ID: 1118233194

View in Genome Browser
Species Human (GRCh38)
Location 14:63973767-63973789
Sequence GTTCCATTTGACTGCCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118233194 Original CRISPR GTTCCATTTGACTGCCTTAA AGG Intronic
902261355 1:15227118-15227140 GTTCCATCTGACTGTCTTCCTGG - Intergenic
903637196 1:24829457-24829479 CTTCTCTTTGACTGCCTAAATGG - Intronic
907641879 1:56198791-56198813 ATTCCAGTTGCCTGGCTTAATGG - Intergenic
908956786 1:69640189-69640211 CATCCATTTCACTGTCTTAAGGG + Intronic
909989279 1:82202603-82202625 GTCCCAGTTTATTGCCTTAAAGG + Intergenic
916387656 1:164294147-164294169 GTTACATTTGACAACCTTATGGG - Intergenic
916854848 1:168738721-168738743 GTTACCTTTGACTTCCTGAAGGG - Intergenic
918015428 1:180628935-180628957 GGGACATTTGGCTGCCTTAAAGG + Intergenic
918553175 1:185768029-185768051 GTTCAAGTTAACTGCCATAAAGG + Intronic
920706266 1:208252837-208252859 GTTCCATTTTCCTCCCTAAAAGG + Intergenic
921315592 1:213887422-213887444 GTCACATTTGACTTCCCTAAGGG - Intergenic
921706878 1:218332285-218332307 ATTCCATATTATTGCCTTAAAGG + Exonic
923656221 1:235919386-235919408 GTTCCATTTCAGTGACTCAATGG + Intergenic
1072779804 10:98240683-98240705 TTTCCATTATTCTGCCTTAAAGG + Intronic
1074387860 10:113031257-113031279 ATTCCATTTTACTTCCTCAAAGG - Intronic
1074834113 10:117272769-117272791 ATGCCATTTGACTGGCCTAATGG + Intronic
1074970727 10:118534364-118534386 GTTCCTCTTGACTTCCTTCACGG + Intergenic
1076825931 10:132968152-132968174 GGTCCATTTGACTGGGCTAAGGG + Intergenic
1080121656 11:28684964-28684986 TTTCAATTTGATTGCATTAAAGG + Intergenic
1080250064 11:30223636-30223658 GTTCCATCTGACTGCCTCGATGG + Intergenic
1081928419 11:46849936-46849958 ATTCCATTAGAATGCCTTATTGG - Intergenic
1085186086 11:74577252-74577274 GTTCCCTTTGTCTGGCCTAATGG + Intronic
1092396101 12:8128252-8128274 TTCCTATTTGACTTCCTTAAAGG - Intronic
1093504939 12:19854271-19854293 TTTTCATTTGACAGCCTTAATGG - Intergenic
1094472836 12:30819267-30819289 GTTCCTTTTCATTGCCATAAAGG - Intergenic
1094874613 12:34626837-34626859 CTTCCATTTTAATGCCTTAATGG + Intergenic
1096834742 12:54342567-54342589 CTTCCATTTACCTGCCCTAATGG - Intronic
1097519337 12:60647770-60647792 GTTCCTTTTGACAACCTTGATGG - Intergenic
1098212151 12:68177891-68177913 GTTTCAATTAAATGCCTTAATGG - Intergenic
1099212737 12:79813190-79813212 GTTCCATTTGATTGATTTATAGG - Intronic
1099334830 12:81342041-81342063 GTTCCATTTTACTACCATGATGG + Intronic
1107307671 13:39039247-39039269 GTTGCAGTTGACTCCCTCAATGG + Exonic
1108880640 13:55110452-55110474 TTTCCATTTTAATGCCTGAATGG - Intergenic
1111795115 13:92909614-92909636 GCTCCCTTTGACTACCTCAAAGG + Intergenic
1113451328 13:110412133-110412155 CTTCCCTTTGACTTGCTTAAAGG - Intronic
1114238633 14:20845543-20845565 GTTCAATTTTATTGCCCTAAAGG - Intergenic
1115075938 14:29390470-29390492 GTTCCATATAATTACCTTAATGG - Intergenic
1118233194 14:63973767-63973789 GTTCCATTTGACTGCCTTAAAGG + Intronic
1123129420 14:105973673-105973695 GTTCCCTGTGAAAGCCTTAAAGG - Intergenic
1125248924 15:37676894-37676916 CTTCCTGTTGACTGCATTAACGG - Intergenic
1127602091 15:60547852-60547874 TTTCCAGTTGACTGCTTTGAAGG + Intronic
1137645812 16:50073048-50073070 ATTCCAATTAACTGGCTTAAAGG - Intronic
1140484159 16:75280818-75280840 GTGTCAGTTGTCTGCCTTAAAGG + Intergenic
1143417329 17:6759350-6759372 GCTCCATCTGACTGCCTTCCAGG - Intronic
1143758695 17:9085371-9085393 CTTCCACTTCACTTCCTTAAAGG - Intronic
1147040018 17:37711316-37711338 GTCCCATTTGGCTGCCTTCCAGG + Intronic
1149336809 17:55643929-55643951 GTTCCATTTTCCTGTCTGAAAGG - Intergenic
1150500325 17:65644310-65644332 GTTCCATTTGAGTGCCAAGATGG + Intronic
1158179246 18:54695200-54695222 ATTCCATGTGACTGACTTCAGGG + Intergenic
1159689078 18:71462697-71462719 GATACAATTAACTGCCTTAATGG - Intergenic
1165954299 19:39492377-39492399 GTTCCATTTGAGTGCCTACATGG - Intronic
925542686 2:4983187-4983209 GTTCCATTTGACTCTCCTGAGGG - Intergenic
926154386 2:10444537-10444559 ATTACATTTGACTGCATAAAAGG + Exonic
926378255 2:12257038-12257060 GTACCTTTTGGATGCCTTAATGG - Intergenic
930104212 2:47627531-47627553 GTTCCATTTAAATGTCTTATAGG - Intergenic
930319348 2:49834717-49834739 GTTCCATTTCACAGCTTTGAAGG - Intergenic
936142469 2:109952173-109952195 GTTATTTTTGACTGACTTAAAGG + Intergenic
936179158 2:110250138-110250160 GTTATTTTTGACTGACTTAAAGG + Intergenic
936202219 2:110419298-110419320 GTTATTTTTGACTGACTTAAAGG - Intronic
940463538 2:153998897-153998919 TTTCCATTTGTCTGTGTTAAGGG - Intronic
941755791 2:169184413-169184435 CTTATATTTGACTCCCTTAAGGG - Intronic
942297340 2:174530689-174530711 GTTCCATTTGTTTTCCTTCAAGG + Intergenic
943432197 2:187817535-187817557 GCACCATTTGACTGGCTAAAAGG + Intergenic
944647046 2:201790323-201790345 TTTCTACTTGACTGCCTAAAAGG - Intergenic
944741855 2:202620252-202620274 GTTCCATTTGGTTGCCTTTAAGG + Intergenic
944864843 2:203850120-203850142 TTTCCACCTGACTGCCTTCAGGG - Intergenic
1168885554 20:1250853-1250875 GTTCCATTTTTTTTCCTTAAAGG + Intronic
1170981228 20:21215214-21215236 ATGCCATTTAACTGCTTTAATGG + Intronic
1177188994 21:17828661-17828683 GTTCCATTTAACAGCATTAAGGG + Intergenic
1178663059 21:34522832-34522854 GTTCCATTTGATGTCCTTAGGGG - Intronic
1179400046 21:41075517-41075539 GCACCATTTGACTGGCTAAAAGG - Intergenic
951916907 3:27810888-27810910 TTTCCATTTGAATGTCTCAAAGG + Intergenic
956173839 3:66454802-66454824 CTTCCATTTAATTGACTTAAGGG + Intronic
957523289 3:81348759-81348781 GTTCCAGTTGACAGCCTTGTAGG - Intergenic
960549822 3:118962679-118962701 GTTCAGTTTCACTGCCTTGATGG - Intronic
960947912 3:122979496-122979518 GTTTCTTTTGGCTGCCTTCAGGG + Intronic
961409836 3:126712142-126712164 GTTCCATTTTTCTGCCTTGGTGG + Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965207998 3:165746492-165746514 GTTCCATTTTACCTCCTAAATGG - Intergenic
966059527 3:175737828-175737850 ATTCCATTTGACTGAGTTATTGG + Intronic
966351496 3:179036891-179036913 GCACCATTTGATTGCCTAAAAGG - Intronic
968074547 3:195809356-195809378 GTTCCTTTTGGCTCCCTGAAGGG - Intronic
968177230 3:196561458-196561480 CGTCCACTTGACTGCCATAATGG + Exonic
974985793 4:69025132-69025154 ATTCTATTTGATTGCCTTGAAGG + Intronic
978411216 4:108428220-108428242 CTTTCATTTGAGTGCCTTAATGG + Intergenic
978411812 4:108434256-108434278 GTTCCATTGAAGTGTCTTAATGG - Intergenic
979469273 4:121074722-121074744 TTTCCTTTTGGCTGCCTAAATGG - Intergenic
982285064 4:153725465-153725487 GACCCATTTCCCTGCCTTAAGGG + Intronic
987581077 5:19793336-19793358 GTTCCATACAACTGCTTTAATGG - Intronic
988357128 5:30192493-30192515 GTTGGTTTTGACAGCCTTAATGG + Intergenic
989531181 5:42510000-42510022 TTTCCACTTGCATGCCTTAAAGG + Intronic
990882214 5:60551976-60551998 GTTACATCAGACTGCCTGAAGGG + Intergenic
991082047 5:62611786-62611808 GGTACATTAGACTGCCTTCATGG + Intronic
998615747 5:143738209-143738231 ATTCCATTTCCCTGCCTCAAAGG - Intergenic
1000372709 5:160552518-160552540 GTTCCATCTGTCTGCCTCACAGG + Intergenic
1002995688 6:2282471-2282493 GTTCAATTTGACTGAGTTATAGG + Intergenic
1003225909 6:4205292-4205314 GTTCTATTTGTCTGCCTTTGAGG + Intergenic
1005267849 6:24131671-24131693 TTTGCATTAGAATGCCTTAAAGG + Intronic
1008120091 6:47604291-47604313 GTTCCATTTTACTAACCTAATGG + Intronic
1009542511 6:64980268-64980290 GTGCTATTTTAATGCCTTAAAGG - Intronic
1010774601 6:79870532-79870554 GTTCCATCTGAGTTCCTTAAAGG + Intergenic
1011708173 6:90024325-90024347 GTTAGATTTGATTGCCTTTAAGG - Intronic
1012108101 6:95191734-95191756 GTTGCATTTCACTTCATTAAAGG - Intergenic
1012161256 6:95888350-95888372 TTAAGATTTGACTGCCTTAATGG - Intergenic
1013483858 6:110576518-110576540 GATCCATTTGATTGGCTTAAAGG + Intergenic
1016222992 6:141698810-141698832 GTACCATTTGATTGACTAAAAGG - Intergenic
1019902363 7:4030924-4030946 GTTCGATGTCTCTGCCTTAATGG - Intronic
1020287511 7:6696047-6696069 GTTACATTTTACTTCCTAAAGGG - Intronic
1027940860 7:84677416-84677438 AATGCTTTTGACTGCCTTAATGG - Intergenic
1030615651 7:111735379-111735401 GTTCCCTTTGACAGCATTAAGGG - Intronic
1030899467 7:115104408-115104430 GTTTCATTTCACTGCCTTAGAGG + Intergenic
1036146983 8:6263232-6263254 GTTGGATTTGACAGCCTTAAAGG - Intergenic
1040817296 8:51521740-51521762 TTTCCTTTTGACTGACTTCAAGG - Intronic
1042672518 8:71280485-71280507 CTTCCCTCTGACTGCCTTACAGG - Intronic
1042739176 8:72024471-72024493 GGTCCATTTGACTTCCTGGATGG - Intronic
1048408730 8:134150007-134150029 CTTCCATTAGACTGCCTTCCTGG + Intergenic
1058215586 9:102229592-102229614 GATCCATTTGACTGCTTTTTTGG - Intergenic
1186966781 X:14795990-14796012 GATCCCTTTGAGTGCCTAAAAGG + Intergenic
1187416156 X:19095015-19095037 GTTCCCATTGACAGCCTGAATGG + Intronic
1199120412 X:144046257-144046279 GTTCCTTTTGAGTGCCATATAGG - Intergenic
1199524089 X:148772080-148772102 GTCACATTTCACTGCCTTTATGG + Intronic
1199753535 X:150843770-150843792 TTTCCATTTCTCTGCCTTAATGG + Intronic
1199823598 X:151475663-151475685 TGTTCATTTGACTGGCTTAAGGG + Intergenic