ID: 1118229472

View in Genome Browser
Species Human (GRCh38)
Location 14:63934409-63934431
Sequence GTTCAAATGGAGCACATAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118229472_1118229477 22 Left 1118229472 14:63934409-63934431 CCGATTATGTGCTCCATTTGAAC 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1118229477 14:63934454-63934476 TGCTGCCACTTTTCTCAGCTAGG 0: 1
1: 0
2: 0
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118229472 Original CRISPR GTTCAAATGGAGCACATAAT CGG (reversed) Intronic
911424045 1:97684446-97684468 TCTCAAATCGATCACATAATTGG - Intronic
912032300 1:105264189-105264211 TTTAAAATTGACCACATAATTGG - Intergenic
912228223 1:107760853-107760875 GTTCCAAAAGAGCAAATAATGGG - Exonic
913092248 1:115484593-115484615 TTACAAAAGGTGCACATAATGGG + Intergenic
913381450 1:118215763-118215785 GTACAAATGGAGGACATAGGAGG + Intergenic
915223988 1:154398227-154398249 ATGCAAATGGAACACATGATTGG + Intergenic
915995668 1:160560218-160560240 TTTAAAATTGATCACATAATAGG + Intronic
916614590 1:166426867-166426889 GCTAAAATTGACCACATAATTGG - Intergenic
917579322 1:176358591-176358613 TCTAAAATGGACCACATAATTGG + Intergenic
917739552 1:177949294-177949316 GTTAAAATGCAGGTCATAATAGG - Intronic
918603918 1:186398570-186398592 GTCCAAATGTACCATATAATTGG + Intronic
918614538 1:186529569-186529591 TCTAAAATGGATCACATAATCGG - Intergenic
920380341 1:205531413-205531435 GATCACATGGAGCACAAATTCGG + Exonic
1063296968 10:4816492-4816514 GTGCATATGGAGCACATAGATGG + Intronic
1068535708 10:58239309-58239331 GTTCAGATGGAGCACAAGAAAGG + Intronic
1072045154 10:91646892-91646914 TCTAAAATGGACCACATAATTGG + Intergenic
1073515422 10:104071585-104071607 GTTCAAAGCAAGGACATAATGGG - Intronic
1075281835 10:121145461-121145483 TCTAAAATGGATCACATAATTGG - Intergenic
1075310357 10:121408475-121408497 AATCAAAAGGAGCACATAAAAGG + Intergenic
1076248935 10:128969205-128969227 GGGCAAATGGAGCAGACAATAGG + Intergenic
1078336627 11:10468717-10468739 TTTAAAATTGACCACATAATTGG + Intronic
1078461805 11:11520237-11520259 TTTAAAATGGAGAAAATAATTGG - Intronic
1079786780 11:24683024-24683046 GTTCAATGAGAGCACATATTTGG - Intronic
1079850922 11:25533313-25533335 GGACAAATGGAGTACCTAATGGG - Intergenic
1080054330 11:27889986-27890008 GGTCAAAAGGAGCACGTCATGGG + Intergenic
1081166327 11:39812710-39812732 TTTAAAATTGACCACATAATTGG + Intergenic
1081317471 11:41648469-41648491 TTTAAAATCGACCACATAATTGG - Intergenic
1082112765 11:48295143-48295165 TTCCAAATTGAGCACATAGTTGG + Intergenic
1086947444 11:92857118-92857140 GTTCAAAGGGAACACACAAATGG - Intronic
1088573041 11:111241769-111241791 CCTCAAATGGAGAACAGAATGGG - Intergenic
1088910311 11:114186058-114186080 TTTAAAATGGAGCACATAAAGGG + Intronic
1088945364 11:114506457-114506479 TTTTAAATCGATCACATAATTGG + Intergenic
1089248546 11:117140018-117140040 TCTAAAATGGACCACATAATTGG + Intergenic
1090116864 11:123982554-123982576 TTTAAAATCGACCACATAATTGG - Intergenic
1094636171 12:32228799-32228821 CTTCAAATGAAGCACATTTTAGG + Intronic
1097414823 12:59302113-59302135 TATAAAATGGACCACATAATTGG + Intergenic
1097470365 12:59983309-59983331 TTTAAAATTGATCACATAATCGG + Intergenic
1099243106 12:80161865-80161887 TTTCAAATGAAGAACATACTTGG - Intergenic
1099550782 12:84041184-84041206 TTTAAAATTGAACACATAATTGG - Intergenic
1099880748 12:88464554-88464576 TTTAAAATTGACCACATAATTGG - Intergenic
1100470165 12:94884452-94884474 TCTCAAATTGACCACATAATTGG + Intergenic
1100734357 12:97510914-97510936 ATTCACATGGAGTCCATAATTGG + Intergenic
1101398107 12:104365830-104365852 GTCCAGGTGGAGCACCTAATAGG - Intergenic
1101596116 12:106166171-106166193 TCTAAAATGGACCACATAATTGG + Intergenic
1104593929 12:130106751-130106773 GTCCAAATGGAGCACAGAGGCGG + Intergenic
1105748993 13:23404161-23404183 CTTAAAATTGACCACATAATTGG - Intronic
1106429692 13:29668301-29668323 TCTAAAATGGACCACATAATTGG + Intergenic
1107399064 13:40050880-40050902 GTACAATTGGGGCACATAAGAGG - Intergenic
1108228044 13:48309950-48309972 TTCCTAATGGAGCTCATAATGGG + Intronic
1108957933 13:56184248-56184270 TCTAAAATCGAGCACATAATTGG + Intergenic
1109293972 13:60507417-60507439 TTTAAAATTGACCACATAATTGG + Intronic
1110036147 13:70687327-70687349 TCTCAAATCGACCACATAATTGG - Intergenic
1116212483 14:41966230-41966252 GCTAAAATTGAGCACATAATTGG - Intergenic
1116289344 14:43012469-43012491 GCTCAACTGAAGCTCATAATAGG - Intergenic
1116491393 14:45507558-45507580 GTACAAATGGAACATATATTTGG + Intergenic
1116932089 14:50701124-50701146 CCTCAAATTGACCACATAATTGG - Intergenic
1117171025 14:53096159-53096181 GTTCAAATGGAGAAGATATAAGG - Intronic
1118213789 14:63789212-63789234 GTTCAGTTGGAGCAGATCATAGG - Intergenic
1118229472 14:63934409-63934431 GTTCAAATGGAGCACATAATCGG - Intronic
1118536744 14:66774741-66774763 GTTCAAATAGAGCAAATCAAAGG + Intronic
1119941891 14:78649878-78649900 GTTTGTATGGAGAACATAATTGG - Intronic
1120770372 14:88372597-88372619 TTTTAAATTGACCACATAATTGG + Intergenic
1122293357 14:100691529-100691551 GCTCTAATGGAGCACTTAAAAGG - Intergenic
1125095492 15:35845654-35845676 TTTCTAATACAGCACATAATTGG + Intergenic
1125219790 15:37319840-37319862 TTCCAAATTGACCACATAATTGG + Intergenic
1126591479 15:50344499-50344521 GTTTAAAGGAAGCAAATAATAGG + Intronic
1127549382 15:60022182-60022204 GTTCAAGTGGATTACAGAATGGG - Intronic
1127859289 15:62979759-62979781 GTTTAAATCGAACACACAATTGG + Intergenic
1129796267 15:78379365-78379387 TTCCAAATTGACCACATAATTGG - Intergenic
1131192998 15:90332216-90332238 GTCCAAATGTAGCCCATAATGGG - Intergenic
1131202650 15:90413101-90413123 TTTCAAAGGGAGTACATACTTGG - Intronic
1134767358 16:16772410-16772432 TCTCAAATTGACCACATAATTGG - Intergenic
1134798010 16:17059206-17059228 GTTCAAAGGGAGCACATAGGAGG - Intergenic
1135865270 16:26095341-26095363 TCTAAAATTGAGCACATAATTGG + Intronic
1137065220 16:35833821-35833843 TTTAAAATTGATCACATAATCGG - Intergenic
1137926005 16:52542797-52542819 GTTCAAATTGAGAACATATTGGG - Intronic
1141314590 16:82949885-82949907 TTTCAAATGAAGCACCCAATTGG - Intronic
1141638551 16:85328520-85328542 ATTCAACTGCAGCACAAAATGGG + Intergenic
1143766021 17:9138294-9138316 GCTCAAATAGACCTCATAATGGG + Intronic
1144044266 17:11440790-11440812 ATTCAAATGGAGTTAATAATAGG + Intronic
1144420379 17:15092448-15092470 ATTCAAGTGGCGCACTTAATGGG + Intergenic
1147051386 17:37797223-37797245 ATCCCAATGGAGCATATAATGGG - Intergenic
1148332827 17:46822137-46822159 GTGCAAAGGGAGCACATAGGGGG + Intronic
1149377679 17:56062147-56062169 TCTAAAATGGACCACATAATTGG - Intergenic
1151821540 17:76499655-76499677 TTTCAAAAGGTGTACATAATTGG + Intronic
1152776195 17:82203687-82203709 GTCCAAATCGAGCTCATACTTGG - Intronic
1154122439 18:11662932-11662954 GTTCAGATGGAGCCCATCAGGGG + Intergenic
1157067036 18:44364423-44364445 TTTAAAATTGACCACATAATTGG - Intergenic
1157327419 18:46679153-46679175 GTTTAAATGGAGCTGAAAATAGG + Exonic
1158398761 18:57101857-57101879 TTTAAAATTGACCACATAATTGG - Intergenic
1163995750 19:21045484-21045506 TTTAAAATTGATCACATAATTGG - Intronic
1164120684 19:22262306-22262328 GTTCAATTAAAGCACATAGTTGG + Intergenic
1164179332 19:22806253-22806275 GTTCAATTAAAGCACATAGTTGG - Intergenic
925619590 2:5778396-5778418 GTTGAAATGAAACAAATAATGGG - Intergenic
927112724 2:19875845-19875867 GTTCACATGGAGGACATAGTGGG - Intergenic
929643977 2:43609242-43609264 GTTCAAATGGAGCAAGTGGTTGG + Intergenic
932371839 2:71196424-71196446 TTTAAAATTGACCACATAATTGG - Intronic
933323680 2:80809246-80809268 TTTAAAATTGACCACATAATTGG + Intergenic
934116182 2:88796888-88796910 ATTCAAATGGATCAAATAATGGG - Intergenic
934626974 2:95867954-95867976 ATTCAAATGGATCAAATAATTGG + Intronic
934806585 2:97233335-97233357 ATTCAAATGGATCAAATAATTGG - Intronic
934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG + Intronic
935449552 2:103193040-103193062 TTTAAAATTGATCACATAATTGG + Intergenic
936775087 2:115963432-115963454 TTTAAAATTGACCACATAATTGG - Intergenic
937188559 2:120069542-120069564 TTTAAAATTGACCACATAATTGG + Intronic
937795699 2:126016170-126016192 GCTAAAATTGACCACATAATTGG + Intergenic
939087752 2:137741995-137742017 TTTAAAAAGGAGCACATAAAGGG + Intergenic
939762812 2:146204477-146204499 GAGCAAATGATGCACATAATAGG - Intergenic
940411018 2:153362959-153362981 TTTAAAATAGACCACATAATTGG + Intergenic
940996081 2:160151170-160151192 TTTAAAATTGACCACATAATTGG + Intronic
942407485 2:175671038-175671060 TCTAAAATGGACCACATAATTGG + Intergenic
942712989 2:178859480-178859502 GCTCAAGTTGAGCACATAAGTGG + Intronic
943534469 2:189130399-189130421 TTTTAAATTGAGCACATATTAGG - Intronic
944292316 2:198020973-198020995 TTTAAAATGGACCACATAATTGG + Intronic
945098734 2:206243908-206243930 TTTCAAATGGTTTACATAATTGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945776438 2:214112227-214112249 TCTAAAATGGACCACATAATTGG - Intronic
948219776 2:236260404-236260426 CTTGAAATGCAGCACATATTGGG - Intronic
1168913453 20:1467901-1467923 GTTCAAATGGAGCAGAAATGTGG - Intronic
1170167613 20:13378490-13378512 TTTAAAATTGACCACATAATTGG - Intergenic
1171188027 20:23137298-23137320 GAACAAATGGAGAAAATAATGGG - Intergenic
1177136649 21:17311373-17311395 TTTTAAATTGACCACATAATTGG + Intergenic
1177764606 21:25442737-25442759 GCTAAAATTGACCACATAATTGG + Intergenic
1177878667 21:26666972-26666994 TTTAAAATTGACCACATAATTGG - Intergenic
1179525176 21:41971351-41971373 GAGCAAATGCAGCACAGAATGGG + Intergenic
949155276 3:819218-819240 TCTAAAATTGAGCACATAATTGG + Intergenic
951833540 3:26957094-26957116 TTTAAAATTGACCACATAATTGG - Intergenic
953074328 3:39553926-39553948 GCTAAAATTGACCACATAATTGG + Intergenic
953624033 3:44555909-44555931 GTGCACATGGCACACATAATTGG - Intronic
954053261 3:48000278-48000300 ATTCAAATGCAGGGCATAATAGG + Intronic
956117358 3:65931803-65931825 GTTCAAATGAAACAGATCATTGG + Intronic
956372992 3:68584532-68584554 TCTAAAATGGACCACATAATTGG - Intergenic
957346319 3:78965853-78965875 TTTCAGAAAGAGCACATAATAGG - Intronic
958618774 3:96529726-96529748 TCTAAAATGGACCACATAATTGG + Intergenic
960445516 3:117744443-117744465 GCTCTAATGGAGCTCATGATCGG + Intergenic
960685887 3:120293130-120293152 TCTCAAATTGACCACATAATTGG + Intergenic
961921140 3:130427871-130427893 GTTCAAAGGGAGGAGATAGTGGG + Intronic
962656231 3:137546358-137546380 ATTAAAATCGAACACATAATTGG + Intergenic
964905098 3:161709780-161709802 TTTAAAATTGACCACATAATTGG + Intergenic
967343390 3:188426368-188426390 TTTAAAATTGACCACATAATTGG - Intronic
967638886 3:191837179-191837201 TTTAAAATTGACCACATAATTGG + Intergenic
967757104 3:193182128-193182150 TTTAAAATTGAGCACATAATTGG + Intergenic
967913347 3:194559834-194559856 GTTTATATGGAGGAGATAATTGG + Intergenic
968436869 4:597164-597186 TTTAAAATTGATCACATAATTGG - Intergenic
968639188 4:1702559-1702581 GTTAAAATGTGGCTCATAATTGG - Intronic
970035541 4:11730914-11730936 AGTCAAATGGAGCACAAGATAGG - Intergenic
974677147 4:65107133-65107155 ATTCAAATGGAAAACATAATGGG + Intergenic
975124306 4:70764883-70764905 ATTCAAATATAGCACAAAATTGG + Intronic
975194480 4:71507818-71507840 TTTAAAATTGATCACATAATCGG + Intronic
975307988 4:72870597-72870619 CTTAAAATCGACCACATAATTGG + Intergenic
975424703 4:74212610-74212632 TCTAAAATTGAGCACATAATTGG - Intronic
975859325 4:78659509-78659531 GCTCAAATGGAGAACTGAATAGG - Intergenic
976111147 4:81675087-81675109 GTTCATATGGAGCAAATGAAAGG - Intronic
977482550 4:97596489-97596511 TCTAAAATGGACCACATAATTGG + Intronic
977771474 4:100866220-100866242 TCTAAAATGGACCACATAATTGG - Intronic
979417707 4:120463333-120463355 GAACAAATCGAGCATATAATCGG + Intergenic
980037561 4:127902914-127902936 TTTAAAATTGACCACATAATTGG - Intergenic
980150477 4:129041595-129041617 TTTCAAGTGTAGCACATAGTAGG - Intronic
981848597 4:149200269-149200291 GTTAAAATGTAGCACATACTGGG - Intergenic
983182649 4:164667260-164667282 CTTCAAGAGGAGAACATAATAGG - Intergenic
983315808 4:166131973-166131995 TTTAAAATTGATCACATAATTGG - Intergenic
983701754 4:170605137-170605159 GGTCAAAAGGAGCACATCATGGG + Intergenic
983795051 4:171852208-171852230 ATAAAAATGGAGCACAGAATTGG - Intronic
984224665 4:177019925-177019947 TTTAAAATTGACCACATAATTGG + Intergenic
985019522 4:185672778-185672800 TTTATAATGGAGCACATATTTGG + Intronic
987834456 5:23143854-23143876 TTTCAAATTGACCACATAATTGG - Intergenic
988975432 5:36510757-36510779 TCTAAAATTGAGCACATAATTGG + Intergenic
992738304 5:79745909-79745931 GTGCAAAAGGATGACATAATGGG + Intronic
993291744 5:86081031-86081053 GCTAAAATTGACCACATAATTGG - Intergenic
994991042 5:106997676-106997698 TCTAAAATGGACCACATAATTGG - Intergenic
995464673 5:112438689-112438711 TCTAAAATGGACCACATAATTGG + Intergenic
995471479 5:112506265-112506287 TCTAAAATGGACCACATAATTGG + Intergenic
995475298 5:112541683-112541705 TCTAAAATGGACCACATAATTGG + Intergenic
996999574 5:129743657-129743679 GTTCTAATGCAGCAGATACTTGG + Intergenic
997295837 5:132767741-132767763 GATCAAATGGAGGACACAGTCGG + Intronic
1004082640 6:12410107-12410129 TTTCAAATGGTAAACATAATGGG + Intergenic
1006712437 6:36085883-36085905 GCTAAAATTGATCACATAATTGG + Intronic
1008407348 6:51133849-51133871 TCTAAAATGGAACACATAATTGG - Intergenic
1009686002 6:66958639-66958661 GTTCATATGGAACCAATAATAGG - Intergenic
1009727599 6:67555781-67555803 TTTAAAATTGACCACATAATTGG - Intergenic
1010094776 6:72029214-72029236 GGTCAAATGCAGCAAATATTTGG + Intronic
1011138880 6:84131271-84131293 TTTAAAATTGACCACATAATTGG - Intronic
1011235325 6:85210565-85210587 TCTAAAATTGAGCACATAATTGG - Intergenic
1011578486 6:88830117-88830139 TCTAAAATTGAGCACATAATTGG + Intronic
1011702618 6:89969703-89969725 CTTCAAATGGGGCTCATAAAAGG + Intronic
1011778823 6:90763280-90763302 ATTCAAATGGATCAAACAATGGG + Intergenic
1011974235 6:93274096-93274118 TTTCAAATGGCACACATAAATGG - Intronic
1012778270 6:103524613-103524635 TATAAAATTGAGCACATAATTGG + Intergenic
1014548033 6:122755264-122755286 GTTCAAATGCAGCCCAGAGTAGG - Intergenic
1014592207 6:123287814-123287836 GTTCTAATGGAGGTAATAATTGG + Intronic
1015003836 6:128254415-128254437 GTTCAACAGGAGAAAATAATAGG + Intronic
1016823253 6:148365622-148365644 GCTGAAATGGCTCACATAATGGG + Intronic
1017231842 6:152081200-152081222 TTTAAAATTGACCACATAATTGG + Intronic
1017630977 6:156396436-156396458 GTTTAAATGTAGCAACTAATGGG - Intergenic
1019204929 6:170352503-170352525 TCTAAAATGGATCACATAATCGG + Intronic
1020338722 7:7086848-7086870 GCTGAAATTGACCACATAATTGG - Intergenic
1020366970 7:7391393-7391415 TCTAAAATTGAGCACATAATTGG - Intronic
1021832289 7:24627095-24627117 TCTAAAATGGACCACATAATTGG + Intronic
1025871943 7:65442731-65442753 ATTCAAAAGTAGCACATAACAGG + Intergenic
1028627694 7:92896138-92896160 TCTAAAATGGACCACATAATTGG - Intergenic
1028728743 7:94120614-94120636 GTTCTGATGGAGCAAACAATGGG - Intergenic
1030882335 7:114895699-114895721 CTTAAAATCGACCACATAATTGG - Intergenic
1033565309 7:142572530-142572552 GCTCAAATCGATCACATATTTGG + Intergenic
1035998035 8:4571558-4571580 TCTAAAATGGACCACATAATTGG - Intronic
1037258005 8:16977252-16977274 TTTAAAATTGACCACATAATTGG - Intergenic
1037595806 8:20353220-20353242 GTTCAAAAGGAGTACAGAAGGGG - Intergenic
1038686809 8:29726475-29726497 GTTCAAATATAATACATAATTGG + Intergenic
1041165369 8:55086998-55087020 ATTCAAATGCAACACAAAATGGG + Intergenic
1043490773 8:80747041-80747063 GTCCAGATGAAGCACATATTCGG - Intronic
1045928111 8:107594697-107594719 TTTAAAATTGACCACATAATTGG - Intergenic
1046342205 8:112874325-112874347 TTTAAAATTGACCACATAATTGG - Intronic
1046705260 8:117442227-117442249 CTTCATCTGCAGCACATAATGGG + Intergenic
1047009370 8:120654379-120654401 GTTCAACTGGGGAACAAAATAGG - Intronic
1050971064 9:11875049-11875071 GTTCAAACTGAGCAAATAAATGG + Intergenic
1051548991 9:18307920-18307942 TTTAAAATTGACCACATAATTGG + Intergenic
1051674270 9:19543846-19543868 TCTAAAATGGACCACATAATTGG - Intronic
1052124831 9:24762496-24762518 TTTAAAATTGACCACATAATTGG - Intergenic
1052421112 9:28244051-28244073 GCTAAAATTGACCACATAATTGG + Intronic
1055090553 9:72361423-72361445 CTTCAAATGGAGAACGTAAAAGG - Intronic
1056348207 9:85721082-85721104 TTTAAAATTGACCACATAATTGG - Intronic
1057460582 9:95257260-95257282 GTTAAAACTGACCACATAATTGG + Intronic
1203491862 Un_GL000224v1:114394-114416 TCTAAAATGGATCACATAATTGG - Intergenic
1203504486 Un_KI270741v1:56265-56287 TCTAAAATGGATCACATAATTGG - Intergenic
1185853350 X:3509390-3509412 GTTTATATGGGGCACAGAATGGG - Intergenic
1186354484 X:8775677-8775699 TTTAAAATTGACCACATAATTGG + Intergenic
1187290331 X:17947253-17947275 GTTCTAATTGAGAACATACTTGG + Intergenic
1188057335 X:25556577-25556599 GGTGAAATGGAACACATATTGGG - Intergenic
1190584966 X:51930735-51930757 TTTAAAATCGACCACATAATTGG - Intergenic
1190820882 X:53971065-53971087 TTTAAAATTGATCACATAATCGG + Intronic
1191156003 X:57273486-57273508 TTTAAAATTGACCACATAATTGG + Intergenic
1192714284 X:73623099-73623121 GCTAAAATTGACCACATAATTGG - Intronic
1193034729 X:76936952-76936974 TTTAAAATTGACCACATAATTGG + Intergenic
1194137401 X:90163129-90163151 GCTAAAATTGATCACATAATTGG + Intergenic
1194708400 X:97202898-97202920 TCTAAAATGGACCACATAATTGG + Intronic
1195993911 X:110712346-110712368 GTTTAAGTGAAGCACATAACAGG + Intronic
1197071018 X:122297972-122297994 TCTAAAATGGACCACATAATTGG - Intergenic
1197191354 X:123651033-123651055 TCTAAAATTGAGCACATAATTGG + Intronic
1197614025 X:128672431-128672453 TTTAAAATTGACCACATAATTGG - Intergenic
1198161088 X:134009192-134009214 ATTCAAAAGTAGCACATAACAGG - Intergenic
1199567155 X:149227832-149227854 TCTAAAATCGAGCACATAATTGG - Intergenic
1199589110 X:149449888-149449910 TTTAAAATTGATCACATAATTGG - Intergenic
1199830976 X:151548837-151548859 TTTAAAATCGACCACATAATTGG + Intergenic
1200483131 Y:3733070-3733092 GCTAAAATTGATCACATAATTGG + Intergenic