ID: 1118230217

View in Genome Browser
Species Human (GRCh38)
Location 14:63940723-63940745
Sequence GGGTCAAAACAGAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118230217_1118230226 5 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230226 14:63940751-63940773 AGGCCATTAAAAAATGGTACTGG 0: 1
1: 0
2: 68
3: 6064
4: 3969
1118230217_1118230230 22 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230230 14:63940768-63940790 TACTGGTGATGACAGGGAAAAGG 0: 1
1: 1
2: 1
3: 23
4: 286
1118230217_1118230225 -1 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230225 14:63940745-63940767 CCAAGGAGGCCATTAAAAAATGG 0: 1
1: 0
2: 4
3: 138
4: 6403
1118230217_1118230229 16 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230229 14:63940762-63940784 AAATGGTACTGGTGATGACAGGG 0: 1
1: 0
2: 1
3: 8
4: 165
1118230217_1118230228 15 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230228 14:63940761-63940783 AAAATGGTACTGGTGATGACAGG 0: 1
1: 0
2: 2
3: 10
4: 148
1118230217_1118230231 28 Left 1118230217 14:63940723-63940745 CCCTACTCCTTCTGTTTTGACCC 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1118230231 14:63940774-63940796 TGATGACAGGGAAAAGGTTGTGG 0: 1
1: 0
2: 0
3: 33
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118230217 Original CRISPR GGGTCAAAACAGAAGGAGTA GGG (reversed) Intronic
902540378 1:17150020-17150042 GGGCCAAAGCAGTAGGATTAAGG - Intergenic
903694695 1:25198159-25198181 GGGGCAAAACAGAAGGAATGAGG + Intergenic
904448776 1:30597761-30597783 GGATCCAAAGGGAAGGAGTAAGG - Intergenic
905645240 1:39620694-39620716 GGATCAAGACAGAAGGAATCCGG + Intergenic
906129088 1:43445377-43445399 GGGACAGAACAGAAGGGGTTGGG - Intronic
909502339 1:76349043-76349065 GGGAGAAAACAGAAGCAGCATGG - Intronic
909562847 1:77024885-77024907 GGGTCACAGCAGATGGAGTTGGG - Intronic
913553273 1:119937699-119937721 GGCTCAAGACAGAAGGTGTAAGG - Intronic
915320091 1:155051634-155051656 GGGTGAAAAGAGAAGGAGGGGGG + Intronic
916371860 1:164106713-164106735 GTGTCAGAACACAAGGAGTTTGG + Intergenic
917401184 1:174651697-174651719 GGCTCAAAACAGAAGGATGGAGG - Intronic
918407169 1:184222724-184222746 GGGGCAAAAGAGCAGGAGAAAGG - Intergenic
919908109 1:202092243-202092265 GGGACAAAACAGAAGCATTGTGG - Intergenic
922322865 1:224503408-224503430 GGGTCAAAACAGGAGGAAGAAGG - Intronic
923142984 1:231176983-231177005 GGGTAAAAACAAAAGAAGTGAGG + Intronic
923350054 1:233095728-233095750 GGGTGAAAATAGAAGCAGAAAGG + Intronic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
924286509 1:242493386-242493408 GGGTCAGAACAGGAGGAGAGAGG + Intronic
924932716 1:248745047-248745069 GGGTTAACACAGAAGGACCAGGG - Intronic
1063894798 10:10668567-10668589 GAGTAAAAACAGAAGTAGTTGGG - Intergenic
1066030901 10:31422809-31422831 GGAACAAAAGAAAAGGAGTAAGG - Intronic
1067961933 10:50864108-50864130 GGGTCAAAAAAGATGGAGATTGG + Intronic
1068781441 10:60922824-60922846 GGGTCAAAACTGAAAGGGTCTGG - Intronic
1069173524 10:65262303-65262325 TGGTCAAAACAAAGGGATTACGG + Intergenic
1070156920 10:73841023-73841045 GGGTCAAAGGAGAAGGCCTAGGG + Intronic
1070704127 10:78625187-78625209 GGCTCAAATCAAAGGGAGTAGGG + Intergenic
1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG + Intergenic
1075942978 10:126407190-126407212 GGGTCCAAAGAGCAGGAGGAAGG + Intergenic
1080101674 11:28466801-28466823 TGGTCAAAACAGAAGCATTTAGG + Intergenic
1081816911 11:45950657-45950679 GGGCCAAAAGAGAAGGACTGGGG + Intronic
1081951877 11:47051505-47051527 GGGTCCAAACAGAACAAGAAAGG - Intronic
1082635545 11:55588717-55588739 GGGTCAAAACTGAAGAGTTAAGG - Intergenic
1084136059 11:67183104-67183126 GGTTTAAAACAGAAACAGTAAGG - Intronic
1084901641 11:72314381-72314403 GGGTCAAAGGTCAAGGAGTATGG + Intronic
1085865658 11:80288620-80288642 GAGTCCAAACTGAAGGAGCAAGG + Intergenic
1086736381 11:90310930-90310952 GGGTCAAAAGAAAAAAAGTAAGG - Intergenic
1087239968 11:95763671-95763693 GGGTCACAACAGAAGGTGAATGG + Intergenic
1088729289 11:112666667-112666689 GGGTGAAAACAGAAGCTGAAAGG + Intergenic
1088984332 11:114892263-114892285 GGGTCAGTACAGAGGGAGGAAGG + Intergenic
1089333979 11:117709877-117709899 AGGTCCAGACAGAAGGAGCAGGG + Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1095258409 12:40068861-40068883 AGGTAAAAACAGCAGGAATATGG + Intronic
1095628437 12:44345120-44345142 GGCCCAGAAGAGAAGGAGTAGGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099351510 12:81575885-81575907 GAAACAAAAGAGAAGGAGTATGG - Intronic
1100633275 12:96409260-96409282 GGTTAAAAACAGAAAGAGAATGG + Intergenic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1102630000 12:114269785-114269807 GGGTCAGAAAAGAAGAACTAAGG + Intergenic
1102893913 12:116583057-116583079 GGGTCAAAGAAGGAGGAGGAGGG + Intergenic
1103907172 12:124333711-124333733 GGGTCAAAAGAGAAAGAGAGGGG - Intronic
1106547641 13:30744347-30744369 GTGTCAAAACAAAGGGAGTGGGG + Intronic
1108228241 13:48312606-48312628 GGTTTAAAATAGAAGGAGTCTGG - Intronic
1108934051 13:55864952-55864974 TGGCCAAAACAGAGGGATTACGG - Intergenic
1109058349 13:57581411-57581433 GGGGCAAATGGGAAGGAGTAAGG - Intergenic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1109895881 13:68689166-68689188 GGGTCAAAACTGATGGACTTTGG + Intergenic
1110077552 13:71267792-71267814 GGTTCAAAACAAAAGGAGGTGGG + Intergenic
1111977272 13:94979612-94979634 GAGCAAAAACAGAAGGTGTAAGG + Intergenic
1115349151 14:32374513-32374535 GGGTCAAATCAGTAGGAGGATGG + Intronic
1115696578 14:35905713-35905735 GAGTAAAAAGAGAAGAAGTATGG - Intronic
1116307423 14:43275717-43275739 GGGTAATAGTAGAAGGAGTATGG + Intergenic
1117256503 14:53983671-53983693 GGGACAAAACACAAGCAGCATGG - Intergenic
1118230217 14:63940723-63940745 GGGTCAAAACAGAAGGAGTAGGG - Intronic
1120496943 14:85249553-85249575 GGGTCAAAACTGAAAGAGATGGG + Intergenic
1121085652 14:91144269-91144291 TGGTCAAAACAGGAAGAGCAGGG + Intronic
1122298369 14:100718063-100718085 GGGTAGCAAGAGAAGGAGTAAGG - Intergenic
1122579120 14:102760749-102760771 GGGCCCAAACGGAAGGAGTGGGG + Intergenic
1124492299 15:30165494-30165516 GGGAAACAAAAGAAGGAGTATGG - Intergenic
1124751236 15:32372823-32372845 GGGAAACAAAAGAAGGAGTATGG + Intergenic
1126273999 15:46854934-46854956 AGTTCAAAACATAAGAAGTAAGG + Intergenic
1126379497 15:48031366-48031388 GGTTCAAGAAAGAAGGAGTGAGG + Intergenic
1127052667 15:55101073-55101095 AGGTAAAAATGGAAGGAGTATGG - Intergenic
1131497501 15:92925734-92925756 AGGTCCAAACAGAAGGAGTTAGG - Intronic
1132125897 15:99223920-99223942 GGGTCAAAGCAGAGGAAGAAAGG + Intronic
1133526913 16:6614655-6614677 GGGGCAAATCACTAGGAGTAAGG - Intronic
1138006346 16:53341421-53341443 GGGTAAAAACAAAAGAAGGAAGG + Intergenic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1141295571 16:82765424-82765446 CAGTTAAAATAGAAGGAGTAGGG - Intronic
1142510548 17:389928-389950 GGATCAAAGCAGAAGGATGACGG + Intergenic
1142744691 17:1950002-1950024 GGGTCAGAACAGCAGGAGCCAGG + Intronic
1144543702 17:16172118-16172140 GGGTGGGAACAGAAGGGGTACGG - Intronic
1148861714 17:50608003-50608025 GGAGAAAAAGAGAAGGAGTAAGG + Exonic
1149534660 17:57423560-57423582 AGCTCAGAACAGAAGGAGGATGG - Intronic
1150988553 17:70227899-70227921 GGGTTCAAATAGAAGGAGTAAGG + Intergenic
1151113900 17:71711255-71711277 TGGTCAAAACAGAAGCATAAAGG - Intergenic
1157878309 18:51294321-51294343 GAGTGAAAAGGGAAGGAGTAAGG - Intergenic
1159856813 18:73598592-73598614 GGCTGAAAATAGATGGAGTATGG + Intergenic
1161177059 19:2850171-2850193 GGGTCAAAACTGAAGTTTTATGG - Intronic
1166012280 19:39951317-39951339 GGCTCCAGACAGAAGGAGAAAGG + Intergenic
1166212740 19:41317746-41317768 GGATGAAAACAGAAGGAAGATGG + Intronic
1166259346 19:41627060-41627082 GGCTCAGCACAGAAGGAGGAAGG - Exonic
1166276135 19:41755522-41755544 GGCTCAGCACAGAAGGAGGAAGG + Exonic
1166453043 19:42917877-42917899 GGCTCAGCACAGAAGGAGGAAGG - Intronic
1166482589 19:43186489-43186511 GGCTCAGCACAGAAGGAGGAAGG - Exonic
1166485069 19:43205621-43205643 GGCTCAGCACAGAAGGAGGAAGG - Exonic
1166492215 19:43269516-43269538 GGCTCAGCACAGAAGGAGGAAGG - Exonic
1168593029 19:57652502-57652524 GGGTCAAAATCGGAGGAGGAAGG - Intergenic
925663067 2:6223169-6223191 GGGGAAAAAGAGAAGGTGTATGG - Intergenic
926726701 2:16004310-16004332 GGGTCAAAGCAAGAGGATTATGG + Intergenic
928670771 2:33600881-33600903 TAGTCAAAAAAGAAGGAATATGG - Intergenic
929226297 2:39514826-39514848 TGGTCCAAACAGAAGGACCAGGG - Intergenic
931051637 2:58421649-58421671 GGGGAAGAACAGAAGGAGTGGGG + Intergenic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
931989033 2:67770935-67770957 GGGTCAATACAGAAGGCCTATGG + Intergenic
932910069 2:75797059-75797081 TGGTCAAAATAGAGGGAGAAAGG + Intergenic
933503895 2:83153008-83153030 AGGTCAGAACAGAAAGATTATGG - Intergenic
933750041 2:85597395-85597417 GGGCCAAAACTGAAGGCCTATGG - Intronic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
935880024 2:107556047-107556069 GGGTAAAATCACAAGGAGTGAGG - Intergenic
936580198 2:113693583-113693605 GGATAAAAACAGAAGGAATTTGG + Intergenic
939058003 2:137385723-137385745 GAGTGAGAAGAGAAGGAGTAAGG + Intronic
939789894 2:146559302-146559324 GGGACAAAACAGAATAAGGAAGG - Intergenic
942028359 2:171933636-171933658 GGGTCAAAAAAGAAGTCGCAAGG - Intronic
943597359 2:189874460-189874482 GGGTTAAAAGAAAAGGATTAAGG + Intronic
943853370 2:192756667-192756689 TGGTCATAGCAGAAGGATTAAGG - Intergenic
946756713 2:222954383-222954405 GGACCCAAACAGAAGGAGGAGGG - Intergenic
948440480 2:237984033-237984055 GGGTAAGAAGAGGAGGAGTAGGG - Intronic
948819385 2:240531348-240531370 TGGTCAAAACAGTAAGTGTATGG - Intronic
1169531922 20:6494573-6494595 TGGGAAATACAGAAGGAGTAAGG + Intergenic
1170085287 20:12524635-12524657 GGAGCAAGACAGAAGGAGAAAGG - Intergenic
1170317830 20:15061704-15061726 GGGTAAAAAGAGAAGGGGAAGGG + Intronic
1175690191 20:61059683-61059705 GGTGAGAAACAGAAGGAGTAGGG - Intergenic
1177804714 21:25863307-25863329 GGTTTAAAACAGAAGGAATTTGG - Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1179994185 21:44966490-44966512 GGGTCTGGACAGAAGGGGTATGG - Intronic
1181994818 22:26868971-26868993 GCTTCAAAACAGAAGCAGTATGG - Intergenic
1182227203 22:28808170-28808192 GGGGAAAGACAGAAGGAGTCTGG + Intergenic
1182584355 22:31335448-31335470 AGGTCAAAACAGAAGGAGAGAGG - Intronic
952598892 3:35054919-35054941 AGGTCAAAACGGAAAGAGAATGG + Intergenic
952726827 3:36595314-36595336 GGGTGAAAGGAGAAGGAGAAAGG - Intergenic
954636783 3:52075175-52075197 GGGCCCAAACAGAATGAGAATGG - Intergenic
954660606 3:52224891-52224913 GGGTCAGAACAGATGGAGAGAGG + Intronic
958139640 3:89545312-89545334 GAGTAAAAACAGGAGGATTATGG - Intergenic
960708070 3:120500409-120500431 GGGTCAAAGCATCAGGAGCAGGG + Intergenic
963853944 3:150235236-150235258 GGGACAAAACGGAGGGAGCAAGG - Intergenic
963953393 3:151227080-151227102 GGGTCACAGCAGCAGGAGTTAGG - Intronic
965949591 3:174291153-174291175 GTTTCAAAAAAGAAGGAATAGGG + Intergenic
966229319 3:177633857-177633879 GGGTCAAAACATTATGAGTAAGG + Intergenic
967978389 3:195048319-195048341 GGGTGAAAACAGAAGCAGGCAGG + Intergenic
970139412 4:12965358-12965380 GGGTCAAAGCAGAGGGAGAAAGG + Intergenic
972234551 4:37115776-37115798 GGGTCAAAAAAAATGAAGTAAGG + Intergenic
975457844 4:74613793-74613815 TGGTCAAAACTGGAGGAGGATGG - Intergenic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
988548558 5:32179588-32179610 GGGTTAAAACAGAAAGACTCTGG - Intergenic
989419557 5:41220848-41220870 GGGTCAGGGGAGAAGGAGTAGGG - Intronic
990181417 5:53164696-53164718 TGGTAAAAACAGAAGGACAAAGG + Intergenic
990957372 5:61356870-61356892 GTGTAAAGACAGAAGAAGTATGG + Intronic
991014456 5:61916002-61916024 GGTTCCACACAGAAGGAGGAAGG - Intergenic
991518277 5:67464893-67464915 GGGTCACCACAAAAGAAGTATGG + Intergenic
992309288 5:75478723-75478745 GGTTCAAAACAGAAAGATCAAGG + Intronic
993122855 5:83797476-83797498 GGCTCAAAACAGAAGGATGGAGG - Intergenic
1000292449 5:159883149-159883171 GGGGAAAAAGAGAAGGAGCAAGG - Intergenic
1001260996 5:170228409-170228431 AGGTTAAAATAGAAGGAGTCGGG + Intergenic
1002020832 5:176363478-176363500 GGGACAAATCAGAAGGAATAGGG - Intergenic
1002021001 5:176364614-176364636 GGGACAAATCAGAAGGAATAGGG + Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003906693 6:10706933-10706955 GGGGCAAAAAAGAAGCAGAAAGG + Intronic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1007319813 6:41019588-41019610 GGGTTAGAAGAGAAGGAGGAGGG + Intergenic
1008831364 6:55766723-55766745 GGGCCAAATCATAAAGAGTAGGG - Intronic
1009287439 6:61838676-61838698 GGGTCAAAATAGATGGATTCAGG - Intronic
1009703474 6:67214118-67214140 GGGACAAAACAGAAAGCCTATGG - Intergenic
1011041409 6:83033640-83033662 GGCACAAAACAGGAGGAGTGAGG - Intronic
1013127787 6:107201905-107201927 GGGGGAAAACAGAAGTGGTAAGG - Intronic
1014397586 6:120945138-120945160 GGAACAAGACAGAAGGAGTGAGG + Intergenic
1015962979 6:138669611-138669633 GGGTTAAAACAGAAGGTTTCTGG + Intronic
1018478031 6:164162173-164162195 GGGTCAAAAAACAAGGAGACTGG + Intergenic
1019647358 7:2138237-2138259 GGGTCCAAAGGGAAGGAGAAAGG + Intronic
1020603429 7:10305449-10305471 GGCTCAAAACAAAAGGAATATGG + Intergenic
1021243475 7:18233701-18233723 GGGTCAAGAAAGAAGGAGGAAGG - Intronic
1021869084 7:24985877-24985899 GGCTTGTAACAGAAGGAGTAGGG - Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1030282421 7:107790817-107790839 GGGTCTAGACAGAAGGAAGAAGG - Intronic
1031741258 7:125434391-125434413 GGGGAAAAATAGAAGGAGAAAGG - Intergenic
1031907539 7:127477257-127477279 GGATTAAAACAGAAGGAATAAGG + Intergenic
1033147331 7:138882774-138882796 GGCACAAAACCGAAGGAGAAAGG + Intronic
1036108979 8:5876846-5876868 TGCTCAAAAAAGGAGGAGTATGG - Intergenic
1037483759 8:19328554-19328576 GGGTCAAAAGACCAGGAGTGAGG - Intronic
1038239107 8:25791666-25791688 GGGTCATAACTGGAGGAGGAAGG - Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1042459680 8:69049055-69049077 GGATCAAAGCAGAAGGCGAAGGG + Intergenic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1046490476 8:114945954-114945976 GGGACAAAACTGAAGGTTTAAGG + Intergenic
1047835510 8:128685918-128685940 CAGTCAAAATAGAAAGAGTATGG + Intergenic
1047985758 8:130231899-130231921 GGGTCAGTACAGTAGGAGTGGGG - Intronic
1048378137 8:133840425-133840447 GAGTCAAATCTGAAGGAGGAAGG - Intergenic
1052614244 9:30817750-30817772 GGAACATAACAGAAGGAGTAAGG - Intergenic
1053259405 9:36648915-36648937 AGATCAAAACAAATGGAGTAAGG + Intronic
1054856281 9:69902902-69902924 GGGTCAAAACCAAGGGAGCAGGG - Intronic
1058905381 9:109478365-109478387 GAGTCATAACAGAAGGGGTCAGG - Intronic
1059774572 9:117462669-117462691 GCGTGAAAAAAGAAGGAGTTGGG - Intergenic
1060082445 9:120662966-120662988 TGGTAAAAACAGAAGGATTTAGG + Intronic
1060301726 9:122378034-122378056 GGCTCAAGACGGAAGGAGTGAGG - Intronic
1060424265 9:123491816-123491838 GGGTGAGGACAGAAGGAGTTTGG - Intronic
1061199805 9:129131270-129131292 GGGGCAAAACAGGAGGAATCTGG - Intronic
1185529879 X:809127-809149 GGTTTAAAACAGCAGGAATATGG - Intergenic
1185908471 X:3960108-3960130 TGGTCAAAACAGAGTGAGTGGGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1190326557 X:49210293-49210315 AGATCAAAACAGAAGGTGTAGGG - Exonic
1190438263 X:50449271-50449293 GGGGAAAAACAGGAGGAGTGAGG - Intronic
1192656327 X:72998826-72998848 GGGAGAAATCAGAAGGAGTGGGG - Intergenic
1192665793 X:73084175-73084197 GGGAGAAATCAGAAGGAGTGGGG + Intergenic
1196537719 X:116867459-116867481 GGATCAAAATAGAGGGAGGAAGG - Intergenic
1196907190 X:120449287-120449309 TGGCTAAAACATAAGGAGTAAGG + Intronic
1202339016 Y:23840775-23840797 GGGTAACAACAAAAGGAGGAAGG + Intergenic
1202531750 Y:25829297-25829319 GGGTAACAACAAAAGGAGGAAGG - Intergenic
1202594516 Y:26522130-26522152 GGGTCAGAAAACATGGAGTATGG - Intergenic