ID: 1118232871

View in Genome Browser
Species Human (GRCh38)
Location 14:63970237-63970259
Sequence AGAGTGCACCAGCACAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7559
Summary {0: 1, 1: 1, 2: 64, 3: 814, 4: 6679}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118232867_1118232871 29 Left 1118232867 14:63970185-63970207 CCAATCCCTGTCTTTTTTTTTTG 0: 1
1: 0
2: 29
3: 575
4: 5083
Right 1118232871 14:63970237-63970259 AGAGTGCACCAGCACAATCATGG 0: 1
1: 1
2: 64
3: 814
4: 6679
1118232868_1118232871 24 Left 1118232868 14:63970190-63970212 CCCTGTCTTTTTTTTTTGAGATC 0: 1
1: 4
2: 36
3: 1053
4: 3843
Right 1118232871 14:63970237-63970259 AGAGTGCACCAGCACAATCATGG 0: 1
1: 1
2: 64
3: 814
4: 6679
1118232869_1118232871 23 Left 1118232869 14:63970191-63970213 CCTGTCTTTTTTTTTTGAGATCG 0: 1
1: 3
2: 74
3: 1108
4: 3268
Right 1118232871 14:63970237-63970259 AGAGTGCACCAGCACAATCATGG 0: 1
1: 1
2: 64
3: 814
4: 6679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118232871 Original CRISPR AGAGTGCACCAGCACAATCA TGG Intronic
Too many off-targets to display for this crispr