ID: 1118227956

View in Genome Browser
Species Human (GRCh38)
Location 14:63920714-63920736
Sequence CCGTGGAGATGGAGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 2, 2: 10, 3: 104, 4: 650}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118227948_1118227956 11 Left 1118227948 14:63920680-63920702 CCCGAGAAAGAATGGTGTCCTGA 0: 1
1: 0
2: 3
3: 15
4: 224
Right 1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG 0: 1
1: 2
2: 10
3: 104
4: 650
1118227947_1118227956 14 Left 1118227947 14:63920677-63920699 CCACCCGAGAAAGAATGGTGTCC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG 0: 1
1: 2
2: 10
3: 104
4: 650
1118227949_1118227956 10 Left 1118227949 14:63920681-63920703 CCGAGAAAGAATGGTGTCCTGAT 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG 0: 1
1: 2
2: 10
3: 104
4: 650
1118227953_1118227956 -7 Left 1118227953 14:63920698-63920720 CCTGATGTAGAGGTGGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG 0: 1
1: 2
2: 10
3: 104
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118227956 Original CRISPR CCGTGGAGATGGAGAGAAAT AGG Intronic
901807587 1:11748161-11748183 CCTTGGAGATGACGGGAAATGGG + Intronic
902165423 1:14567233-14567255 CCTAGGAGAGGGAAAGAAATGGG + Intergenic
902736339 1:18403775-18403797 GTGTGGAGATGGACAGACATAGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903561118 1:24228626-24228648 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
903662970 1:24989941-24989963 CACTGGAGGTGGGGAGAAATGGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904202486 1:28830097-28830119 CTGAGGAGAGGGAGAGAGATGGG + Intronic
904254744 1:29247819-29247841 CCGTGGAGATGGCAAGATGTTGG + Intronic
904784951 1:32975838-32975860 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
904990550 1:34589309-34589331 CCTTGGAGATGGAGAGGTCTGGG - Intergenic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907534453 1:55137018-55137040 TCAGGGAGATGAAGAGAAATTGG + Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908397734 1:63741543-63741565 CCAAGGAGAGGGAGAGATATGGG - Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908651473 1:66337558-66337580 CCCTGGAGATGGAAGGACATGGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909418225 1:75431778-75431800 CCGAGGAGAAGGGGAGGAATAGG + Intronic
909844049 1:80368064-80368086 CCCAGGAGATGAAGAGAGATGGG - Intergenic
909907295 1:81213585-81213607 CCCTGGAGATGGGGAGAGAGTGG + Intergenic
910151536 1:84153092-84153114 CCAAGGAGAGGGAGAGAAATGGG + Intronic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911649646 1:100373254-100373276 CCAAGGAGAGGGAGAGAGATGGG + Intronic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913993592 1:143637086-143637108 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
914356759 1:146892283-146892305 CTGTGGAGAAGCAGAAAAATGGG + Intergenic
914774574 1:150724751-150724773 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
915585052 1:156840023-156840045 CCATGTAGATGGAGAGATAATGG + Intronic
916191587 1:162184159-162184181 CTGAGGAGAGGGAGAGAGATGGG + Intronic
916261549 1:162847248-162847270 CCTTGGAGCTAGATAGAAATAGG + Intronic
916304278 1:163311610-163311632 CCAAGGAGAGGGAGAGAGATGGG + Intronic
916800204 1:168208718-168208740 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
917859721 1:179134717-179134739 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
917866373 1:179199506-179199528 CTGTGAAGATGTAGAGAGATTGG - Intronic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
919436051 1:197562634-197562656 CTGAGGAGAGGGAGAGAGATGGG - Intronic
919448834 1:197745440-197745462 CCCAGGAGAGGGAGAGAGATGGG + Intronic
919487881 1:198166605-198166627 CCAAGGAGAGGGAGAGAGATGGG + Intronic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
920678030 1:208051877-208051899 CCCTGAAGATGTAGAGAATTTGG - Intronic
921192604 1:212724200-212724222 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
922588639 1:226755220-226755242 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923264841 1:232304456-232304478 CCCTGGAGATAGAGAGCAAATGG - Intergenic
923294116 1:232576482-232576504 CTGAGGAGAGAGAGAGAAATGGG - Intergenic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
923763157 1:236866420-236866442 CCGAGGAAAGGGAGAGAGATGGG - Intronic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924692098 1:246362446-246362468 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
1064484911 10:15776359-15776381 TGGTGAAGATGGGGAGAAATTGG - Intergenic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065111589 10:22445221-22445243 AACTGGAGAAGGAGAGAAATGGG + Intronic
1065503458 10:26404474-26404496 GCGAGGGGAGGGAGAGAAATAGG + Intergenic
1065645294 10:27827630-27827652 CCCTGGAGATGAAGAGAAATGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066050888 10:31633852-31633874 CCAAGGAGAAGGAGAGAGATTGG - Intergenic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1066374676 10:34846918-34846940 CCGAGGAGAAGGAGAGAGACAGG - Intergenic
1067559991 10:47298485-47298507 ACATGGAGAAGGAGGGAAATGGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068090534 10:52427645-52427667 CAGTGGAGAGGGAGATATATGGG - Intergenic
1068107066 10:52631782-52631804 CCTTGGAGGTGGAAAGAATTAGG + Intergenic
1068700392 10:60013684-60013706 CCAAGGAGAGGGAGAGATATGGG + Intergenic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069893155 10:71664473-71664495 CCGTGGAGGTGGAGCGGAAGTGG - Intronic
1070656822 10:78277394-78277416 CCCTGGAAAGGGAGAGAAACAGG - Intergenic
1070972512 10:80579135-80579157 GCCTGGTGATGGAGAGAGATGGG + Intronic
1071851653 10:89577742-89577764 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1072565345 10:96612328-96612350 CCCTGGGGTTGGAGAAAAATGGG + Intronic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073772292 10:106748479-106748501 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076011926 10:126995671-126995693 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076262294 10:129076424-129076446 CACAGGAGATGGAGAGAGATAGG - Intergenic
1076619778 10:131779781-131779803 TCGTGGAGATGGAGAGGCCTTGG - Intergenic
1076914506 10:133415176-133415198 CCGTGGAGAGGGAGAGGGAGCGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077263758 11:1638506-1638528 CCCTGGAGAGGGAGAGAGATAGG - Intergenic
1077347306 11:2068835-2068857 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1077680598 11:4237161-4237183 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077684876 11:4282559-4282581 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077690314 11:4335371-4335393 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078442594 11:11379675-11379697 CGATGGAGATGGAGACCAATAGG - Intronic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080842330 11:35996289-35996311 CCGAGGAGAGGTAAAGAAATTGG + Intronic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081457311 11:43236650-43236672 CCGAGGAGAGTGAGAGAAACAGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083062867 11:59892413-59892435 CCGCCGAGATGGAAATAAATGGG - Intergenic
1083135199 11:60667226-60667248 CCAAGGAGATGGAGAGAGACAGG - Intergenic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084527965 11:69709090-69709112 CCATGGAGCAGGAGGGAAATGGG + Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1085122869 11:73978400-73978422 CCCAGGAGATGGAGAAAAACTGG + Exonic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085436513 11:76508936-76508958 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1085534460 11:77209674-77209696 AGGTGGTGATGGAGAGACATGGG - Intronic
1086318608 11:85620299-85620321 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1086896968 11:92324454-92324476 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1087484115 11:98739570-98739592 CCTTTAAGTTGGAGAGAAATAGG + Intergenic
1087913954 11:103786394-103786416 CAGAGGAGAGGGAGAGAGATGGG + Intergenic
1088567875 11:111192130-111192152 CAGAGGAGAGGGAGAGACATGGG - Intergenic
1089061857 11:115632256-115632278 CCTTGGAGAAGGAGAGGAATGGG + Intergenic
1090147786 11:124345098-124345120 CTGAGGAGAGGGAGAAAAATGGG - Intergenic
1090350002 11:126101784-126101806 CCTTGGAGATGGCCTGAAATTGG - Intergenic
1090398051 11:126432160-126432182 ACCTGGAGATGGAGGGAAAGGGG - Intronic
1090557104 11:127888021-127888043 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
1091869814 12:3879726-3879748 CCGAGGAGAGGGAGAGACACAGG + Intergenic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092464996 12:8723283-8723305 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092655802 12:10684431-10684453 CCGTGGAGAGAGAAAGAAGTGGG + Intergenic
1093635233 12:21458689-21458711 CCAAGGAGAGGGAGAGACATAGG + Intronic
1093838297 12:23864258-23864280 CCGAGTAGAGGGAGAGAGATGGG - Intronic
1093883737 12:24436062-24436084 CCAAGGAGAGGAAGAGAAATGGG - Intergenic
1094280111 12:28727559-28727581 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1094280686 12:28734271-28734293 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1094754423 12:33449728-33449750 CCGATGAGAGGGAGAGAGATAGG - Intergenic
1095068999 12:37815893-37815915 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1095936870 12:47693243-47693265 CCAAGGAGAAGGAGAGAGATGGG + Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096259041 12:50079652-50079674 CGATGTAGATGGAGAGAACTAGG - Intronic
1096398594 12:51286757-51286779 CTGTGCTGATGGAGAGAGATAGG - Intronic
1096440326 12:51637204-51637226 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096755233 12:53793937-53793959 CCGTGGTTATAGAAAGAAATAGG - Intergenic
1097206517 12:57326144-57326166 CCAAGGAGAGGGAGAGAGATCGG - Intronic
1097328494 12:58306587-58306609 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1097652842 12:62323094-62323116 CAATGGACATTGAGAGAAATAGG - Intronic
1097659518 12:62414023-62414045 ACATGGAGAGGGAGAGAGATGGG + Intronic
1097788607 12:63789256-63789278 CCAAGGAGATGGGGAGAAATGGG + Intronic
1097936484 12:65257593-65257615 CCGAGGAGAGGGAGAAAGATGGG + Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099461369 12:82925762-82925784 CCATGGAAAGGGAGAGAAATTGG - Intronic
1100069225 12:90690989-90691011 CCCAGGAGAGGGAGAGGAATAGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100927299 12:99563456-99563478 CTGAGGAGAGGAAGAGAAATAGG + Intronic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1102570561 12:113824792-113824814 CCGTGGAGATGATGAGAAACGGG - Intronic
1103250595 12:119496637-119496659 CCGTGAAGATGAAAAGAAATGGG - Intronic
1103948913 12:124541218-124541240 AGGTGGAGATGGAGGGAGATGGG + Intronic
1104113614 12:125727357-125727379 CCTAGGAGAGGGAGAGAGATAGG - Intergenic
1104501740 12:129292957-129292979 CAGTGGAGAAGTAGAGATATTGG + Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104635277 12:130434653-130434675 CCGTGGAGATCAAGAGACATGGG - Intronic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106560379 13:30840578-30840600 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1106769222 13:32945418-32945440 CCTTGGAGATGGGGAGAAATGGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108889264 13:55232864-55232886 ACGTTGAGAAGCAGAGAAATGGG - Intergenic
1109465272 13:62723503-62723525 CCGATATGATGGAGAGAAATTGG + Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110388394 13:74942177-74942199 CCGAGAAGATGGAAATAAATTGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1110661498 13:78063267-78063289 CCATGGAGATAAAGAGAAATAGG - Intergenic
1110800020 13:79683907-79683929 ACGTGGAGAGAGAGAGAAAAAGG - Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111388420 13:87561001-87561023 CCGTGGAGAGGGAGAGGTAGAGG - Intergenic
1111388427 13:87561028-87561050 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111388435 13:87561055-87561077 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111640517 13:90963853-90963875 CCGAGGAGAAGGAGAGAGATGGG - Intergenic
1112521151 13:100096422-100096444 CTGAGGAGAGGGAGAGACATAGG - Intronic
1112556236 13:100471183-100471205 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1117764490 14:59066812-59066834 CCGAGGAGAGGGTGAGAGATGGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119663979 14:76471204-76471226 CCATGGAGATGAAGAAAAGTAGG - Intronic
1119835572 14:77746927-77746949 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120262590 14:82205653-82205675 CGGTGAAGATGGGGAGAAAAGGG - Intergenic
1120550399 14:85864370-85864392 GCTTTGAGATAGAGAGAAATGGG + Intergenic
1121031111 14:90659519-90659541 CCATGGAAAGGGAGAGAAAAGGG + Intronic
1121303242 14:92888611-92888633 CCATGGAGGTGGAGAAAAGTGGG + Intergenic
1121827191 14:97019919-97019941 ATGGGGAGATGGGGAGAAATTGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122251647 14:100444210-100444232 CCGTGAAAATGGAAGGAAATTGG + Intronic
1122522709 14:102356868-102356890 CCAAGGAGATGGGGAGAAAGGGG - Intronic
1122662577 14:103307649-103307671 CTGAGGAGTTGGAGAGAGATGGG + Intergenic
1123067188 14:105624665-105624687 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123071207 14:105643392-105643414 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123076169 14:105668435-105668457 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123090867 14:105741662-105741684 CCGTGGAGTGGGAGAGCAATGGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124255398 15:28137670-28137692 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124568912 15:30841952-30841974 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1127307609 15:57723417-57723439 CCATGGAGAGGGAGAGAGTTGGG - Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1127804852 15:62509847-62509869 CCGTTGAGGTGGAGAGAATCCGG + Intronic
1128722577 15:69961588-69961610 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1129101101 15:73264943-73264965 CGGTGCTGAGGGAGAGAAATGGG + Intronic
1129459331 15:75692589-75692611 CCATGGTGCTGCAGAGAAATTGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129724629 15:77895297-77895319 CCGTGGTGCTGCAGACAAATTGG - Intergenic
1129798467 15:78395847-78395869 TCGTGGAGCTGGAAAGAACTTGG + Intergenic
1130129831 15:81130837-81130859 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1130684670 15:86026203-86026225 CCGTGGGAAAGGAGAAAAATGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131909948 15:97187307-97187329 CGGAGGAGATGAAGAGAGATGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1136237992 16:28926038-28926060 CGCTGGAGATGGAGAAAAAGGGG - Intronic
1137900929 16:52268183-52268205 CCGAGGAGAGGGAGAGAGATGGG - Intergenic
1138256012 16:55561541-55561563 CCGTGAAGATGGAGGGCATTTGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139425694 16:66878709-66878731 CCCTGGAGACAGAGAAAAATGGG - Intronic
1139977255 16:70823170-70823192 CTGTGGAGAAGCAGAAAAATGGG - Intronic
1140892570 16:79297821-79297843 CCCTATAGATGGAAAGAAATTGG - Intergenic
1141349628 16:83282078-83282100 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142496859 17:310556-310578 ATGTGGAGATGGAGATAAACAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1142826211 17:2512945-2512967 ACGTGGACAGGGAGAGAACTTGG - Intergenic
1143083991 17:4402251-4402273 ATGTGAAGATGGAGAGAGATTGG + Intergenic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1143479884 17:7222093-7222115 CGGAGGAGAAGGGGAGAAATGGG - Intronic
1144196681 17:12901517-12901539 ACCTGAAGATGGAGAAAAATCGG + Intronic
1144505279 17:15824149-15824171 CAGTGAAGATGTGGAGAAATCGG - Intergenic
1144645239 17:16969056-16969078 CGGTGAAGATGTGGAGAAATTGG + Intronic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1145169456 17:20642023-20642045 CGGTGAAGATGTGGAGAAATCGG - Intergenic
1145277729 17:21444528-21444550 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1145713997 17:27002345-27002367 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146903497 17:36602717-36602739 CCCTGGCGAGGGAGAGAAAGGGG + Intronic
1146947629 17:36884735-36884757 CCGTGAAAATGGCGACAAATCGG - Intergenic
1147049374 17:37780054-37780076 CCGAGGAGTGGGAGAGAGATGGG - Intergenic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149149075 17:53537271-53537293 CCCTGGGTATGGAGAGTAATGGG + Intergenic
1149299412 17:55290593-55290615 CCAAGGAGAGGGAGAGAAATGGG - Intronic
1149901946 17:60488494-60488516 GCCTGGTGTTGGAGAGAAATGGG + Intronic
1150509350 17:65733182-65733204 CCAAGGAGATGGAGAGAGATGGG + Intronic
1150639087 17:66937589-66937611 GCAAGAAGATGGAGAGAAATAGG - Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1152464426 17:80457870-80457892 GCGTGGGGATGGAGAGAGAGTGG - Intergenic
1152729953 17:81964950-81964972 TCCAGGAGATGGAGAGAAACAGG + Intergenic
1153133183 18:1881397-1881419 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1153292801 18:3518220-3518242 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1153390575 18:4553246-4553268 TGGTGAAGATGCAGAGAAATTGG - Intergenic
1153546338 18:6209502-6209524 CAGTGAAGATGTGGAGAAATTGG + Intronic
1153566416 18:6422727-6422749 CCAAGGAGAAGGAGAGAGATGGG + Intergenic
1153605722 18:6829295-6829317 CTGTGGAGCTGGACTGAAATTGG - Intronic
1153871729 18:9327342-9327364 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1154207371 18:12349085-12349107 GCGTTCAGAAGGAGAGAAATAGG + Intronic
1154227642 18:12521926-12521948 CCCAGGAGAGGGAGAGAGATGGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155692277 18:28639787-28639809 CAGTGAAGATGTGGAGAAATTGG - Intergenic
1155855199 18:30825488-30825510 TGGTTGAGATGGACAGAAATGGG + Intergenic
1155896124 18:31329223-31329245 CCATGACGATAGAGAGAAATGGG - Intronic
1155990453 18:32274145-32274167 CCCTTAAGATGCAGAGAAATAGG - Intronic
1156280883 18:35637087-35637109 CCGAGGAGAGGGAGAGAGACAGG - Intronic
1156676059 18:39528610-39528632 CCTTGGAGATGGGCAGAACTTGG + Intergenic
1156680665 18:39584880-39584902 CCCTTAAGATGGAAAGAAATAGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157011561 18:43655191-43655213 CCGAGGGGAGGGAGAGAATTAGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1158919187 18:62170557-62170579 CCAAGGAGAGGGAGAGAGATGGG - Intronic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1162776456 19:12982779-12982801 ACATGGAGATGGAGAGACATGGG - Intergenic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1164064878 19:21707362-21707384 CCGTGGAGAGGGATAGGGATAGG - Intergenic
1164168706 19:22703853-22703875 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1164475027 19:28569115-28569137 CCCTGGAGAAAGAGAGAGATGGG + Intergenic
1165065161 19:33224514-33224536 CCCTGGAGATGGAGAAAGTTTGG - Intronic
1165397475 19:35573534-35573556 CCTTGGAAATGGGGAGAAAAAGG - Intergenic
1166147818 19:40849545-40849567 CCTTAGAGATGGAGAGAGAGGGG + Intronic
1166559766 19:43724596-43724618 CAGTGGAAATGCTGAGAAATTGG + Intergenic
1167142896 19:47664570-47664592 CCGTGGGGATGGGGAGGGATCGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926449977 2:12991213-12991235 CAGAGGAGAGGGAGAGAGATGGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
927439114 2:23097843-23097865 ATTTGGAGAAGGAGAGAAATTGG - Intergenic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
928264011 2:29794664-29794686 CCAAGGAGATGGAGAGAGTTAGG + Intronic
928443905 2:31316118-31316140 CTGTGGAAATGAAGAGACATGGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
931013670 2:57949577-57949599 CCAAGGAGGGGGAGAGAAATAGG - Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931279609 2:60777780-60777802 CTGAGGAGAGGGAGAGAGATGGG + Intronic
931604917 2:64042472-64042494 CCGTGGAGAGGGAGAGGGAGGGG + Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932281091 2:70492447-70492469 GCCTGGCGATGGTGAGAAATGGG - Intronic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933630112 2:84646289-84646311 CCAAGGAGAAGGAGAGAGATGGG - Intronic
935832200 2:107011803-107011825 CCTTGGAGCAGGAGAGAAAGAGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937547065 2:123035900-123035922 CCATTACGATGGAGAGAAATTGG + Intergenic
938227668 2:129629958-129629980 ATGTGGATATAGAGAGAAATAGG - Intergenic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939696379 2:145329937-145329959 CCGAGGAAATGGATAAAAATAGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
941538301 2:166749452-166749474 CCTAGAAGATGGAGATAAATAGG + Intergenic
943039929 2:182792383-182792405 CCTTGGGGAAGGAAAGAAATTGG - Exonic
943531666 2:189089881-189089903 CCATGGAGAGGAAGAGAGATGGG - Intronic
943695106 2:190918852-190918874 CCAAGGAGAGGGAGAGAGATGGG + Intronic
943740833 2:191406581-191406603 CCGAGGAGAGGGAGAGAGATGGG + Intronic
943799597 2:192041789-192041811 CCGTAGAAAAGGAGAGAGATGGG + Intronic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
945646787 2:212506240-212506262 CCAAGGAGAGGGAGAGAGATGGG - Intronic
945654544 2:212607156-212607178 CAGTGGAGGTGGTAAGAAATGGG - Intergenic
945683810 2:212944862-212944884 ACCTAGAGATGGAGAGAAATTGG + Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946901246 2:224374016-224374038 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947497558 2:230649259-230649281 CCTTGGAGATGGCAAGAATTAGG + Intergenic
947540961 2:230977753-230977775 CCGTGGAGGTGGGAAGGAATGGG + Intergenic
947554013 2:231073092-231073114 CCAAGGAGAAGGAGAGAGATGGG + Intronic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
948821943 2:240554328-240554350 TCGTGGAGATGGAAAGAGAGAGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169653886 20:7900656-7900678 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1169836702 20:9888278-9888300 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1170287368 20:14724998-14725020 TTCTGGAGATGGAGACAAATGGG + Intronic
1171251342 20:23651016-23651038 CCGAGGAGAGGGAGAGAGATGGG + Intergenic
1171313173 20:24162500-24162522 CCGAGGAGAGGGAGAGAGACGGG - Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172042336 20:32054195-32054217 CCCTGGGGAGGGAGAGAAACAGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173597514 20:44268720-44268742 CCATGGAGTGGGAGAGAACTGGG + Intronic
1173768228 20:45633199-45633221 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1173910723 20:46668047-46668069 CTGAGGAGAGGGAGAGAGATTGG - Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1176735847 21:10546348-10546370 CCAAGGAGAAGGAGAGAGATGGG - Intronic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1176946046 21:14982995-14983017 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1177681767 21:24380322-24380344 CCGTGAGGATGTGGAGAAATAGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178226506 21:30725405-30725427 GCAAGGAGAGGGAGAGAAATTGG + Intergenic
1178592193 21:33920798-33920820 CCATAGAGATGGAAAGAGATGGG - Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1179540445 21:42080031-42080053 CCGTGGGGCTGGGAAGAAATGGG - Intronic
1179772045 21:43628051-43628073 CCTAGGAGAGGGAGAGAAACGGG - Intronic
1179803176 21:43821578-43821600 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1180667775 22:17528368-17528390 CCGTGGAGATAGAGGGGAAAAGG + Intronic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181786006 22:25227827-25227849 CCATGGAGACAGAGAGAAAGGGG - Intronic
1181970978 22:26689848-26689870 AGGAGGAGAAGGAGAGAAATGGG - Intergenic
1182726573 22:32451735-32451757 AGGTGGAGATGGGGAGAAACAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183533304 22:38376522-38376544 CCAAGGAGAAGGAGAGAGATGGG + Intronic
1183672257 22:39280020-39280042 CCTGGGAGCTGGAGAGAATTGGG + Intergenic
1184337373 22:43861943-43861965 CCGTGGAGATGGAGCCTATTTGG - Intronic
1184831212 22:46989545-46989567 CCGAGGAGAGGGAGAGAGATGGG + Intronic
1185096933 22:48814003-48814025 CAGAGGAGAGGGAGAGAGATGGG - Intronic
1185237755 22:49724777-49724799 CCGTGGAGAGGGAGAGACCGCGG - Intergenic
949165160 3:931597-931619 CCATGGAGGTGGGGAGAAGTGGG - Intergenic
949809803 3:7994377-7994399 CCAAGGAGATGGAGAGAGAAAGG - Intergenic
949961081 3:9313050-9313072 CCTTGTAGATGGGGAGCAATGGG - Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950130026 3:10536007-10536029 CGATGAAGATGCAGAGAAATTGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950576561 3:13835514-13835536 CCATGGGGATGCAGAGCAATGGG + Intronic
950700326 3:14740296-14740318 CCAAGGAGATGGAGAGAAACAGG + Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
952201187 3:31129577-31129599 CTGAGGAGAGGGAGAGAAACAGG + Intergenic
952393314 3:32899535-32899557 CCTTGGAGGTTGAGAGGAATTGG + Intergenic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953174443 3:40537022-40537044 CTGAGGAGAGGGAGAGAGATGGG - Exonic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954908509 3:54083688-54083710 TCTTAGAAATGGAGAGAAATAGG + Intergenic
955211156 3:56942505-56942527 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955290344 3:57686770-57686792 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955416614 3:58697870-58697892 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957069749 3:75557848-75557870 CCATGGAAATGGGGTGAAATGGG + Intergenic
957596036 3:82268077-82268099 TGGTGGAGAGAGAGAGAAATAGG + Intergenic
957955744 3:87184908-87184930 CTGAGGAGAAGAAGAGAAATAGG + Intergenic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
959107148 3:102077436-102077458 CAGTGGTCATGGAAAGAAATGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960179065 3:114553015-114553037 ACGTGGATTTGGAGAGAAAAGGG - Intronic
960258867 3:115542033-115542055 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960669001 3:120138943-120138965 CGGAGGAGAGGGAGAGAGATGGG - Intergenic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
962033478 3:131626098-131626120 CCAAGGAGAGGGAGAGAGATGGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963562844 3:146888277-146888299 CCTTGGAAATTGAGACAAATTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963773257 3:149411164-149411186 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
964628394 3:158781491-158781513 ACATAAAGATGGAGAGAAATGGG - Intronic
965005391 3:163016296-163016318 CCCTGGAGAGGGAGAGAGACTGG - Intergenic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966542846 3:181111031-181111053 CAGTGAAGATCGGGAGAAATGGG - Intergenic
966750872 3:183320980-183321002 CCGAGGAGAGGGAGAGAGACAGG + Intronic
966783678 3:183607336-183607358 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
967367057 3:188699244-188699266 ACGTGGAGACGGAGAGAGGTGGG + Intronic
967603646 3:191418099-191418121 CCGAGGTGAGGGAGAGAAATAGG - Intergenic
967926978 3:194658094-194658116 TCGTAGAGATGGAGAGACTTAGG - Intronic
968877840 4:3283517-3283539 CCATTGAGATGAAGACAAATTGG + Intergenic
970937961 4:21596911-21596933 CCGAGGAGATGGAGAGCCAGTGG + Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971071164 4:23093848-23093870 CCCTGCAAATGGAGAGAGATAGG - Intergenic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971848546 4:31951686-31951708 CCATGGCGGTGGAGTGAAATTGG - Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972580193 4:40388342-40388364 CCGTGGAGACAGAGAGTGATGGG + Intergenic
972760640 4:42100141-42100163 AGGAGGAGATGGGGAGAAATTGG - Intergenic
972768964 4:42178219-42178241 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
973290823 4:48468656-48468678 CCAAGGAGATGGAGAGCATTAGG - Intergenic
975023818 4:69524398-69524420 CAGAGGAGAGGGAGAGAGATGGG + Intronic
975063650 4:70036933-70036955 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
979823237 4:125200548-125200570 CCGAGGAGAGGGAGAGAGACGGG - Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980221316 4:129919637-129919659 CCAAGGAAATGGAGAGAGATAGG - Intergenic
980616348 4:135230481-135230503 CCAGAGAGATGGAGAAAAATGGG - Intergenic
980869966 4:138600027-138600049 CCGAAGAGAGGAAGAGAAATGGG - Intergenic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981493012 4:145361191-145361213 CTGAGGAGAGGGAGAGAGATAGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981911017 4:149981963-149981985 CCGAGGAGATGAAGAGAGAATGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982152765 4:152480385-152480407 CTGAGGAGAGGGAGAGAGATAGG - Intronic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
982681691 4:158438771-158438793 CCGAGGAGAGGAAGAGAGATGGG - Intronic
983044689 4:162972042-162972064 TTTTGGAGATGGAGAGATATGGG - Intergenic
983651566 4:170041326-170041348 CCCTGAAGATGGAGAGTCATAGG + Intergenic
983987405 4:174076269-174076291 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
984637137 4:182123518-182123540 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
985789365 5:1916886-1916908 CCCTGGAGAGGGAGGGACATGGG + Intergenic
987544435 5:19294633-19294655 GGGTGGAGATGAAGAGAGATTGG - Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
989021680 5:37014217-37014239 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
989532380 5:42523618-42523640 CAGAGGAGAGGGAGAGAGATAGG - Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990297913 5:54421349-54421371 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
990481580 5:56216316-56216338 CTGAGGAGAGGGAGAGAGATGGG - Intronic
990697489 5:58436879-58436901 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
990801863 5:59613140-59613162 CCATGGTGATGGTGAGAAATGGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991336239 5:65550421-65550443 CCAAGGAGAGGGAGAGAGATGGG + Intronic
991468537 5:66941879-66941901 CCATGGAGAAGGAAAGAGATGGG + Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991936238 5:71803628-71803650 CCAAGGAGAAGGAGAGAAGTAGG + Intergenic
992253956 5:74903130-74903152 TCGTGAAGATGTAGAGAAAATGG + Intergenic
992548405 5:77838023-77838045 AGATGGAGATGGAGAGAAAATGG + Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993275980 5:85859305-85859327 CTGAGGAGAGGGAGAAAAATGGG + Intergenic
993709402 5:91209254-91209276 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
994851418 5:105058498-105058520 TCAAGGAAATGGAGAGAAATGGG - Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995479110 5:112577655-112577677 CCCTGGAGAAGGTTAGAAATTGG + Intergenic
995715953 5:115082120-115082142 CCCTGGAGATGGAGATCACTGGG - Intergenic
995853592 5:116572474-116572496 GCGTGGAGCGGGAGAGGAATGGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996841966 5:127856736-127856758 CCAAAGAGATGGAGAGATATGGG + Intergenic
997566649 5:134892814-134892836 CTGAGGAGAGGGAGAGAGATGGG + Intronic
997695080 5:135854986-135855008 CTGAGGAGAGGGAGAGAGATAGG + Intronic
998432372 5:142077317-142077339 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
998814548 5:145999628-145999650 CCAAGGAGAGGGAGAGAGATGGG + Intronic
998863657 5:146472572-146472594 CCGAGGAGAGGAAGAGAGATGGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000390386 5:160717220-160717242 GCTTGGAGAAGGAGAGGAATTGG + Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000542530 5:162557991-162558013 CCCGGGAGATGGAGGGAGATGGG + Intergenic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002379304 5:178814230-178814252 CCGTTGAGAGGGAGAGAAGGGGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003013330 6:2447196-2447218 CCGTGCAGATGTGGAGAAAAGGG - Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004437466 6:15610365-15610387 CCAAGGAGAGGAAGAGAAATTGG - Intronic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006925287 6:37650570-37650592 CCCAGGAGATGGAGAGGATTTGG - Intronic
1007382959 6:41502590-41502612 CCATGGAGATGGACAGAGAGAGG + Intergenic
1008271075 6:49490780-49490802 CCAAGGAGAGGGAGAGAAACTGG + Intronic
1008309116 6:49943218-49943240 CAGTTGAGATAGACAGAAATGGG + Intergenic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012012726 6:93810749-93810771 CCAAGAAGAGGGAGAGAAATGGG - Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1013668193 6:112369600-112369622 CTGTGGAGGGGAAGAGAAATTGG + Intergenic
1014034878 6:116754990-116755012 CCAAAGAGAGGGAGAGAAATGGG - Intronic
1014509013 6:122297375-122297397 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016220365 6:141661705-141661727 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
1016235699 6:141862827-141862849 CGCTGCAGATTGAGAGAAATGGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017734674 6:157350484-157350506 CTGAGGAGAGGGAGAGATATAGG - Intergenic
1018076596 6:160221698-160221720 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1019749026 7:2717271-2717293 CCGTGAAGACGGAGAGAATCAGG + Intronic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1019863202 7:3679759-3679781 ACGTCGAGATGTAAAGAAATGGG + Intronic
1020127454 7:5541028-5541050 GGGTGGAGAAGGAGAGAAAAGGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021376569 7:19915143-19915165 CTGAGGAGCAGGAGAGAAATGGG + Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022762408 7:33369662-33369684 CTATGGTGATGGAGAGAGATAGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023026078 7:36050960-36050982 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023773250 7:43579289-43579311 CTGAGGAGAGGAAGAGAAATGGG + Intergenic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024336703 7:48215267-48215289 CCGAGGAGAGGAAGAGAGATGGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025968737 7:66301652-66301674 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1026567240 7:71499676-71499698 CTGTATAGATGAAGAGAAATCGG - Intronic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027950462 7:84808608-84808630 TCTTGGAGAAGAAGAGAAATAGG + Intergenic
1028064940 7:86372083-86372105 CCGAGGAGAGTGAGAGAGATGGG - Intergenic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028300096 7:89188368-89188390 CCAAGGAGAAGGAGAGAGATAGG - Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1029443415 7:100600512-100600534 CCTTGGAGGAGGAGAGAAAGGGG - Exonic
1029526488 7:101097782-101097804 CCATGGCAATGTAGAGAAATGGG - Intergenic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031441522 7:121800459-121800481 GCATGGAAATGGAGAGAATTTGG - Intergenic
1031586077 7:123533766-123533788 GCCTGGAGATGGGGAGAAATGGG + Intronic
1031813500 7:126402686-126402708 CCATGGAAAAGCAGAGAAATAGG + Intergenic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1032374908 7:131403697-131403719 CCAAAGAGAGGGAGAGAAATGGG + Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032730384 7:134636340-134636362 CCGAGGAAATGGGGAGAGATGGG + Intergenic
1032861757 7:135886454-135886476 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1033241597 7:139684245-139684267 CCGAGAAGAAGGAGAGAGATGGG - Intronic
1035173465 7:157033753-157033775 CCGTGCAGATGGACAGAAAGGGG - Intergenic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036485211 8:9173202-9173224 CAGTTGAGATGGAAAGAAAGTGG - Intergenic
1036787333 8:11696990-11697012 CCGGGGAGATGGTGTGAAATAGG + Intronic
1037456032 8:19065303-19065325 ACTTGGTGATGGAGAGAAAGAGG - Intronic
1037543337 8:19893421-19893443 CCGGAGAGATGTGGAGAAATAGG + Intergenic
1037672387 8:21026323-21026345 TCTTAGAGATGGAGAGAAAATGG - Intergenic
1038745051 8:30247881-30247903 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1040061382 8:43106127-43106149 TGGTGAAGATGCAGAGAAATGGG - Intronic
1040068128 8:43165360-43165382 CCAAAGAGAGGGAGAGAAATGGG - Intronic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1040737285 8:50523540-50523562 CCAAGGAGAGGGAGAGAGATGGG + Intronic
1040841070 8:51785721-51785743 CCAAGGAGAGGGAGAGAGATGGG - Intronic
1041401478 8:57450027-57450049 TCTTGGAGAAGCAGAGAAATGGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043689553 8:83133026-83133048 CTGATGAGATGTAGAGAAATGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044639953 8:94368796-94368818 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1044668980 8:94659451-94659473 CCAAGGAGAGGGAGAGAGATGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045563541 8:103289976-103289998 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046147053 8:110174015-110174037 AGGTGGAGAGGGGGAGAAATGGG + Intergenic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046538098 8:115542550-115542572 ACGGGGAGATGGGGAGAAAAAGG + Intronic
1047009897 8:120660882-120660904 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047670086 8:127136615-127136637 GCTGTGAGATGGAGAGAAATAGG - Intergenic
1047703625 8:127474902-127474924 CAGAGGAGATGGGGAGAGATGGG - Intergenic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048902468 8:139051947-139051969 CCAAGGAGATGGAGAGAGATGGG - Intergenic
1049314183 8:141951268-141951290 CCTAGGAGAGGGAGAGAGATGGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051123750 9:13780383-13780405 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1051721617 9:20042968-20042990 CCAAGGAGAAGGAGAGAAATGGG - Intergenic
1052667884 9:31518499-31518521 CCGTGAAGATGGGGAGAAACAGG - Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054733259 9:68722928-68722950 ACGAGGGGATGAAGAGAAATTGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056932791 9:90892726-90892748 CCTTGCAAATGGAGAGAAGTTGG + Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058211509 9:102175098-102175120 CTTTGGATATGGTGAGAAATAGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059301503 9:113317284-113317306 CCTTGGAGATGGAGGATAATGGG + Intronic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059833647 9:118126659-118126681 CTGAGGAGAGGGAGAGACATGGG - Intergenic
1059880119 9:118679057-118679079 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1059880133 9:118679105-118679127 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061221427 9:129254217-129254239 CCTTGGAGAGGGAGAGAGATAGG + Intergenic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1186693002 X:11999219-11999241 CTGTGGACATGGATAGAAACAGG - Intergenic
1187787370 X:22907043-22907065 TCATGGAGATAGAGAGTAATAGG - Intergenic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188469139 X:30517679-30517701 CCGAAGAGAGGGAGAGAGATGGG - Intergenic
1188855624 X:35191682-35191704 GCCTGAAGAGGGAGAGAAATGGG + Intergenic
1189263709 X:39697214-39697236 CCAAGGAGAGGGAGAGAGATGGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190414609 X:50168457-50168479 CGGTGAAGATGTGGAGAAATGGG + Intergenic
1190505439 X:51120472-51120494 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191186536 X:57619216-57619238 CGGTGAAGTTGGGGAGAAATAGG + Intergenic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191713638 X:64178708-64178730 CCCTGTAGTTGGAGAGAATTTGG - Intergenic
1191736622 X:64394843-64394865 CCGTGGAGCTGGAGCGAGAGTGG + Intronic
1191894361 X:65976060-65976082 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192886572 X:75341573-75341595 CCGTGGAGATAGGGAGTAAAAGG - Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1194588571 X:95769036-95769058 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1194704044 X:97152762-97152784 CCATGGAGGTGTTGAGAAATAGG - Intronic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195293447 X:103451418-103451440 GCCTGGAAATGGAGAGAGATAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1196063906 X:111441804-111441826 CTCTGGAAAGGGAGAGAAATGGG + Intergenic
1196260362 X:113572158-113572180 CCAAGGAGAGGGAGAGAAACAGG + Intergenic
1196504771 X:116428468-116428490 CCAAGGAGAAGGAGAGAGATGGG - Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1196968436 X:121083641-121083663 CCTTGGAAATTGAGAGCAATTGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197462339 X:126757761-126757783 CTGTGGAGATGCATAGATATTGG + Intergenic
1197707604 X:129646027-129646049 CCGTGGGGAAGGGGAGAAAGTGG - Exonic
1197972444 X:132129647-132129669 CCGTGGAGGAGGCTAGAAATAGG + Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198323142 X:135539794-135539816 CTGAGGAGAGGGAGAGAGATAGG + Intronic
1198490593 X:137136394-137136416 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1198816965 X:140601754-140601776 CCATGAAGATGTTGAGAAATAGG - Intergenic
1199066953 X:143430657-143430679 CCCATGAGATGGAAAGAAATGGG + Intergenic
1199103021 X:143827994-143828016 CTGAGGAGATGAAGAGAGATAGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1199862642 X:151815623-151815645 CCATGGAGCAGAAGAGAAATTGG + Intergenic
1200071466 X:153531395-153531417 GCCTGGAGGTGGAGAGAGATGGG + Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201143724 Y:11049991-11050013 CCAAGGAGAGGGAGAGAGATGGG - Intergenic
1201447702 Y:14076433-14076455 CCCTGGAGATGGAGACCTATGGG + Intergenic
1201948159 Y:19535210-19535232 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic