ID: 1118230795

View in Genome Browser
Species Human (GRCh38)
Location 14:63947223-63947245
Sequence AATAGGATTTTCTGCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 5, 2: 28, 3: 140, 4: 557}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118230792_1118230795 -6 Left 1118230792 14:63947206-63947228 CCAGAAAAATTTTGTCCAATAGG 0: 1
1: 0
2: 2
3: 13
4: 133
Right 1118230795 14:63947223-63947245 AATAGGATTTTCTGCAGTGATGG 0: 1
1: 5
2: 28
3: 140
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118230795 Original CRISPR AATAGGATTTTCTGCAGTGA TGG Intronic
900750525 1:4394164-4394186 AATAGGACTTTTTGGAGTGATGG + Intergenic
900842872 1:5069649-5069671 AATAGAATTTTCTGTGGTGCTGG - Intergenic
901346008 1:8543084-8543106 AATAGAACTTTCTGCTGTGATGG - Intronic
901519305 1:9770583-9770605 AATACGCTTTTCTGCATTAAAGG - Intronic
902778257 1:18688544-18688566 AATAGAAGTTTCTGCGATGACGG - Intronic
903212885 1:21828615-21828637 CAGAGGATTGTCTGCACTGACGG - Intronic
903308512 1:22432597-22432619 AACAGGACTTTCTGCAATGAAGG - Intergenic
903527654 1:24004408-24004430 AAAAGAATTTTTTGCAGAGATGG + Intergenic
904129438 1:28264783-28264805 AACAGAATTTTCTGCGATGATGG - Intronic
904776635 1:32912552-32912574 AATAGAACTTTCTGTAATGAGGG + Intergenic
904868545 1:33601916-33601938 AGCAGAACTTTCTGCAGTGATGG - Intronic
904923825 1:34030071-34030093 AGTAAAATTTTCTGCAATGATGG + Intronic
905360187 1:37413733-37413755 AATAGAACTTTCTGCCATGATGG + Intergenic
905506520 1:38484363-38484385 AGTAGAATCTTCTGTAGTGACGG + Intergenic
905712781 1:40120717-40120739 AGTAGAATTTTCTGCAATGATGG + Intergenic
905999037 1:42407994-42408016 GGTAGGATTTTCAGCAGAGATGG - Intronic
906138225 1:43515563-43515585 AACAGAACTTTCTGCATTGAGGG + Intergenic
906203253 1:43973269-43973291 AATAGAACTTTCTGCCATGATGG - Exonic
906390861 1:45414853-45414875 AATAGAACCTTCTGCAGTGATGG - Intronic
906739251 1:48165551-48165573 AATAAAATTTTCTGCAATTATGG + Intergenic
906863749 1:49392276-49392298 AATAGAACTTTCTACAGTAATGG - Intronic
906917398 1:50025721-50025743 AACAAAACTTTCTGCAGTGATGG - Intergenic
908018520 1:59874242-59874264 AATAGAACTTTCTGCAATGATGG - Exonic
908447479 1:64214172-64214194 AGTAGCACTTTCTGCATTGATGG + Intronic
908857013 1:68442108-68442130 AATAGAACTTTCTGCAATAATGG - Intronic
908959075 1:69672373-69672395 AATAGAACTTTCTGCAATGATGG - Intronic
909421141 1:75466937-75466959 AATAGTTTTTTGTGCAGTGTAGG - Intronic
910007400 1:82415731-82415753 AATAGAACTTCCTGCAGTGAGGG + Intergenic
910474643 1:87593755-87593777 AACAGAACTTTCTGCAGTGCTGG - Intergenic
910617637 1:89217175-89217197 ATGAGAATTATCTGCAGTGATGG + Intergenic
910905096 1:92167279-92167301 CATAGGATTTAAGGCAGTGATGG + Intronic
910993722 1:93081679-93081701 AGTAGAAATTTCTCCAGTGATGG + Intronic
911097514 1:94066809-94066831 AGTAGAACTTTCTGCAGTGATGG + Intronic
911312416 1:96309929-96309951 AACAGAACTTTCTACAGTGATGG + Intergenic
911627285 1:100138862-100138884 AACAGAACTTTCTGCAATGATGG - Intronic
911631609 1:100189860-100189882 AATAGAATTTTCTGTGATGATGG + Exonic
912304376 1:108551542-108551564 AATAGAACTTTCTGCAATAATGG - Intergenic
912378419 1:109231866-109231888 AATAGGACTTTCTGCGATGATGG + Intronic
912378537 1:109233034-109233056 AATAGAACTTTCTGCACTGATGG + Intronic
912874803 1:113347099-113347121 AAAAGGATTTTCTGAACTCAGGG - Intergenic
912990084 1:114477677-114477699 AACAGAATTTTCTGCAATAATGG + Intronic
913515239 1:119599833-119599855 AAAAGAACTTTCTGCAGTGAAGG + Intergenic
914003590 1:143713395-143713417 ACTCAGATTTTCAGCAGTGAGGG - Intergenic
914312892 1:146483113-146483135 ACTCAGATTTTCAGCAGTGAGGG - Intergenic
914501455 1:148250260-148250282 ACTCAGATTTTCAGCAGTGAGGG + Intergenic
914790575 1:150873946-150873968 AAAAGGATTAACTGAAGTGAAGG + Intronic
914942226 1:152033385-152033407 AGTAGAACTTTCTGCAGTGGTGG - Intronic
915573287 1:156757919-156757941 AATAGAACTTACTGCAGTGATGG - Intronic
915889449 1:159758752-159758774 GATAGAACTTTCTGCATTGATGG - Intergenic
916236809 1:162597149-162597171 GATAGAACTTTCTGCAGTGAAGG + Intronic
916494327 1:165331327-165331349 AATACAACTTTCTGCAATGATGG + Intronic
916758938 1:167799649-167799671 AATAGAACTTTCTGCAATGAAGG - Intergenic
917013287 1:170499956-170499978 ATCAGGAATTTCTTCAGTGAGGG - Intergenic
918102248 1:181386538-181386560 AATAAAACTTTTTGCAGTGATGG + Intergenic
918198578 1:182245829-182245851 AATAGAACGTTGTGCAGTGATGG - Intergenic
918567094 1:185947221-185947243 AATAGGACTTTCTGCAATGATGG + Intronic
918795852 1:188895956-188895978 TATAGCATTTTCTGCAGTCATGG - Intergenic
920205037 1:204285141-204285163 AATAGAATGTTCTACAATGATGG - Intronic
921135758 1:212257578-212257600 AAAAGTATTTTTTGCAGAGATGG - Intergenic
921522910 1:216178706-216178728 AATAGAACTTTCTCCAATGAAGG + Intronic
921555822 1:216597648-216597670 AATAGAACTTTCTGCAGTTATGG - Intronic
921856224 1:219987935-219987957 AGTAGAACTTTCTGCAGTGATGG - Intronic
922241341 1:223757189-223757211 AAGAGGATTTTCTTCAGTGTTGG + Intronic
922324994 1:224519966-224519988 AATAGAACTTTCTACAGTGATGG - Intronic
922700729 1:227758620-227758642 AACAGACCTTTCTGCAGTGATGG - Intronic
923695603 1:236247418-236247440 AACAGGATTTGCTGCAGTATTGG - Intronic
924518845 1:244788429-244788451 AATAAAACTTTCTGCAATGATGG - Intergenic
1063486002 10:6421589-6421611 AACAGAACTTTCTGCTGTGATGG - Intergenic
1063917922 10:10903399-10903421 AATAGAATTCTCTACAGTAAGGG - Intergenic
1064305037 10:14157923-14157945 AATAGAATTTTCAGCAGACAAGG + Intronic
1064357169 10:14630088-14630110 AACAGGAAATTCTTCAGTGAAGG - Intronic
1064506682 10:16038780-16038802 AACAGCATTTGCTGCAATGAAGG + Intergenic
1064645964 10:17459955-17459977 AAAAAGATTTTTTGCAGAGACGG - Intergenic
1064801180 10:19074196-19074218 AATAGGATTGTCAACTGTGAAGG - Intronic
1065396116 10:25239726-25239748 AACAGAACTTTCTGCACTGAAGG - Intronic
1068776746 10:60875466-60875488 AGTAGAACTTTCTGCAGTGATGG - Intronic
1068946791 10:62737631-62737653 AATAGAACTTTCTGCAATGATGG - Intergenic
1069976936 10:72221496-72221518 AATAGAACTTTCTGCCATGATGG - Intronic
1070098046 10:73357794-73357816 AGTAGGATTTGCTGTAGAGACGG - Intronic
1070194441 10:74143833-74143855 AACAGGGCTTTCTGCAATGATGG + Intronic
1070296755 10:75168361-75168383 AACAGAATTCTCTGCAATGACGG - Intronic
1070649752 10:78226542-78226564 ACTGGAACTTTCTGCAGTGATGG - Intergenic
1071161837 10:82755662-82755684 AACAGGATTATCTGCTGAGAAGG + Intronic
1071306763 10:84306010-84306032 AAGAGGAGTTACTGCAGTGAGGG + Intergenic
1071847896 10:89538271-89538293 AACAGAATTTTCTACAGTGATGG + Intronic
1072230013 10:93406747-93406769 AATAGGACCTTCTGCAGAGCTGG + Intronic
1072240783 10:93494152-93494174 AATACAACTTTCTGCAGTGATGG - Intergenic
1073837358 10:107459854-107459876 AACAGGAGTTTATGCAGAGAAGG + Intergenic
1073920781 10:108456074-108456096 AATAGAACTTTCTGCAATGATGG - Intergenic
1074113474 10:110438543-110438565 AATGGAACTTTCTGCAATGATGG + Intergenic
1074203811 10:111263409-111263431 AAGAGGATTTTCTAAGGTGATGG - Intergenic
1074691250 10:116006516-116006538 ATTAGAACTTTCTGCTGTGATGG - Intergenic
1074752839 10:116603350-116603372 AACAGAACTTTCTGCAATGAGGG + Intronic
1074966591 10:118496248-118496270 GATAGAATTTTCTGGAATGATGG - Intergenic
1075045714 10:119144907-119144929 AGTGGAACTTTCTGCAGTGATGG - Intronic
1075437631 10:122457430-122457452 TCTAGAATTTTCTGCAGTGATGG - Intergenic
1075502644 10:122989770-122989792 AACATAACTTTCTGCAGTGATGG - Intronic
1075966020 10:126612402-126612424 AATAGAACTTTCTACAATGATGG - Intronic
1076013431 10:127008441-127008463 AATAGAACTTTCTGTAATGATGG - Intronic
1076018420 10:127048735-127048757 AACAGAACTTTCTACAGTGATGG - Intronic
1076190252 10:128478158-128478180 AATAGATCTTTCTGCAATGATGG - Intergenic
1076436234 10:130444470-130444492 ATGAGGTGTTTCTGCAGTGATGG - Intergenic
1078301851 11:10139354-10139376 AAAAGCATTTTCTGTAATGATGG + Intronic
1078567019 11:12424632-12424654 ATTAAGACTTTCTGCAATGATGG - Intronic
1078731876 11:13982458-13982480 TACAGGATTTTGTGCTGTGAAGG + Intronic
1078778210 11:14412654-14412676 AATAGAACTTTCTGAAATGATGG - Intergenic
1078813081 11:14790925-14790947 AATAGAAATTTTTGCAATGATGG + Intronic
1078881077 11:15449294-15449316 ACTAGGATTTTCTACAGTCCAGG + Intergenic
1079293200 11:19207435-19207457 AAGAGACCTTTCTGCAGTGATGG - Intronic
1079875210 11:25847748-25847770 AGTAGAATTTTCTGCAATGATGG - Intergenic
1079948402 11:26771084-26771106 AATGGAACTTTCTGCAATGATGG + Intergenic
1079975711 11:27089307-27089329 AATAGGGCTTTCTGCAATAATGG - Intronic
1080006222 11:27409975-27409997 AATAGAACTTTCTGCAATGATGG + Intronic
1080368912 11:31611177-31611199 AGTAGAATTTTCTGCAGTGATGG + Intronic
1080673503 11:34402944-34402966 AACAGAACTTTCTGCAATGATGG + Intergenic
1080730025 11:34941010-34941032 AATAGAAGTTTCTGTGGTGATGG + Intronic
1080753986 11:35177939-35177961 AATAGAACTTTCTGCAATGATGG - Intronic
1080954421 11:37076560-37076582 AACAGAACTTTCTGCAATGAAGG + Intergenic
1081296851 11:41401338-41401360 AATAGAACTTTCTGCCGTAATGG - Intronic
1081462172 11:43282094-43282116 CATAGGACTTTCTGCATTTATGG - Intergenic
1081719772 11:45279916-45279938 AGTAGAATTTTCTCCAGTGCAGG - Intronic
1082029667 11:47594984-47595006 AATGGAATTTTCTGCTGGGAAGG + Intergenic
1082129035 11:48464901-48464923 AATATGATTTTCTGCATTTTTGG + Intergenic
1082248374 11:49952477-49952499 AATATGATTTTCTGCATTTTTGG - Exonic
1082255907 11:50032919-50032941 AACAGGAATTTCTGCAGTTCTGG - Intergenic
1082562572 11:54635877-54635899 AATATGATTTTCTGCATTTTTGG + Intergenic
1082929420 11:58584715-58584737 TACAGAATTTTCAGCAGTGATGG - Intronic
1085358721 11:75865409-75865431 AATAAAACTTTCTGCAATGATGG + Intronic
1085370278 11:75997149-75997171 AAAAGGCATTTCTGCAGGGAAGG + Intronic
1086595996 11:88571404-88571426 AACAGTATTTTTTGCAATGAAGG - Intronic
1087142178 11:94775676-94775698 AACAGAAATTGCTGCAGTGATGG - Intronic
1087898888 11:103618256-103618278 AATAGATTTTTCTGCAATGTTGG - Intergenic
1087975889 11:104545589-104545611 AATAGTATTTTCTGGAGTAACGG - Intergenic
1088752255 11:112854003-112854025 AATGGAAATTTCTGCAATGATGG + Intergenic
1089259779 11:117216214-117216236 CAAAGAATTTTCTGCAATGATGG - Intronic
1089926192 11:122260711-122260733 AATAGAATTTTCTGCAGTGATGG - Intergenic
1090329484 11:125919803-125919825 AACAGAGCTTTCTGCAGTGATGG + Intronic
1090331299 11:125934299-125934321 AATAGAACTTTCTGCAATGATGG + Intergenic
1091231919 11:133993612-133993634 AGTTTGACTTTCTGCAGTGATGG + Intergenic
1091848920 12:3679449-3679471 AATAGGAGCCTCTGCAGTCAGGG - Intronic
1092117888 12:6022472-6022494 GATAGAACTTTCTGCAGTGGGGG - Intronic
1092945153 12:13447214-13447236 GAGAGAATTTTCTGGAGTGATGG - Intergenic
1092992399 12:13915540-13915562 AACAGGACTGTCTGCAGTGATGG + Intronic
1093005337 12:14045021-14045043 AACAGAACTTTCTGCAATGATGG + Intergenic
1093510720 12:19924321-19924343 AATTGGATTTTCTACAAAGAAGG - Intergenic
1093559289 12:20518816-20518838 GATAGGACTTTCTGTACTGATGG + Intronic
1094304536 12:29003175-29003197 AATAGAATTTTCTGTGGAGATGG - Intergenic
1094342327 12:29426801-29426823 AATAGAACTTTCTGCAATGATGG + Intronic
1094414064 12:30200014-30200036 AAGAGGAGTTACTGCAGTGTGGG + Intergenic
1095539357 12:43290521-43290543 AATAGAACTTTCTGTATTGATGG + Intergenic
1095580905 12:43796619-43796641 AATAGGACTTTTTGCACTGATGG + Intronic
1095587068 12:43861144-43861166 AATAGTATTTTCAGCAGTGGAGG + Intronic
1095692974 12:45111395-45111417 AATAGTATTTTTTGTAGAGATGG - Intergenic
1096568314 12:52499763-52499785 AAAAGAATTTTCTGGAGTAATGG - Intergenic
1096673261 12:53212879-53212901 AGTAGAACTTTCTGCAATGATGG - Intronic
1096795881 12:54077324-54077346 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1097151276 12:56981582-56981604 AACAGGTTTTGCTGCAGTGAGGG - Intergenic
1097154355 12:57002009-57002031 AACAGGATTTTATGGAGTGATGG - Exonic
1097171642 12:57117898-57117920 AATAGAATTTTCTGTGATGATGG - Intronic
1097349012 12:58527249-58527271 AATAGCACTTTCTGAAGTAAGGG - Intergenic
1097381562 12:58901586-58901608 AATGGCACTTTCTGCAGTGATGG - Intronic
1097660457 12:62424553-62424575 AACAGGATTTTATGCATTGCTGG + Intergenic
1097879899 12:64677282-64677304 AGCAGTATTTTCTGCAGTGGAGG - Intronic
1098041554 12:66358404-66358426 AACAATATTTTCTCCAGTGAAGG - Intronic
1098540164 12:71646509-71646531 AATAGAATTTTCTACAATAATGG - Intronic
1098781506 12:74692998-74693020 AATAACATTTCCTTCAGTGAAGG - Intergenic
1098858317 12:75679353-75679375 AATGGGATTTTCAGCAATGAGGG + Intergenic
1099113791 12:78597436-78597458 AATACAATTTTCTCCAATGATGG - Intergenic
1099765609 12:86979167-86979189 AACAGGATTTTCTGTATTGATGG + Intergenic
1100107953 12:91200317-91200339 AATAGAACTTTCTCCAGTAATGG + Intergenic
1101686111 12:107023440-107023462 AGTAGAACTTTCTGCAATGATGG - Intronic
1101732163 12:107435833-107435855 AGTAGAACTTTCTGCACTGATGG + Intronic
1101931397 12:109017054-109017076 AATAGAACTTTCTGCAATTATGG + Intronic
1102095903 12:110241160-110241182 AATAAGACTTTCTGCAGGGTTGG + Intergenic
1102178288 12:110892527-110892549 AATAGAATTTTCTGTTCTGATGG - Intronic
1103215348 12:119197481-119197503 AATGGGATTGACTGCAGGGATGG - Intronic
1103559102 12:121783094-121783116 AGTAGAACTTTCTGCAGTGGAGG - Intronic
1104171108 12:126281679-126281701 AATGGGACCTTCTGCAGTGAAGG - Intergenic
1104361308 12:128135727-128135749 AAACTGATTTTCTGCAGAGAGGG - Intergenic
1104428169 12:128695087-128695109 AATAGGACTTTCTACAGTGGTGG + Intronic
1104529626 12:129556845-129556867 AATAGAATTTTCTGTGGTGATGG - Intronic
1105524111 13:21159201-21159223 AATAGAATTTTCTATAATGATGG - Intronic
1105991958 13:25631207-25631229 AACAGGACTTTCTGCAGTGATGG + Intronic
1106451132 13:29883526-29883548 AACAGAACTTTCTGCAATGAAGG + Intergenic
1106909925 13:34452626-34452648 AATAGCATTTTCAGAAGAGATGG - Intergenic
1106986289 13:35355538-35355560 AAAAGAACTTTCTGCAATGACGG - Intronic
1107812935 13:44217408-44217430 AATAGAATTTTCTGCAATGACGG + Intergenic
1108503999 13:51093351-51093373 AGTAGGACTTTCTGTAGTGCTGG + Intergenic
1108739776 13:53323775-53323797 AATAGAATTATCTGCATTGATGG + Intergenic
1108872325 13:55002511-55002533 AATTGGGGTTTCTGCAGTGATGG - Intergenic
1108929880 13:55805655-55805677 AATAGAATTTTCTGTAATTATGG - Intergenic
1109428972 13:62207151-62207173 AATAGGAATTTCTTCAGTTTTGG - Intergenic
1109770643 13:66967479-66967501 TAAAGAACTTTCTGCAGTGATGG - Intronic
1110194202 13:72767609-72767631 AACAGAACGTTCTGCAGTGATGG + Intronic
1110428130 13:75392412-75392434 AAGTGGATTGTCTGCTGTGAGGG - Intronic
1110438467 13:75501479-75501501 AATAGAATGTTCTGCCATGATGG + Intergenic
1110988090 13:82000041-82000063 AATAAAACTTTCTGCAGTGTTGG - Intergenic
1111551943 13:89824647-89824669 AATAGAATTTTTTGTATTGATGG + Intergenic
1111887249 13:94037838-94037860 AATAGAATTTTCTGTGATGATGG + Intronic
1112219834 13:97476920-97476942 AATAGAATGTTCTGCAATGATGG - Intergenic
1112791172 13:103003630-103003652 AATGGGAAATTCTGAAGTGAAGG + Intergenic
1112987107 13:105464767-105464789 AGGAGGACTTTCTGCAGTAATGG + Intergenic
1113275731 13:108727459-108727481 AATCAGAATTTCTGCAATGAAGG - Exonic
1113337061 13:109386686-109386708 AATAGGCCCTTCTGCACTGAAGG - Intergenic
1113504131 13:110801358-110801380 AGCAGGATCTTCTGCAGCGATGG + Intergenic
1115668281 14:35578713-35578735 AATAGAATTATCTGCAGTTATGG + Intronic
1115706259 14:36002076-36002098 TATTGGATTTTGTGCAGTCAAGG + Intergenic
1117255434 14:53972482-53972504 AATAGCATTTTGTCCTGTGATGG + Intergenic
1117560890 14:56937258-56937280 AATAGAACTTTCTGCAATGACGG - Intergenic
1117748486 14:58896435-58896457 AATAGGAGTTCCTGAAGAGAAGG - Intergenic
1118230795 14:63947223-63947245 AATAGGATTTTCTGCAGTGATGG + Intronic
1118581401 14:67303152-67303174 AATAGAACTTTCTCCAATGATGG - Intronic
1118686717 14:68298783-68298805 TATAGCATTCTCTGCAGTGATGG - Intronic
1118800220 14:69182850-69182872 ATTAGTTTTTTCTGTAGTGATGG + Intergenic
1119446576 14:74669562-74669584 AAGAGAACTTTCTGCAGTGGTGG - Intronic
1119701364 14:76757456-76757478 AAAAGAAATTTCTGCAGTGATGG + Intergenic
1119909691 14:78338354-78338376 AATAGGAATTTCTTCAGTGATGG - Intronic
1120586753 14:86321176-86321198 AATATTTTTTTCTGCAGTTAAGG - Intergenic
1121944354 14:98104825-98104847 AGGAGGATTTTATGCAGGGATGG + Intergenic
1122331282 14:100916222-100916244 AGTAGAACTTTCTGCAGTGATGG + Intergenic
1124114192 15:26825091-26825113 AATAGTACTTACTGCAATGAAGG + Intronic
1125008076 15:34840267-34840289 AATCGGACTTTCTGCAAAGACGG - Intergenic
1125040651 15:35182898-35182920 AATAGTATTTTTTGCTTTGAAGG - Intergenic
1125733508 15:41907690-41907712 TTTTGGATTTTCTGCAGAGACGG + Intronic
1125953225 15:43771598-43771620 AATAGAGCTTTCTTCAGTGATGG + Exonic
1126636089 15:50781148-50781170 AATAGGACATTCTGCAGTGATGG - Intergenic
1127228244 15:56958591-56958613 AACAGAACTGTCTGCAGTGACGG - Intronic
1127316391 15:57798076-57798098 AATAGAATGTTATGCTGTGAGGG - Intergenic
1127909387 15:63403587-63403609 AACAGGATTGTCTGCAATGGTGG - Intergenic
1128593588 15:68924831-68924853 AAGAAGATTTTCTTCAGTGCCGG - Intronic
1128676904 15:69616324-69616346 AGTAGGAGGTTCTGCAATGATGG - Intergenic
1128741216 15:70085116-70085138 AGTAGAACTTTCTTCAGTGATGG - Intronic
1129482261 15:75836805-75836827 AATAGAACTTTCTGCAATGATGG - Intergenic
1129614732 15:77089355-77089377 AATAGAACTTTCTGCAGGGATGG + Intergenic
1129813475 15:78530512-78530534 AGTAGGATTTTCTTCAATGAAGG + Intronic
1130624298 15:85497751-85497773 AACAGAATTTTCTGCAATGATGG - Intronic
1131450629 15:92536428-92536450 CACAGAATTTTCTGCAATGACGG + Intergenic
1133308436 16:4826659-4826681 AAAAGAATATTCTGCAATGATGG + Intronic
1133626915 16:7579001-7579023 AACAGCACTTTCTGCAGAGATGG + Intronic
1133883212 16:9802723-9802745 AATAGAACTTTCTGCAATGCTGG + Intronic
1134045728 16:11099533-11099555 AAAAGGACTTTCTGCATTGATGG - Intronic
1134424005 16:14121764-14121786 CATAGAGTTTTCTGCAATGATGG + Intronic
1135090940 16:19516532-19516554 AGTAGAACTTTCTGCAATGATGG - Intronic
1135246521 16:20861841-20861863 AATAGGAATCTCAGCAGGGAAGG - Intronic
1138440606 16:57032687-57032709 AATAGAACTTTCTGCAATGATGG - Intronic
1138616503 16:58171664-58171686 AATAGGACCTTCTGCAATGATGG + Intronic
1138777378 16:59740197-59740219 AATAGGAATTTTTGAAGGGAAGG - Intronic
1138994009 16:62426328-62426350 AATAGACGTTTCTCCAGTGATGG + Intergenic
1139262838 16:65611517-65611539 AATAGAACTTTCTGCAATGATGG - Intergenic
1139437058 16:66942372-66942394 ATGAGGATTTACTGCAATGATGG - Intronic
1139661987 16:68427458-68427480 AACAGAACTTTCTGCAGTGATGG + Intronic
1140181200 16:72720276-72720298 AATAGCACTTTCTGCGATGATGG + Intergenic
1140236917 16:73167749-73167771 AAGAGAATTTTCTGCAGAAAAGG - Intergenic
1140322723 16:73969371-73969393 AGTAGAACTTTCTGCTGTGATGG - Intergenic
1140445323 16:75022732-75022754 AACAGCACTTTCTGCAATGATGG - Intronic
1140724922 16:77803327-77803349 AATAGAACTTTCTGGAATGATGG - Intronic
1140860277 16:79012127-79012149 AATAGAACTTTCTGCAGTGATGG + Intronic
1141077208 16:81018062-81018084 AACAGAGCTTTCTGCAGTGATGG + Intronic
1141757045 16:85998169-85998191 GATAGAAAATTCTGCAGTGATGG + Intergenic
1144153153 17:12470749-12470771 AGTACAACTTTCTGCAGTGATGG + Intergenic
1144367645 17:14560028-14560050 AATACGATTCTCTCCAGAGACGG + Intergenic
1144442206 17:15293697-15293719 AATAGGGCTTTCTGCAATGATGG - Intergenic
1144692024 17:17273381-17273403 AATAGAACTATCTGCAGTGGTGG - Intronic
1146835454 17:36107164-36107186 AACAGAACTTTCTGCAATGATGG - Intergenic
1146850077 17:36214433-36214455 AACAGAACTTTCTGCAATGATGG - Intronic
1147427701 17:40354156-40354178 GATAGAATTTTCTACAATGATGG - Intronic
1147485704 17:40811297-40811319 AAGAGGATTTTTTGGAATGATGG - Intergenic
1147552954 17:41457590-41457612 AGTAGAACTTTCTGCAGTGTTGG + Intergenic
1147554252 17:41466283-41466305 AAGAGGACCTTCTGCAGGGATGG - Intronic
1148136412 17:45294934-45294956 AATAGAACTTTCTGCAATGCTGG - Intronic
1148554722 17:48571492-48571514 ACTAGGATTGTCTGGAGTGAAGG + Intronic
1148661557 17:49337710-49337732 AAAAGGAATTTCTGCATTCAGGG - Intronic
1148945240 17:51256774-51256796 AATAGAAGTTTCTGCAATGATGG - Intronic
1149479719 17:56993321-56993343 AATAGAACTTTCTACAGTAATGG - Intronic
1149517491 17:57291790-57291812 AATAGGTTTTTTTTGAGTGAAGG + Intronic
1150102298 17:62434140-62434162 AATAGAACTTTGTGCAGTGACGG + Intronic
1150251167 17:63705355-63705377 ACTAGAATTTGCTGCAGCGAAGG - Intronic
1150598113 17:66624980-66625002 AACAGAATCTTCTGCAATGAGGG - Intronic
1151162375 17:72176303-72176325 AGGAGGATTTTTTGCAGTGGTGG - Intergenic
1152793504 17:82294575-82294597 AAGAGAATTTTCTGGGGTGAGGG - Intergenic
1153031373 18:716358-716380 AATGGAATTTTCTGAAATGATGG + Intergenic
1153387436 18:4513272-4513294 AAAAGGAATTTATGAAGTGAAGG - Intergenic
1153497469 18:5714387-5714409 AAGAGAACTTTCTGGAGTGATGG - Intergenic
1153518424 18:5927548-5927570 AATAAAACTTTCTGCTGTGATGG + Intergenic
1153737367 18:8085075-8085097 AATAGAACTTTCTGAAATGATGG - Intronic
1153759905 18:8320433-8320455 AGTAGAACTTTCTGCAGTGGTGG + Intronic
1154277229 18:12972727-12972749 AGTAGAATGTGCTGCAGTGATGG + Intronic
1154345377 18:13539485-13539507 AAAAGGGCTTTCTGTAGTGAAGG - Intronic
1154955348 18:21248884-21248906 AACAGAACTTTCTCCAGTGATGG - Intronic
1155208876 18:23584403-23584425 AATAGGATTATTTCCAGTTAAGG + Intronic
1156129870 18:33958653-33958675 AATAAAACTTTCTGCAGTGAAGG - Intronic
1157144643 18:45149294-45149316 ATTAGGTTTTTCTGCCTTGAAGG + Intergenic
1157570306 18:48707914-48707936 AATAGGCATATCTGCAGAGATGG - Intronic
1158033649 18:52998209-52998231 AATAGAACTTTCCACAGTGATGG - Intronic
1158491111 18:57910568-57910590 AGTAGGATTATCAGCAGGGATGG - Intergenic
1158884137 18:61809241-61809263 CATAGGATTTTCTGGGTTGAGGG - Exonic
1159644013 18:70896281-70896303 AGTAGAACTTTCTACAGTGATGG - Intergenic
1161621584 19:5300366-5300388 CACAGAACTTTCTGCAGTGATGG - Intronic
1161927763 19:7313845-7313867 AATAAGATTTTCTTCTGTGTGGG - Intergenic
1162336932 19:10067614-10067636 CATAGAACTTTCTGCAGTGACGG - Intergenic
1163111600 19:15164685-15164707 AATAGGACTTTCTGTGATGATGG - Intronic
1165252165 19:34548150-34548172 AAGAGAACTTTCTGCAGTGGTGG - Intergenic
1165268332 19:34680336-34680358 AAGAGAACTTTCTGCAGTGGTGG + Intronic
1165274532 19:34736561-34736583 AAGAGAACTTTCTGCAGTGGTGG + Intronic
1166221052 19:41364761-41364783 AAGAGGATTTTCTGCAAATAAGG - Intronic
1167222164 19:48206855-48206877 AACAGAACTTTCTGCAGTGATGG - Intronic
1168550800 19:57291695-57291717 AAAAGGCTTTTCTCCAGTGTGGG - Exonic
926051177 2:9745838-9745860 GATAGGATTTGCTTCAGTAAAGG - Intergenic
926651357 2:15349921-15349943 AATAGAACTTTCTTCAGTGAAGG - Intronic
927344287 2:22019448-22019470 AATGGAATTTTCTGCCATGATGG - Intergenic
927494021 2:23540412-23540434 AGTACGATTTTCTGCAATGGTGG - Intronic
927533404 2:23832612-23832634 AATAGAATTTTCTGTGATGATGG - Intronic
928347237 2:30511555-30511577 TATAGAATATTCTGCAATGATGG - Intronic
928438827 2:31274380-31274402 ACTAGGCTTTTCTGGAATGAGGG - Intergenic
928978855 2:37117745-37117767 CATAGGGGTTTCTGGAGTGAGGG - Intronic
929061535 2:37930069-37930091 AAAAGAACTTTCCGCAGTGATGG + Intronic
929213454 2:39384590-39384612 AAAAGAACTTTCTGCATTGATGG + Intronic
929213473 2:39384880-39384902 CATTGGAGTTTTTGCAGTGATGG - Intronic
929924687 2:46198487-46198509 AATAGGATAATTTGCAGTGACGG + Intergenic
930793740 2:55365088-55365110 TATAGAACTTTCTGCATTGATGG - Intronic
931617848 2:64179208-64179230 AGTAGAATTTTCTACAATGATGG + Intergenic
931722169 2:65075020-65075042 AATAGGACTTTATGTGGTGATGG - Intronic
931729411 2:65139849-65139871 AATGGAACTTTCTGCAGTGATGG - Intergenic
931829191 2:66033303-66033325 AATAGAACTTCCTGCAGTGATGG - Intergenic
931945524 2:67302253-67302275 AATAGAATTTTCTGCATCAATGG + Intergenic
932121817 2:69108023-69108045 AATAGAACTTTCTGTAATGATGG + Intronic
932183013 2:69666185-69666207 AATAGGTATTTCTGCAAAGAAGG + Intronic
932236273 2:70123621-70123643 AATCGGGTTTACTGCAGGGAAGG - Intergenic
932259166 2:70312528-70312550 AATAGAACTTTCTGCAATTATGG - Intergenic
932337607 2:70939858-70939880 AAGTGGATTATCTGCAATGATGG + Exonic
932805553 2:74779843-74779865 AAATGGATTTACTGAAGTGAAGG - Intergenic
932830309 2:74983032-74983054 AATAGAATTTTCTGTGATGATGG + Intergenic
933069686 2:77841537-77841559 AATAGAATTTGCTGCAGAAATGG - Intergenic
933494934 2:83038301-83038323 AATAGAATGTCCTACAGTGATGG + Intergenic
934956185 2:98622263-98622285 AACAGAGCTTTCTGCAGTGATGG + Exonic
935039838 2:99415524-99415546 AACTGAACTTTCTGCAGTGATGG + Intronic
935898518 2:107764467-107764489 AAGAGAACTTTCTGCAGTTATGG - Intergenic
937607773 2:123822518-123822540 ATTAATATTTTCTGCAGTGTAGG - Intergenic
938048525 2:128145416-128145438 AACAGAACTTTCTGCAATGATGG - Intronic
938606889 2:132903348-132903370 AATAGAACTTTCTGCAGTGTTGG - Intronic
938704386 2:133909623-133909645 AATATGATTTTCTGCAATGATGG + Intergenic
939362351 2:141189198-141189220 AACAGCACTTTCTACAGTGATGG + Intronic
940046910 2:149419566-149419588 AATAAGACTTTCTGTAATGACGG - Intronic
940249648 2:151660821-151660843 AATAGAACTTTCTGTAATGATGG + Intronic
940351261 2:152691574-152691596 AATAGAACTTTCTGCAGTGATGG - Intronic
940452075 2:153851366-153851388 AATACCATTTTCTGTAGTGAAGG - Intergenic
941376179 2:164733790-164733812 AATGGAATTTTCTGCACTGATGG + Intronic
942712249 2:178849845-178849867 AATATTTTTCTCTGCAGTGATGG + Intronic
943102158 2:183500168-183500190 AATAAGCTTTTGTGCAGCGAAGG - Intergenic
943166000 2:184327095-184327117 TAAAGGATGTTCTTCAGTGAAGG + Intergenic
943601638 2:189927906-189927928 AATACAACTTTCTGCAATGATGG - Intronic
943997147 2:194784387-194784409 AATAGAGTTTTCTGTAGTAATGG - Intergenic
944480137 2:200148805-200148827 AATAGGTTTTTCTGGGTTGATGG + Intergenic
944779302 2:203001736-203001758 GATAGAACTTTCTGCAGTGAAGG - Intronic
944888126 2:204086011-204086033 GATAGAACTTTCTGCAATGATGG - Intergenic
944920075 2:204403605-204403627 AATAGAACTTTCTGCAATGATGG + Intergenic
945008036 2:205430562-205430584 AATAGGATTTTCCGTGATGATGG - Intronic
945369663 2:209001500-209001522 AATAGAATTTTTTGTAATGATGG - Intergenic
945911340 2:215653066-215653088 AGTAGAACTTTCTGCATTGATGG + Intergenic
946028247 2:216685431-216685453 ACCAGGACTTTCTGCAATGATGG - Intronic
946243306 2:218370199-218370221 AATAGAACTTTCTGCAGTGATGG + Intergenic
946342249 2:219077841-219077863 AATCGAACTTTCTGCAATGATGG + Intronic
946892498 2:224292413-224292435 AATATGATTTCCTGGAGGGATGG - Intergenic
947091337 2:226514789-226514811 TATAGACTTTTATGCAGTGATGG - Intergenic
948227511 2:236322934-236322956 AGTAGAACTTTCTGCAATGATGG - Intergenic
948325118 2:237111511-237111533 AATAGAATTTTCAGTAATGATGG - Intergenic
1169267888 20:4177910-4177932 AATAGAACTTTCCACAGTGATGG + Intronic
1169359111 20:4933035-4933057 AATAGAACTTTCTGCAATGAGGG + Intronic
1169676900 20:8164526-8164548 AATAACATATTCTGCAATGATGG - Intronic
1169733065 20:8807697-8807719 AATAGAATTTTCTGCAGTGATGG + Intronic
1169736714 20:8845573-8845595 AATAGAACTTTCTGTAATGATGG - Intronic
1169824048 20:9746560-9746582 AATAGAATTTTCTGCAATGCTGG + Intronic
1169824238 20:9748726-9748748 AATAGAATTTTCTGCAATGCTGG + Intronic
1169947746 20:11007506-11007528 AAAAGGGTTTTCTACACTGAAGG + Intergenic
1170036885 20:11998904-11998926 AATAAATCTTTCTGCAGTGATGG - Intergenic
1170243861 20:14198839-14198861 ATGAGCATTTTCTGCAGTGATGG + Intronic
1170296606 20:14832982-14833004 AATAGAACTTTCTGTAATGATGG + Intronic
1170565595 20:17601671-17601693 AACAGAGTTTTCTGCAATGATGG - Intronic
1171416993 20:24988859-24988881 AATAGAACTTTCTGCAACGATGG + Intronic
1171525349 20:25805366-25805388 AATATTATTTTTTGCAATGATGG + Intronic
1171551478 20:26050518-26050540 AATATTATTTTTTGCAATGATGG - Intergenic
1172071982 20:32264445-32264467 AATAAAACTTTCTGTAGTGATGG - Intergenic
1172464018 20:35142017-35142039 AATCCAATTTTCTGCAGTGATGG - Intronic
1172607502 20:36224108-36224130 AGCAGAACTTTCTGCAGTGATGG + Intronic
1172757439 20:37296215-37296237 AATAAAGCTTTCTGCAGTGATGG - Intronic
1172920439 20:38477091-38477113 AATAGAATTTTCTGCAATCATGG + Intronic
1172965956 20:38835473-38835495 AATAGAGCTTTCTGCAGTGATGG + Intronic
1172973783 20:38891867-38891889 AATAGAACTTTCTACAATGATGG + Intronic
1173064092 20:39692935-39692957 AATAGAACATTCTGCAATGATGG - Intergenic
1173123648 20:40316907-40316929 AATGGGATTTTCTGCAATTATGG - Intergenic
1173360501 20:42340060-42340082 AATAGAATTTTCTGTCATGATGG + Intronic
1173435937 20:43032343-43032365 AATAGAATTTTGTGCAATGGTGG - Intronic
1173550796 20:43931946-43931968 AACAGAACTTTCTGCAGGGATGG - Intronic
1173677479 20:44849473-44849495 AATGGAACTTTCTGCAGTGATGG - Intergenic
1174567622 20:51477999-51478021 AATAGGACTTTCTGTGATGATGG - Intronic
1174623784 20:51897506-51897528 AATAGAACTTTCTGCAATGATGG + Intergenic
1177077470 21:16595275-16595297 CATAGGATGTTCTCTAGTGAGGG + Intergenic
1178081487 21:29071300-29071322 AATAGAACTTTTTGCAGTGCTGG - Intronic
1179001780 21:37467972-37467994 AACAGAATTTTCCGCAATGATGG - Intronic
1180569323 22:16700886-16700908 GATAGAACTTTCTGCAGTGGGGG - Intergenic
1181744993 22:24950146-24950168 AATAGAACTTTCTGCAACGATGG - Intergenic
1182984390 22:34702615-34702637 AAGAGCATTTTCTACAGTGTCGG + Intergenic
1183993259 22:41613210-41613232 AATAGAACTTTCTGCAGTGATGG - Intronic
949358452 3:3206358-3206380 AATAGAACTTTCTGTGGTGATGG - Intergenic
949773496 3:7604787-7604809 AATAAGAGTTTCTGAATTGAAGG + Intronic
949776177 3:7635004-7635026 GATAGAATTTTCTGTAATGATGG + Intronic
949938377 3:9135174-9135196 AATGGAAGTTTCTGCAATGATGG - Intronic
950005403 3:9688069-9688091 AAGAGGCTCTTCTGCAGGGAAGG + Intronic
950011025 3:9723923-9723945 AATAGCACTTTCTGCAATGATGG + Intronic
950023867 3:9807649-9807671 AATGGAACTTTCTGCAATGATGG - Intronic
950382947 3:12632970-12632992 AAAAGGGGTTTCTGCAGTCAAGG - Intronic
950938586 3:16869305-16869327 AACAGAACTTTCTGCAGTGTTGG - Intronic
951036148 3:17934354-17934376 AGTAGAATTTTCTGCAGTGATGG + Intronic
951354176 3:21643849-21643871 AATAGAACTTTCTGCAGTTTTGG - Intronic
951410257 3:22354958-22354980 AGTAGAACTTTCTGCAGTGAGGG - Intronic
951428125 3:22573313-22573335 AATGGGCTTTTCTGCATTCATGG + Intergenic
951534925 3:23731815-23731837 AATAGAACTTTCTGCAATGGTGG + Intergenic
951693551 3:25421956-25421978 AATAGAGCTTTCTGCAATGATGG + Intronic
951724776 3:25745133-25745155 AATAGAATTTTCAGCAATAATGG + Intronic
951728499 3:25784542-25784564 AAAAGGAATTTCTGCAAAGAAGG - Intronic
951791124 3:26485841-26485863 GAGAGTAGTTTCTGCAGTGATGG - Intergenic
953648429 3:44776724-44776746 AATGGAACTTTCTGCAGTGATGG + Intronic
953774397 3:45803223-45803245 AATGGAACTTTCTGCAGTGATGG - Intergenic
954097588 3:48341421-48341443 AATGGAATATTCTGCAGTGTGGG - Intergenic
954442212 3:50528008-50528030 AAAACGATTTTCTCCAGTTAAGG - Intergenic
954470073 3:50686253-50686275 AGCAGAGTTTTCTGCAGTGATGG - Intronic
954532359 3:51332212-51332234 AATAGGGTTGTATGGAGTGAAGG + Intronic
955112749 3:55965236-55965258 AATAGAACTTTCTGCAATTATGG + Intronic
955178716 3:56644826-56644848 AATAGAACTTTCTGCAATAATGG + Intronic
955331916 3:58054369-58054391 AATAGAAGTTTCTGCAACGATGG - Intronic
955533279 3:59897162-59897184 AAAAGAACTTTCTGCAATGATGG + Intronic
955551531 3:60090310-60090332 AAAAGTAATTTCTCCAGTGATGG - Intronic
955717888 3:61849823-61849845 AAAAGGAGTTTCAGCAGTTATGG - Intronic
955765365 3:62338988-62339010 AACAGAATTTTCTGCAGTGGCGG + Intergenic
955973017 3:64454691-64454713 AATAGAATTTTCTGGAATTATGG - Intergenic
956016634 3:64890641-64890663 AACAGAACTTTCTGCAATGACGG - Intergenic
956058449 3:65325459-65325481 AATAGAACTTTCTGCAGTGATGG - Intergenic
956203710 3:66734193-66734215 AATAGGACTTTCTGTGATGATGG - Intergenic
956366844 3:68513318-68513340 AATAGTACTTTCTGTAGGGATGG + Intronic
956384478 3:68702224-68702246 AATAGGTCTTTCTGTAATGATGG + Intergenic
956682914 3:71798002-71798024 AATAGAACTTTCTGCAATGGTGG + Intergenic
956758738 3:72417772-72417794 AATAGGATTATCTGTAATGATGG - Intronic
956771531 3:72530256-72530278 AATAGAACTTTTTGCAATGATGG - Intergenic
956906202 3:73767918-73767940 AATAGGACTTTCTGCAATAATGG + Intergenic
956982763 3:74658157-74658179 AGTAGAATTTTCTGCAAAGATGG - Intergenic
958428027 3:94002172-94002194 AGTAGAACTTTCTGCAATGATGG + Intronic
958879196 3:99650334-99650356 AATAGAACTTTCTGCAATGATGG + Intronic
959721322 3:109492837-109492859 ATTAGCATCTTCTCCAGTGATGG + Intergenic
959999179 3:112713098-112713120 AATATTACTTTCTGCACTGAAGG - Intergenic
960051651 3:113244681-113244703 CGTAGAATTTTCTGCAATGATGG - Intronic
960064681 3:113358166-113358188 AAGAGTATTTCCTGAAGTGAGGG + Intronic
961022483 3:123520551-123520573 AATAGAACTTTCTGCATTGCTGG - Intronic
961161782 3:124732679-124732701 GATAGAACTTTCTGCAATGATGG - Intronic
961901270 3:130214221-130214243 AAGAGGATTTTCAGGAGAGAAGG + Intergenic
961919287 3:130409066-130409088 AATAGGAGTTTCTGCAGTGATGG - Intronic
961941658 3:130644284-130644306 AATAGAAGTTTCTGCAGTGATGG + Intronic
961993393 3:131215927-131215949 AGTAGAATTTTCTGCAGTGTTGG + Intronic
962054164 3:131851014-131851036 AATAGATGGTTCTGCAGTGAAGG - Intronic
962572876 3:136728732-136728754 AATGTAACTTTCTGCAGTGATGG - Intronic
963020746 3:140870713-140870735 AATAGAACTTTCTGCAATTATGG + Intergenic
963118207 3:141751852-141751874 AATAGAATTTTCTTCACTGAAGG - Intergenic
963149768 3:142033328-142033350 AATAGAACTTTCTTCAGTGATGG - Intronic
963714888 3:148791671-148791693 ATTAGGATTATATGCACTGATGG + Intronic
964187002 3:153958208-153958230 AATAGAACTTCCTGCAGTTATGG - Intergenic
964617291 3:158680877-158680899 AATAGAACTTGGTGCAGTGATGG + Intronic
965312442 3:167147326-167147348 AATGGGATTTCATGCAGTGTTGG - Intergenic
965757860 3:172042712-172042734 AATGGAATTTTCTTCAGTGTTGG + Intronic
965785638 3:172331847-172331869 AATAGAACTTTCTGCAGTGATGG + Intronic
966289385 3:178337249-178337271 ATTAGCATTTTCTTCAGTGATGG + Intergenic
967377731 3:188824479-188824501 AACAGGATTATCTGCAATAATGG - Intronic
968211608 3:196853616-196853638 AATAGAACTTTCTGCAATGATGG + Intergenic
968237399 3:197042101-197042123 AATAGTCTTTTCAGCTGTGATGG + Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969103180 4:4785160-4785182 GGAAGGATCTTCTGCAGTGAGGG - Intergenic
969237999 4:5880190-5880212 ACTGGGAATTTCTGCACTGAGGG + Intronic
970014278 4:11495447-11495469 AAAAGAACTTTGTGCAGTGATGG + Intergenic
970020648 4:11563845-11563867 AAAAGAAATTTTTGCAGTGATGG + Intergenic
970175097 4:13331534-13331556 GATAGAACTTTCTGCACTGAGGG - Intergenic
970679101 4:18486703-18486725 AAGAGAACTTTCTACAGTGATGG + Intergenic
971081200 4:23213583-23213605 AACAGAACTTTCTGCAATGAGGG - Intergenic
972757287 4:42061176-42061198 AACAGAATTTTCTGCAATGATGG + Intronic
973148061 4:46854501-46854523 AATAGAACTTTCAGCAGTGATGG - Intronic
973619005 4:52709300-52709322 CATACAACTTTCTGCAGTGATGG - Intergenic
973790091 4:54370260-54370282 AATAGAACCTTCTGCAATGATGG + Intergenic
974701681 4:65457212-65457234 AATGGGATTTAGTTCAGTGAAGG + Intronic
976067191 4:81201354-81201376 AGTAGAACTTTCTTCAGTGATGG - Intronic
976198623 4:82558346-82558368 AAAAGAACTTTCTGCATTGATGG - Intronic
977337218 4:95714604-95714626 ATAAGGATTTTGTGCAGGGAAGG + Intergenic
977534008 4:98235631-98235653 AGTAGAATTTTCTACAGTGATGG - Intergenic
979144883 4:117233609-117233631 AACAGCATTTTCTGCAATAATGG + Intergenic
979608108 4:122660687-122660709 TATATAACTTTCTGCAGTGATGG - Intergenic
979718251 4:123867692-123867714 AATAGGATTTTCATCATTGTAGG + Intergenic
980240290 4:130164605-130164627 AATAGAATTTTCTGTGATGATGG + Intergenic
980251274 4:130318746-130318768 AATAGAACTTCCTGCAATGATGG - Intergenic
980500915 4:133652258-133652280 AACAGAAATTTCTGCAATGATGG + Intergenic
980847506 4:138341813-138341835 AATAGAACATTCTGCAATGAGGG + Intergenic
980925453 4:139132625-139132647 AATAGAATTTTCAGCAATGAAGG - Intronic
980999554 4:139815634-139815656 AATAAGATATTCTGCATTCATGG + Intronic
981793009 4:148561651-148561673 AATAGAACTTTCTGTGGTGATGG - Intergenic
981880043 4:149599216-149599238 AATGGGATGTTGTGCATTGATGG + Intergenic
981946296 4:150348090-150348112 TCTAGAATTTTCTGCAGTGCTGG - Intronic
982179133 4:152733799-152733821 AAAAGAACTTTCTGCAATGATGG - Intronic
982366995 4:154590070-154590092 AATACGCTTTTCCGCAGTAATGG - Intronic
982628016 4:157792508-157792530 AATAGAACTTTCTGTAATGATGG + Intergenic
983165049 4:164465417-164465439 AAGAGAATTGTCTGAAGTGAAGG - Intergenic
983259719 4:165442706-165442728 AGTAGAACTTTCTGCAGTGGTGG - Intronic
983398923 4:167238049-167238071 TATAGGATCTTAGGCAGTGAAGG - Intergenic
984087301 4:175328587-175328609 ATTAGAACTTTCTGCAGTAATGG - Intergenic
984231078 4:177100176-177100198 ATTTGGATTTTCTGCATAGAGGG + Intergenic
984275850 4:177608083-177608105 AATAGAACTTTCTGCGATGATGG - Intergenic
984461453 4:180041766-180041788 AATAGGATATTCTGCAATAATGG - Intergenic
985032130 4:185800024-185800046 AATAGTATTTTTAGCAGAGACGG - Intronic
985082402 4:186279511-186279533 CATAGATCTTTCTGCAGTGATGG - Intronic
985085283 4:186306907-186306929 AGTAGAACTTTCTGCAGTTATGG + Intergenic
986379350 5:7167376-7167398 AACAGGATATTCTCCATTGAGGG - Intergenic
986844719 5:11739148-11739170 AGTAGAACTTTCTGCAGTGATGG - Intronic
987136109 5:14901062-14901084 GAAAGGATTTTTGGCAGTGACGG - Intergenic
987154108 5:15070644-15070666 AATAGGATTTTCTGCACTGATGG + Intergenic
987684757 5:21182733-21182755 CATATGATTTTCAGCTGTGATGG + Intergenic
987920644 5:24275761-24275783 AGTAGGACTTTCTGAGGTGATGG + Intergenic
988271167 5:29019107-29019129 AATAACACTTTCTGCAATGATGG + Intergenic
988357336 5:30195641-30195663 AATAGGATTTAGTTCAGAGAGGG - Intergenic
988611893 5:32734669-32734691 AATGGAACTTTCTGCAATGATGG + Intronic
988703918 5:33704642-33704664 AATAGGAATTTCTTCAAAGAAGG - Intronic
990309280 5:54522384-54522406 AATAGAACTTTCAGCACTGATGG - Intronic
990318722 5:54609109-54609131 AGTAGAAATTTCTGCAATGATGG + Intergenic
990427469 5:55701166-55701188 AATAGAACTTTCTACAATGATGG - Intronic
990434673 5:55776571-55776593 AACAGAATTTTCTTCAGTAAAGG + Intronic
990953239 5:61319178-61319200 AGTTAGATTTTCTGCAGGGAGGG + Intergenic
990963514 5:61419660-61419682 AATAGAATTTTCTACAATGATGG - Intronic
991388820 5:66120654-66120676 AATAGGACTTACTGAAATGATGG + Intergenic
991527751 5:67580892-67580914 AATAGGATTTTCTGCAGTAATGG + Intergenic
992243893 5:74797736-74797758 AATAGAACTTTCTGCAGTGATGG - Intronic
992914867 5:81438833-81438855 AATAGAATTTTGTGCAATGATGG + Intronic
992983946 5:82207741-82207763 AATAGAACTTTCTGCAAAGATGG + Intronic
993210362 5:84941982-84942004 AATAGGCCTTTTTGCATTGATGG - Intergenic
993345659 5:86778904-86778926 ACTAGAACTTTCTGCAGTGAGGG + Intergenic
994164455 5:96594247-96594269 TATATGATTTTCTGCAGGAACGG - Intronic
994498497 5:100543495-100543517 AATAGAACTTTCTGCAGTGATGG - Intronic
995087545 5:108131961-108131983 AAAAGGACTTTCTTCAGTCAAGG - Intronic
995439510 5:112174627-112174649 AAAATGATTATATGCAGTGATGG - Intronic
995656942 5:114436798-114436820 AATAGAACTTTCTGCAGTGATGG + Intronic
995942965 5:117607472-117607494 AATAGGATCTCCTGCATTGCTGG - Intergenic
995996013 5:118300333-118300355 AATAGAGCTTTCTCCAGTGATGG + Intergenic
996183040 5:120443357-120443379 AATAGAATGTTCTGTAGTGGTGG + Intergenic
996373128 5:122774603-122774625 AATAGAATTTTCTGACATGATGG - Intergenic
996905851 5:128598672-128598694 ATTAGGCTTTTCTTCATTGAAGG + Intronic
997244404 5:132334443-132334465 AATAGAACTTTCTGCAGTGACGG + Intronic
997730523 5:136169462-136169484 AATAGTATTTGGTGCTGTGATGG - Intronic
998375450 5:141687546-141687568 GATAGAATTTCCTGCAATGATGG + Intergenic
998787917 5:145732418-145732440 AATAGAACTTTCTACATTGATGG + Intronic
999319713 5:150606316-150606338 AGTAGGTATTACTGCAGTGAGGG - Intronic
999624737 5:153508223-153508245 CATAGAACTTTCTGCAGTGTTGG + Intronic
1000112892 5:158126127-158126149 AATATGATTTTTTGTAGGGAAGG + Intergenic
1000214003 5:159137558-159137580 AATAGACTTTTCTGCAATAATGG + Intergenic
1000383420 5:160649532-160649554 AATAGAACTTACTGCAATGATGG + Intronic
1000525687 5:162354792-162354814 AATAGAACTTTCTGCAGTAATGG + Intergenic
1001744194 5:174078168-174078190 AACAGAACTTTCTGCAATGATGG - Intronic
1002987469 6:2204686-2204708 AATAAAATTTTCTGCAATGATGG - Intronic
1003654290 6:7991392-7991414 AGTAGAACTTTCTGCAGTGGGGG - Intronic
1004191966 6:13471787-13471809 AGTAGAACTTTCTGCAATGATGG + Intronic
1004314931 6:14578228-14578250 AGTGGAATTTTCTCCAGTGATGG - Intergenic
1004735260 6:18399566-18399588 AGTGGGATTTTCAGCAGTCATGG - Exonic
1004982174 6:21037534-21037556 AATAGAGCTTTCTGCAGTGATGG + Intronic
1005084985 6:21996480-21996502 AATAGAACTTTCTGCAGTGATGG - Intergenic
1005116255 6:22340899-22340921 AATAGAACTTTCTGCGGTGATGG - Intergenic
1006328158 6:33369794-33369816 AATAGAACTTTCTGCAATGATGG - Intergenic
1006483907 6:34322083-34322105 AATAGAACTTTCTGAAGTGAAGG - Intronic
1006596658 6:35198407-35198429 AATAGAACTTTCTGCAGTGATGG - Intergenic
1008841122 6:55905741-55905763 AATAGGATTTTCAGAAGATATGG + Intergenic
1008851989 6:56033610-56033632 AAGAGGATTTTATGCAGTGGAGG - Intergenic
1009172160 6:60414147-60414169 TATATCATTTCCTGCAGTGAAGG - Intergenic
1009353183 6:62707817-62707839 AATGGGATTTGCTGCCTTGAAGG - Intergenic
1009441347 6:63682795-63682817 AATAGTATATTCAGCTGTGAAGG - Intronic
1009826612 6:68874141-68874163 ATTAGGATTTTCTAAAATGATGG + Intronic
1010205196 6:73316134-73316156 AATAGACGTTCCTGCAGTGATGG + Intergenic
1010617680 6:78032351-78032373 AAGAGAATTTTCTGGGGTGAGGG - Intergenic
1010902639 6:81446451-81446473 AAAAGGAAATTCTGCAGTTAAGG - Intergenic
1011441994 6:87397422-87397444 AACAGAATTTTCTACAATGATGG + Exonic
1011543618 6:88460813-88460835 AAGAGAACTTTCTGGAGTGATGG - Intergenic
1011661828 6:89601355-89601377 GTAAGGAATTTCTGCAGTGAGGG - Intronic
1012482474 6:99682476-99682498 AATGAAATTTTCTGCAGTGGAGG - Intergenic
1013439682 6:110150546-110150568 AGTACAACTTTCTGCAGTGAAGG - Intronic
1014793089 6:125696762-125696784 AATAGGATTTTTTGGGGGGAGGG - Intergenic
1015295395 6:131585655-131585677 AGTATGACTTTCTGCAATGATGG - Intronic
1015715111 6:136184536-136184558 AATGGGATTTGCTGCAATGATGG - Intronic
1016078845 6:139831170-139831192 GAAAGGAATTTCTGCACTGAAGG + Intergenic
1016370626 6:143370345-143370367 AATAGAACTTCCTGCAGTGCTGG + Intergenic
1016427593 6:143950793-143950815 AACAGAACTTTCTGCAATGATGG + Intronic
1016432780 6:144005719-144005741 AATATAAATTTCTGCAATGATGG + Intronic
1016745946 6:147580504-147580526 AATAGGACTTTCTGTAATGATGG + Intronic
1018207720 6:161451157-161451179 AAGATGATTTTCTGCGGTGCTGG - Intronic
1018944638 6:168338928-168338950 AATAGGAATCTTTCCAGTGATGG - Intergenic
1019988007 7:4672245-4672267 AACAGAACTTTCTGCAGTGATGG + Intergenic
1020749104 7:12117052-12117074 CATTGAACTTTCTGCAGTGAGGG - Intergenic
1021056553 7:16054887-16054909 CATAGGATTTTCTACATAGATGG - Intergenic
1021083530 7:16391696-16391718 AATAAAACATTCTGCAGTGATGG - Intronic
1021642992 7:22758390-22758412 AATAGATATTTCTGCAGTGATGG - Intergenic
1022394389 7:29972776-29972798 AAAAGAATTTTCTACAATGATGG + Intronic
1022461263 7:30610089-30610111 AACGGAACTTTCTGCAGTGATGG + Intronic
1022838343 7:34137999-34138021 AATAGCACTCTCTTCAGTGATGG + Intronic
1023564924 7:41514791-41514813 AATAGGATTTCTGGCAATGAGGG - Intergenic
1024588838 7:50863759-50863781 AATAGACTTATCTGCAATGATGG - Intergenic
1026938628 7:74273645-74273667 AAAAGGTTTTTCTGTAGAGATGG + Intergenic
1027549509 7:79573738-79573760 GATGGGATGTGCTGCAGTGAAGG - Intergenic
1027550879 7:79593553-79593575 AACAGAACTTTCTGCAATGATGG - Intergenic
1027569697 7:79848440-79848462 AACAGGATTTTCTTGAGTGGAGG - Intergenic
1028956051 7:96691860-96691882 AATAGAACTTGCTGTAGTGATGG - Intronic
1029257642 7:99280309-99280331 AGCAGAACTTTCTGCAGTGACGG - Intergenic
1029309122 7:99644889-99644911 ATCAGGAGTGTCTGCAGTGAAGG - Intergenic
1029897041 7:103994074-103994096 AATAGGACTTTCTGCAGTAATGG - Intergenic
1030788529 7:113694018-113694040 AATAGAACTTTGTTCAGTGATGG + Intergenic
1030898060 7:115086053-115086075 AATCAGAATTTCTGGAGTGATGG + Intergenic
1030961447 7:115928504-115928526 CATAGTATTTTCTGCAATGTTGG - Intergenic
1030964652 7:115975970-115975992 AGTAGAAATTTCTGCAATGATGG + Intronic
1031056776 7:117000287-117000309 AATAGAACTTTCTGCAATAATGG + Intronic
1031907296 7:127474810-127474832 AATAGAACTTTCTGCAATGATGG + Intergenic
1032031445 7:128487003-128487025 AATAGAACTTTGTGCAGTGATGG + Intronic
1032938157 7:136757781-136757803 GCTAGGATTTTCTAAAGTGATGG - Intergenic
1034004767 7:147459046-147459068 AACAGAATTTTCAGCAGTGATGG + Intronic
1034367827 7:150567265-150567287 AATAGAACTTTCTGCAGGGATGG - Exonic
1034920906 7:155080842-155080864 AATGGGATTTTCTGCTGGAATGG + Intronic
1036505413 8:9350387-9350409 AATGGAACTTTCTGCAGTGATGG - Intergenic
1036908860 8:12734865-12734887 AATAGAATTTTCTGCATTGATGG - Intronic
1038548017 8:28441069-28441091 AGTAGAATTTACTGCAGAGATGG + Intronic
1038829290 8:31039097-31039119 AAAAGGCTTTTCTGCAGAAATGG - Intronic
1039134849 8:34309936-34309958 AATAGAAATTTCCACAGTGATGG - Intergenic
1039753839 8:40501200-40501222 AGTAGGACTTTTTGCAATGAAGG - Intergenic
1039753858 8:40501472-40501494 AGTAGGACTTTTTGCAATGATGG + Intergenic
1040454156 8:47579380-47579402 CACAGAATTTTCTGCATTGATGG + Intronic
1040472557 8:47747019-47747041 AGTAAGATTTTCTGAAATGAAGG + Intergenic
1041380651 8:57251253-57251275 AATAGAACTTTTTGCATTGATGG - Intergenic
1041449260 8:57989984-57990006 AATAGAACTTTCTGCAATGATGG + Intergenic
1041593565 8:59619957-59619979 AATAGGACTCTCTGGAATGAAGG - Intergenic
1041695891 8:60735806-60735828 CATGTAATTTTCTGCAGTGATGG + Intronic
1041778759 8:61554664-61554686 AAAAGAATTTTCTACTGTGATGG - Intronic
1042610362 8:70592791-70592813 AATAGAACTTTCTGCAATCATGG + Intronic
1043455859 8:80411471-80411493 AATAGAACTTTCTGCAATGATGG + Intergenic
1043505118 8:80894975-80894997 AATAGAACTTTCTGCAGTTATGG + Intergenic
1043515013 8:80988045-80988067 AATAGAACTTTCTGCAGTGCTGG - Intronic
1043772077 8:84216657-84216679 AACAGAATTTTCTTCACTGAGGG + Intronic
1044358010 8:91247706-91247728 AACAGGATTTTATGAATTGAAGG - Intronic
1044629866 8:94268038-94268060 AATAGAATTATCTCAAGTGAAGG + Intergenic
1045230437 8:100301211-100301233 AATAGAACTTTCTGTGGTGAAGG - Intronic
1045480425 8:102587135-102587157 AATAGAATTTTCTGCCATGGTGG + Intergenic
1045507090 8:102786511-102786533 AGTAGAATTTTCTGCAAGGATGG - Intergenic
1045562392 8:103277672-103277694 AGCAGAATTTTCTGCTGTGATGG + Intergenic
1045633370 8:104154312-104154334 AATAGAACTTTTGGCAGTGATGG + Intronic
1045714422 8:105025086-105025108 AATAGAACTTTCTGCAGTGATGG - Intronic
1046072469 8:109273992-109274014 TATAGAATTTTCTGCATTGGTGG - Intronic
1046437084 8:114204853-114204875 AAGAGTATATTCTGCAGTGGTGG - Intergenic
1046573774 8:115999708-115999730 CCTAGGATTTTCAGCAGAGAGGG + Intergenic
1046583990 8:116128856-116128878 AACAGAACTTTCTGCAATGATGG + Intergenic
1046598833 8:116294189-116294211 AAAATGATTTTCAGAAGTGAGGG - Intergenic
1047029010 8:120855732-120855754 AGTAAAATTTTCTTCAGTGATGG - Intergenic
1047048089 8:121077653-121077675 AATAGAATGTTCTGCAATAATGG - Intergenic
1047564659 8:126030740-126030762 AATAGAACTTTCTTCAGTGATGG + Intergenic
1047696657 8:127410185-127410207 AAAAGGACTTTCTGCACTGATGG + Intergenic
1050162564 9:2733579-2733601 AATAGAACTTTCTGTAATGATGG + Intronic
1050375403 9:4967387-4967409 AATAGAAATGTCTGCTGTGATGG - Intergenic
1050430971 9:5561284-5561306 AGTAGAACTTTCTGCAATGATGG - Intronic
1050450639 9:5778300-5778322 CTTAGGATTTTCTACATTGAAGG + Intronic
1050981899 9:12029846-12029868 AATTTTATTTTCTGTAGTGAGGG + Intergenic
1051615798 9:19005253-19005275 AATAGGATTTTCTGCCAAAAAGG - Intronic
1051618557 9:19029647-19029669 AACAGAACTTTCCGCAGTGATGG + Intronic
1051811656 9:21056130-21056152 AACAGGAGTTTCTGCAATAATGG - Intergenic
1052476219 9:28963199-28963221 AACAGAACTTTCTGCAGTGTTGG + Intergenic
1052803775 9:32994150-32994172 AATAGAATTTTCTGCAATGACGG + Intronic
1053129420 9:35606495-35606517 AATAGAATTTTCTTCAGTGACGG + Intronic
1053349962 9:37407247-37407269 AGGAGGGTTTTATGCAGTGATGG - Intergenic
1053485111 9:38447058-38447080 AAAAAGCTTTTGTGCAGTGAAGG - Intergenic
1053785503 9:41649995-41650017 ACTAGGAATTCCTGCAGTGTAGG - Intergenic
1054159528 9:61664178-61664200 ACTAGGAATTCCTGCAGTGCAGG + Intergenic
1054174222 9:61863947-61863969 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1054449081 9:65393014-65393036 ACTAGGAATTCCTGCAGTGCAGG - Intergenic
1054663315 9:67716834-67716856 ACTAGGAATTCCTGCAGTGCAGG + Intergenic
1054781734 9:69172349-69172371 AACAGAACTTTCTGCATTGATGG + Intronic
1055344560 9:75321608-75321630 AATAGAACTTTTTGCAATGATGG - Intergenic
1055355997 9:75437598-75437620 GATAGAACTTTCTACAGTGATGG + Intergenic
1056266621 9:84903189-84903211 AACAGACCTTTCTGCAGTGATGG - Intronic
1057525245 9:95793406-95793428 AGTAGAAATTTCTGCAGTGATGG + Intergenic
1057748052 9:97767485-97767507 AAAAGGACTTTCTACAATGATGG - Intergenic
1058375649 9:104317990-104318012 AATAGGAGTTTCTTCAATGATGG - Intergenic
1059535434 9:115076074-115076096 GATTGGAGTTTCTGCTGTGAAGG - Exonic
1059641828 9:116224609-116224631 AATAGGATTTGCTGCAATAACGG + Intronic
1059646187 9:116270302-116270324 AATGGATTTTTCTGCAATGATGG + Intronic
1059821211 9:117974204-117974226 AACAGAACTTTCTGCAGCGATGG - Intergenic
1060062430 9:120472790-120472812 AATAGAACTTTCTCCAGTGATGG + Intronic
1060117735 9:120957325-120957347 AAAAACATTTTCTACAGTGATGG + Exonic
1060137837 9:121174502-121174524 AACAGAACTTTCTGCAATGATGG - Intronic
1060432776 9:123564610-123564632 AACAGAACTTTCTGCAGTGATGG + Intronic
1061078900 9:128358277-128358299 AACAGAACTTTCTGCAGCGATGG + Intronic
1061333482 9:129912783-129912805 AACAGAACTTTCTACAGTGATGG + Intronic
1186513898 X:10151600-10151622 AATAGAATTATCTGCAATGATGG + Intergenic
1186894241 X:13990170-13990192 AATAGAAATTTCTTCAATGATGG - Intergenic
1187060406 X:15781558-15781580 AATAGAACTTTCTGCAATGACGG - Intronic
1187174467 X:16883530-16883552 AATGGAACTTTCTGCAATGATGG + Intergenic
1187218101 X:17296633-17296655 AATAAAACTTTCTGCAATGATGG + Intergenic
1187237222 X:17478753-17478775 AATAGGATTTTCTGTGATGCTGG + Intronic
1187279797 X:17849350-17849372 AGTAGAACTTTCTGCAATGATGG - Intronic
1187375746 X:18752029-18752051 AATAGGCTTTTTTGCAGAAATGG - Intronic
1187931399 X:24296619-24296641 GACAGAATTTTCTGCATTGATGG + Intergenic
1187941816 X:24389929-24389951 CTGAGGACTTTCTGCAGTGATGG + Intergenic
1187959215 X:24552418-24552440 ACTAGGACTCTCTGCAGTGCTGG + Intergenic
1187972089 X:24669141-24669163 AGCAGAATTTTCTGCAATGATGG + Intronic
1187983396 X:24783936-24783958 AATAGTACTTCCTGCAATGATGG - Intronic
1188339708 X:28984088-28984110 AATAGAATTTTCTGCAGTAATGG + Intronic
1188439715 X:30203658-30203680 AATAGAATTTTCTGCACTAATGG + Intergenic
1188746682 X:33853265-33853287 AATATTATTTTCTGGACTGATGG - Intergenic
1189453229 X:41159147-41159169 AATAGAAATTTCTGCAAAGAAGG + Intronic
1189696250 X:43666413-43666435 AATAGGATTTGCTGCTGGAATGG - Intronic
1189894519 X:45640439-45640461 AAGAGAATTTTATGGAGTGATGG - Intergenic
1189965109 X:46364729-46364751 AATAGAACTTTCTGCAATTATGG - Intergenic
1191730698 X:64332009-64332031 AATAGAACTTTCTGCAATGATGG + Intronic
1193726344 X:85044019-85044041 TCTAGAATTTTCTGCAATGATGG + Intronic
1193861766 X:86676505-86676527 AATAGAACTTTCTGCGATGATGG + Intronic
1194272703 X:91837771-91837793 AACAGAATTTTCTGCAAGGACGG + Intronic
1194339147 X:92688001-92688023 GATAGTATTTTCTTCAGTAATGG - Intergenic
1195734060 X:107995274-107995296 AATAGAACTTTCTGTGGTGATGG - Intergenic
1195792891 X:108608090-108608112 AAAAGGATTTTCTGAATTAAAGG + Intronic
1195843482 X:109200842-109200864 AATAGTATTTTCTGCAATGATGG + Intergenic
1195997195 X:110743165-110743187 AATAGAACTTTTTGCAATGATGG - Intronic
1196611505 X:117719870-117719892 GGGAGGGTTTTCTGCAGTGAGGG + Intergenic
1197777768 X:130130690-130130712 AATAGAACTTTCTGCTGCGATGG - Intronic
1198093168 X:133351949-133351971 ATTTGTATTTTCTGCACTGATGG - Intronic
1198374280 X:136022418-136022440 AACAGAACTTTCTGCAATGATGG - Intronic
1198623479 X:138540903-138540925 GATATGATTTATTGCAGTGAGGG - Intergenic
1198697682 X:139360347-139360369 AATAGAGCTTTCTGTAGTGATGG + Intergenic
1198810516 X:140531424-140531446 AACAGAACTTTCTGCAATGATGG - Intergenic
1200589948 Y:5059187-5059209 AACAGAATTTTCTGCAAGGACGG + Intronic
1200647538 Y:5804782-5804804 GATAGTATTTTCTTCAGTAATGG - Intergenic