ID: 1118229369

View in Genome Browser
Species Human (GRCh38)
Location 14:63933193-63933215
Sequence ACTTAAATGCAGAGCGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118229369_1118229370 9 Left 1118229369 14:63933193-63933215 CCTGCATCGCTCTGCATTTAAGT 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1118229370 14:63933225-63933247 AGCTAGTGATTCTTAGCCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118229369 Original CRISPR ACTTAAATGCAGAGCGATGC AGG (reversed) Intronic
905014873 1:34770924-34770946 GCTTAAATGCTGAGAGATGCAGG - Intronic
905916420 1:41687622-41687644 ACTTAGGTGCACGGCGATGCTGG + Intronic
906338811 1:44959640-44959662 ACTTAAAAGCACAGGGAGGCTGG - Intronic
908631212 1:66110122-66110144 TCATAAATGCAGAACAATGCTGG + Intronic
908682583 1:66678811-66678833 ACCTAAACGCAGAGGGAGGCAGG - Intronic
910553284 1:88500632-88500654 AGATAAATGCAGAGTGAAGCGGG - Intergenic
911908169 1:103595544-103595566 ACTAAAATGGAGAGGGATGAGGG + Intergenic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911914749 1:103683922-103683944 ACTAAAATGGAGAGGGATGAGGG - Intronic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912391812 1:109308161-109308183 TTTAAAATGCAGAGGGATGCTGG - Intergenic
913683070 1:121205498-121205520 ACATAAAAGCAGAGCTATTCTGG - Intronic
914034911 1:143993124-143993146 ACATAAAAGCAGAGCTATTCTGG - Intergenic
914154543 1:145074848-145074870 ACATAAAAGCAGAGCTATTCTGG + Intronic
918246599 1:182665775-182665797 ATTTAAATGCAGTGAGATGAGGG - Intronic
920450850 1:206060096-206060118 ACTTAAAGTCAGAGAGATGGAGG + Intronic
920470380 1:206224009-206224031 ACATAAAAGCAGAGCTATTCTGG - Intronic
922330721 1:224573115-224573137 ACTAAAATACAAAACGATGCTGG - Intronic
923497254 1:234536416-234536438 TCTTCAGTTCAGAGCGATGCAGG + Intergenic
1063894462 10:10665254-10665276 AATTAAATACAGAGCTATGCCGG + Intergenic
1064487044 10:15804206-15804228 GCTTAAATGCAGAGGGTTGGCGG + Intronic
1064752094 10:18540827-18540849 AATTAAATACAGAGCGAGGTGGG - Exonic
1066312133 10:34207377-34207399 ACTTTAATGCTGAGAGATGTAGG - Intronic
1070242340 10:74695329-74695351 ACCTAAATGGAGAGATATGCTGG - Intronic
1079333246 11:19550497-19550519 GCTTAAAGGCAGATCGATACAGG + Intronic
1079938688 11:26650327-26650349 TCTTAATTACAGAGCTATGCTGG - Intronic
1087561632 11:99797146-99797168 ACTTAACTGCACATCGATGGTGG - Intronic
1096660139 12:53119082-53119104 ACATAACTGGAGAGGGATGCTGG - Intronic
1099855257 12:88156469-88156491 ATTTAAATGCAGAGGGATGGTGG - Intronic
1102778902 12:115546556-115546578 ACTTAAAAGCAGAAAGATGTAGG + Intergenic
1105208401 13:18242374-18242396 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1108246177 13:48516542-48516564 ATTTAGATGCAGAGATATGCAGG - Intronic
1108637259 13:52347863-52347885 ACCTAAATGCAGAGTGATGCAGG + Intergenic
1111090238 13:83436966-83436988 AGTTAAATGCACAGCAATCCTGG + Intergenic
1113525885 13:110976014-110976036 ACTGAAATGCAGAGCTGTTCTGG + Intergenic
1114043175 14:18698650-18698672 ACTAAAAAGCAGAGAGATCCTGG - Intergenic
1114174581 14:20309209-20309231 ACTTAAAAGCACAGAGAAGCTGG + Intergenic
1115438637 14:33406344-33406366 ACTAAGAAGCAGAGAGATGCAGG + Intronic
1118229369 14:63933193-63933215 ACTTAAATGCAGAGCGATGCAGG - Intronic
1125324312 15:38521181-38521203 ACTTCAATGCAAAGAGATTCAGG + Intronic
1126259613 15:46673035-46673057 AATTAAATACAGAGCCATCCAGG + Intergenic
1128615882 15:69109295-69109317 AGATAAATGCAAAGCCATGCAGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1139811197 16:69618536-69618558 TCTTCAATGCAGAACGATGTTGG + Intronic
1150562509 17:66305090-66305112 AATTAAATGCAGAGTGCTGCAGG - Intronic
1153491388 18:5652200-5652222 ACTTAAATACAGAGAGATTGAGG + Intergenic
1153978296 18:10288364-10288386 ACTCAAATGCAGGGAGATCCAGG - Intergenic
1154412632 18:14149585-14149607 ACCTGAATGCAGAGCAAAGCTGG + Intergenic
1157000488 18:43517350-43517372 AATTAAATGCAGAGCTTTGGGGG + Intergenic
1157157354 18:45280884-45280906 AGATAAAGGCACAGCGATGCTGG - Intronic
1166718990 19:44986783-44986805 ACTTGATTGCGGACCGATGCTGG - Intronic
926979872 2:18557671-18557693 ACTTAACTTCAGAGCCAGGCAGG + Intronic
927178026 2:20424050-20424072 ACTGACTTGCAGAGAGATGCAGG + Intergenic
929001174 2:37348322-37348344 ACTTAAAAGCAGAGCCGTGCGGG - Intronic
930758686 2:55006951-55006973 AGTCAAATGCAGAGTGAGGCAGG - Intronic
936727444 2:115337456-115337478 ACCTAAAGTCAGAGAGATGCAGG + Intronic
938164029 2:129010551-129010573 AAGTAAATGCAGAGAGGTGCTGG + Intergenic
939541462 2:143499100-143499122 AGTTAAATGCACAGCCATCCAGG + Intronic
941473517 2:165920145-165920167 ACTTAAGTGCAGATCAGTGCGGG - Intronic
948044989 2:234936616-234936638 ATTTCAATGCAGAGCGAGGGCGG + Intergenic
1173523895 20:43717674-43717696 ACTCAAATGCAGTGCGCTGCAGG + Intergenic
1176134653 20:63516890-63516912 ACTTAAATGGAAAACGAGGCCGG - Intergenic
1176860374 21:14008670-14008692 ACCTGAATGCAGAGCAAAGCTGG - Intergenic
1180208592 21:46279379-46279401 ACTTAACTGCAGTGGGATTCAGG + Intronic
1180778444 22:18505424-18505446 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1180811167 22:18762732-18762754 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1180823858 22:18849950-18849972 ACTTAAATGTAGTGAGAGGCCGG - Intronic
1181124275 22:20693059-20693081 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1181188878 22:21124597-21124619 ACTTAAATGTAGTGAGAGGCCGG + Intergenic
1181197318 22:21196987-21197009 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1181210323 22:21285896-21285918 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1181399201 22:22641039-22641061 ACTTAAATGTAGTGAGAGGCCGG + Intergenic
1181650221 22:24255020-24255042 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
1181707157 22:24655717-24655739 ACTTAAATGTAGTGAGAGGCCGG + Intergenic
1184143540 22:42594579-42594601 ACTTAACTGCAGGGAGAGGCTGG + Intronic
1184483337 22:44760947-44760969 ACTCACATGCAGGGCGAGGCAGG + Intronic
1203216626 22_KI270731v1_random:9535-9557 ACTTAAATGTAGTGAGAGGCCGG + Intergenic
1203274001 22_KI270734v1_random:75854-75876 ACTTAAATGTAGTGAGAGGCCGG - Intergenic
956456398 3:69424978-69425000 ACATAAAAGCAGAGGGTTGCGGG - Intronic
960797705 3:121505400-121505422 ACTGAAAAGCAGAGCAATGAAGG + Intronic
967632144 3:191757100-191757122 ACTTCAATGCACAGAGATGAAGG + Intergenic
967867550 3:194203017-194203039 AATTAAATTCAGCGAGATGCAGG - Intergenic
971951470 4:33354753-33354775 ACTTAATTGCAGAGCCATATTGG - Intergenic
975542659 4:75530901-75530923 AATTAAATGAAGAGAGATGGTGG + Intronic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
984146078 4:176063281-176063303 ATTTAAAAGCAGAGCGATTAGGG - Intergenic
984183857 4:176518444-176518466 ACTTAAATGAAGAACAAAGCAGG + Intergenic
986488798 5:8268406-8268428 ACTTAAATGCAATGTAATGCAGG + Intergenic
988726556 5:33932141-33932163 ACTTTAATCTAGAGGGATGCGGG - Intergenic
996422392 5:123277359-123277381 ACTTAAACACAGAGTGATTCTGG - Intergenic
997507191 5:134426759-134426781 ACTTAAATGCATAGTGGTCCCGG + Intergenic
998768147 5:145511602-145511624 ACTGAAATCCACAGAGATGCTGG - Intronic
999521148 5:152351793-152351815 ACTTTAATTCAGAGCTATGTAGG + Intergenic
1005863737 6:29922581-29922603 AGAGAAATGCAGAGCGAAGCGGG - Intergenic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1018994879 6:168703029-168703051 ACCAAAATGAAGAGCAATGCAGG - Intergenic
1021603232 7:22385547-22385569 AATTAAATGCAGAGGTATCCAGG + Intergenic
1029168268 7:98612009-98612031 ACTTAACAGCAGGGCCATGCTGG - Intergenic
1037321927 8:17651876-17651898 ACTTACATGCAGGGATATGCAGG - Intronic
1041264003 8:56046241-56046263 AGATAAATGAAGAGTGATGCAGG - Intergenic
1046489732 8:114935540-114935562 ACTTAATTGAAGGGCGTTGCTGG - Intergenic
1048726481 8:137391054-137391076 ACTTAAATACAGTGCAGTGCTGG - Intergenic
1052936558 9:34098179-34098201 TCTTAAAGGCTGAGTGATGCTGG - Intronic
1059218657 9:112591043-112591065 ACTTAAATGCATTGAAATGCTGG + Intronic
1186269819 X:7874668-7874690 ATTTAAATGCAGAGCTTGGCAGG + Intergenic
1186984612 X:14998612-14998634 ACCTAAAGGCAGAGGGTTGCTGG - Intergenic
1189466050 X:41278328-41278350 GCTTCAATGCAGAGCGCCGCTGG - Intergenic
1193739618 X:85202643-85202665 GCTTCAATCCATAGCGATGCAGG + Intergenic
1193955682 X:87858633-87858655 TTTTAAATGCAGAGAGATTCAGG - Intergenic
1196066486 X:111470298-111470320 ATTTAAATGCCCAGCGATGGGGG - Intergenic
1196131254 X:112159395-112159417 ACTGAACTTCACAGCGATGCTGG - Intergenic