
1042219207 8:66456999-66457021 CTTAACATCTAGAATATGCAGGG + Intronic
1043093284 8:75931426-75931448 TTTAACATCCAGAATCTAGAAGG + Intergenic
1043414765 8:80035417-80035439 TATCATATCCAGAATATGAAGGG + Intronic
1044666589 8:94639669-94639691 TTTCACATCATGAATATGAACGG + Intergenic
1046490464 8:114945808-114945830 TTTTACATCCAAAGTATGTAAGG + Intergenic
1047690423 8:127347413-127347435 GCTAACATCCAAAATATGGAAGG - Intergenic
1048096104 8:131296714-131296736 ATTCATATCCAGAATATGTAAGG - Intergenic
1048189049 8:132271758-132271780 TTCCACATCCAGAAAAGGAAAGG - Intronic
1050979179 9:11987404-11987426 TTTAACATCCAGAATCTATAAGG - Intergenic
1051319199 9:15882319-15882341 ATTAACAACCAGAATATGCAAGG - Intronic
1051982182 9:23034076-23034098 ATCAATATCCAGAATATGGAAGG + Intergenic
1053546597 9:39029059-39029081 TTTCACAGCCAGAATCAGAAAGG - Intergenic
1053640276 9:40068064-40068086 TTTGATATCCAGAATATATAAGG + Intergenic
1053765859 9:41397413-41397435 TTTGATATCCAGAATATATAAGG - Intergenic
1053810915 9:41850719-41850741 TTTCACAGCCAGAATCAGAAAGG - Intergenic
1054320973 9:63664068-63664090 TTTGATATCCAGAATATATAAGG + Intergenic
1054544471 9:66308570-66308592 TTTGATATCCAGAATATATAAGG - Intergenic
1054619679 9:67336720-67336742 TTTCACAGCCAGAATCAGAAAGG + Intergenic
1055229668 9:74046966-74046988 TTTAACATCCAAAATATATAAGG - Intergenic
1056240496 9:84641753-84641775 TTTCACATTCAATAAATGGAAGG + Intergenic
1056448202 9:86687091-86687113 TTTCTCATCCACAATTTGGCTGG - Intergenic
1056733704 9:89186304-89186326 TTAGAAATACAGAATATGGAGGG - Intergenic
1057730030 9:97600470-97600492 TTTCACATCCATCATAAGGTTGG - Exonic
1058454274 9:105124801-105124823 TTACACAACCAGAATATAAATGG - Intergenic
1058831298 9:108819497-108819519 TCTCATATCCAGAATCTTGAAGG + Intergenic
1058838621 9:108882929-108882951 TTTAATATCCAGAATATGTAAGG - Intronic
1058969693 9:110069514-110069536 TGCCCCATCAAGAATATGGAAGG - Intronic
1059302653 9:113327575-113327597 TTTGTCATCCTGAATATTGATGG + Intronic
1059895050 9:118855384-118855406 TTTTACATCCATATTAAGGATGG - Intergenic
1060431153 9:123552361-123552383 TTACACATCCACCTTATGGAAGG + Intronic
1202788045 9_KI270719v1_random:51136-51158 TTTAATATCCAGAATATATAAGG + Intergenic
1185524035 X:763329-763351 TGTGACATCCAGATGATGGAGGG + Intergenic
1186740402 X:12511461-12511483 TTTCACTTCCAGAATTTGTTTGG - Intronic
1187228994 X:17403136-17403158 TTCCCCATCCAGCATATGGGTGG - Intronic
1187305576 X:18092416-18092438 ATTAATATCCAGAATATGCAAGG - Intergenic
1187651576 X:21414451-21414473 ATTAACAACCAGAATATGTAAGG - Intronic
1188279565 X:28248137-28248159 TTTCAAATACTGAATATGCACGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188724613 X:33567130-33567152 GTTAACATCCAGAATATTTAAGG - Intergenic
1188913484 X:35879986-35880008 TATCACAGCCAGATTATGGAAGG + Intergenic
1188961283 X:36495081-36495103 GTTGACATCCAGAATATATAAGG - Intergenic
1189422554 X:40869265-40869287 GTTAATATCCAGAATATGGAAGG - Intergenic
1189658596 X:43274126-43274148 GTTAATATCCAGAATATGTAAGG - Intergenic
1189658603 X:43274182-43274204 GTTAATATCCAGAATATGTAAGG - Intergenic
1189894374 X:45638960-45638982 TCTAACATCCAGAATATATAAGG + Intergenic
1191196794 X:57732437-57732459 TTTCTTATCCAGACTATGGGAGG + Intergenic
1191964026 X:66736553-66736575 AGTCATATCCAGAATATAGAAGG - Intergenic
1192110809 X:68362098-68362120 TTTAATATCCAAAATATGTAAGG - Intronic
1193602100 X:83520063-83520085 TATCACAACCAAAATATTGATGG - Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194518991 X:94895122-94895144 TCTAAGATCCAGAATATGTAAGG - Intergenic
1194786573 X:98092184-98092206 TTTAATATCCAGAATCTGTAAGG - Intergenic
1195353911 X:104020351-104020373 GTTAATATCCAAAATATGGAAGG + Intergenic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1196395081 X:115251741-115251763 GTTAATATCCAGAATATGTAAGG + Intergenic
1196536895 X:116856779-116856801 TTTAATAACCAGAATATGTATGG + Intergenic
1196966236 X:121058499-121058521 GCTAACATCCAGAATATGCAAGG - Intergenic
1197333093 X:125179199-125179221 TTTCACTTCCGGAATGTGAATGG + Intergenic
1197542360 X:127780302-127780324 GTTCACATCCAAAATATATAAGG - Intergenic
1198180947 X:134208541-134208563 TTTCACTTCCAGAACTTTGATGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199405743 X:147457440-147457462 TTTAATATCCAGAATCTGTAAGG + Intergenic
1199951444 X:152709103-152709125 TTTAACTTCCATAATGTGGATGG - Intergenic
1199958239 X:152759358-152759380 TTTAACTTCCATAATGTGGATGG + Intergenic
1202106637 Y:21376269-21376291 CCTGAAATCCAGAATATGGAGGG - Intergenic