ID: 1118234832

View in Genome Browser
Species Human (GRCh38)
Location 14:63992821-63992843
Sequence TCTCCTCCAAGGCCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118234832_1118234837 14 Left 1118234832 14:63992821-63992843 CCTCAAGGAGGCCTTGGAGGAGA 0: 1
1: 0
2: 4
3: 31
4: 311
Right 1118234837 14:63992858-63992880 CATTGTGCCTTACCTGCAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118234832 Original CRISPR TCTCCTCCAAGGCCTCCTTG AGG (reversed) Intronic
900178981 1:1303116-1303138 TCTCCCCCAACCCCACCTTGAGG + Intronic
900301266 1:1978640-1978662 TCTCCTCGGAGGCTTCCGTGGGG + Intronic
900385025 1:2406603-2406625 TCTCCTCCAAGGAGGCCCTGGGG + Exonic
900907309 1:5568630-5568652 TCTTCACCAAGGCCTCTTCGTGG - Intergenic
900908296 1:5576203-5576225 TCACCCCCAAGGCTTCCTGGTGG + Intergenic
901162937 1:7193803-7193825 TCTCCTCCGAGTGCTCCTTTAGG + Intronic
901534385 1:9872833-9872855 TCTCCTCCAGCTCCTCCTGGAGG - Intronic
901856638 1:12048662-12048684 TCTCTTTCTAAGCCTCCTTGTGG + Intergenic
902169186 1:14597377-14597399 TATCATCCAAGGCCTCCTGAAGG + Intergenic
902476119 1:16688815-16688837 TTTTCTCCAAAGCCACCTTGAGG + Intergenic
902637074 1:17741574-17741596 TCTCATGCACGACCTCCTTGAGG - Intergenic
902717626 1:18283397-18283419 TCTTCCCCCAGGCCCCCTTGGGG + Intronic
902773932 1:18662158-18662180 TCTCCTCCCAGGCCTGCAGGAGG - Intronic
903213047 1:21829294-21829316 TATCCTCCCATGCCTCCCTGGGG + Intronic
903790401 1:25889069-25889091 TCTCCTCCGATGTCTCCTTTTGG - Intronic
903835496 1:26200907-26200929 TCTCCTCCAGGAACCCCTTGCGG + Exonic
904255480 1:29251841-29251863 TCTTAGCCAAGGCCTCCTTGAGG - Intronic
906658786 1:47567887-47567909 CCTCCTCCCAGTCCTCCCTGGGG - Intergenic
906680690 1:47723760-47723782 TCTCCCCCACGGCCTTCTTGTGG - Intergenic
907338393 1:53715784-53715806 GGTCCTCCACGGCCTCCATGGGG - Intronic
907371793 1:54008444-54008466 ACTGCTCCAAGGCATACTTGTGG - Intronic
908825185 1:68126225-68126247 CCTACTCCTGGGCCTCCTTGCGG + Intronic
909139829 1:71849291-71849313 ACTCCTCAAAGTCATCCTTGAGG - Intronic
909324630 1:74334815-74334837 TCTCTTCCAAAGTCTCCTTCTGG - Intronic
909433696 1:75616588-75616610 CCTCCTCCACAGCCTCCTCGAGG + Intergenic
910845389 1:91600286-91600308 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
911600462 1:99842725-99842747 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
912824210 1:112890785-112890807 TCTTCTCCAATGTCTCCTTTTGG + Intergenic
913074924 1:115334033-115334055 TCTGCTTCAAGGTCTCATTGGGG - Intronic
913604422 1:120452007-120452029 TCTGTTTCAAGGTCTCCTTGAGG + Intergenic
913640529 1:120808435-120808457 TCTGTTTCAAGGTCTCCTTGAGG + Intronic
913641298 1:120814719-120814741 TCTGCTTCGAGGTCTCCTTGAGG + Intronic
914084118 1:144437197-144437219 TCTGCTTCGAGGTCTCCTTGAGG - Intronic
914190139 1:145402468-145402490 TCTGCTTCGAGGTCTCCTTGAGG - Intronic
914244075 1:145872964-145872986 TCCCCTCCAAGGGCCCCTAGAGG + Exonic
914277186 1:146135609-146135631 TCTGCTTCGAGGTCTCCTTGAGG - Intronic
914538233 1:148586557-148586579 TCTGCTTCGAGGTCTCCTTGAGG - Intronic
914587155 1:149073020-149073042 TCTGCTTCGAGGTCTCCTTGAGG - Intronic
914587932 1:149079309-149079331 TCTGTTTCAAGGTCTCCTTGAGG - Intronic
914984839 1:152447644-152447666 TCTGCTCAAACGCCTCCTTTTGG - Intergenic
914986958 1:152468163-152468185 TTTTCTCCTAGGCCTCCTTTAGG + Intergenic
915834623 1:159166062-159166084 TCTCCTCCATGTGCTCTTTGAGG - Intergenic
916072667 1:161179793-161179815 GCTCCTCTAAGGCCTCTTTTTGG + Intergenic
916719450 1:167473328-167473350 TCTCCTCCAAGGCCCATCTGAGG + Intronic
917211428 1:172635642-172635664 TCTCCTGGAAACCCTCCTTGAGG - Intergenic
917536323 1:175877111-175877133 TCTCCACTCAGGCCTCCTTGAGG - Intergenic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
919985012 1:202667348-202667370 TCTCCACCAACGCCTGCCTGTGG + Intronic
920435400 1:205943737-205943759 CCTCCTCCAGGGCCGCCTTGGGG - Intergenic
922155620 1:223038128-223038150 CCTCCTCCCAGGCCTCCAGGAGG + Intergenic
922694526 1:227722091-227722113 TCTTGTCCAAGACCTCCTTCTGG + Intergenic
923958716 1:239052766-239052788 TCTTCTCCAATGTCTCCTTTTGG + Intergenic
1065176332 10:23079767-23079789 TCTCCCCCACTGCCTCCTTCAGG - Intergenic
1067058242 10:43064685-43064707 TCTCCCCCAGGGCCTCCAGGTGG + Intergenic
1067531143 10:47074503-47074525 TCTTCACCATGGCCACCTTGTGG + Intergenic
1067905878 10:50290436-50290458 TCACCTCCATGCCTTCCTTGAGG + Intergenic
1069079562 10:64073663-64073685 TCTTCTACAAGACCTCCCTGTGG - Intergenic
1070855469 10:79605083-79605105 TCTTCTCCAAGGCTACCTAGGGG - Intergenic
1072313347 10:94178370-94178392 GCTTCTACAAGGCCTCCATGTGG + Intronic
1073243604 10:102074199-102074221 TCTCATCCTGGGCCTCCTGGAGG + Intergenic
1073243608 10:102074211-102074233 GCTCCTCCAGGGCCTCCAGGAGG - Intergenic
1075010578 10:118866265-118866287 TCTGCACAAAGGCCTCCCTGGGG - Intergenic
1075629810 10:123994251-123994273 CCACTTCCAAGGCCTCCCTGGGG + Intergenic
1075843075 10:125521098-125521120 TTGACTCCAAGGCTTCCTTGAGG - Intergenic
1077008840 11:371137-371159 CCTCTTCCAAGGACCCCTTGAGG + Intronic
1077036699 11:498858-498880 TGGCCTCCAAGGCCTCGCTGCGG - Exonic
1077288510 11:1778197-1778219 TCTGCTGCAAGGACTTCTTGGGG - Intergenic
1077539699 11:3140740-3140762 TCCCATCCTAGTCCTCCTTGGGG + Intronic
1079374338 11:19878792-19878814 TTTCCTCCAAGGCTTAGTTGGGG - Intronic
1083620748 11:64048240-64048262 GCTACTCAAAGGCCTCATTGTGG + Intronic
1084672448 11:70615298-70615320 GCTCGTCCAAGGCCACCTAGAGG - Intronic
1085282502 11:75340428-75340450 CCTCCTCCAAGGCCCCTCTGGGG + Intronic
1086931862 11:92702330-92702352 TCCCCTTCAAGGTCTCATTGAGG - Intronic
1087059271 11:93962450-93962472 TCTTCCCCAAAGCCCCCTTGCGG + Intergenic
1087644207 11:100788314-100788336 TCTCCACAATGTCCTCCTTGTGG - Intronic
1087811105 11:102609949-102609971 TCTCCTCCCAGGCCTTCTCCAGG + Exonic
1088655201 11:111992408-111992430 TCTGCTGCAAGGCATCCTAGGGG - Intronic
1088783293 11:113156889-113156911 TCTACTCCAAGCCTTCCATGTGG - Intronic
1089005193 11:115084957-115084979 TCTCCCCCAAGGCCTCCTTCTGG + Intergenic
1089286125 11:117409285-117409307 TCTCTTCCAGGGCCTCCTTGAGG + Intronic
1089519868 11:119056655-119056677 TCTCCTCCTCGGCATCCCTGCGG + Intronic
1090940117 11:131380047-131380069 CCTGCTCCATGGCCTCTTTGGGG + Intronic
1092253190 12:6912835-6912857 TCTGCACCAGGGCCTCCTGGCGG - Exonic
1093663042 12:21779416-21779438 CCTGCTCCAAGGCATTCTTGGGG + Intergenic
1094620885 12:32079132-32079154 GATCCGCCAAGGCCTCCTTGAGG + Intergenic
1097272565 12:57786177-57786199 CCTCCTTCTGGGCCTCCTTGTGG - Exonic
1098090565 12:66896335-66896357 TCTCCTCCTAGACTTCCCTGTGG - Intergenic
1099769194 12:87030142-87030164 TTTCCTCCTAGACCTCCTGGCGG + Intergenic
1100064431 12:90624447-90624469 TCTCCTGCAATACCTCCTGGAGG - Intergenic
1102132498 12:110542968-110542990 CCTCCTTCCAGGCCTCCCTGGGG + Intronic
1102255002 12:111410099-111410121 CTTCCTCCCAGGCCTCCCTGGGG - Intronic
1102462728 12:113109966-113109988 CCTGCTCCAGGGCCACCTTGGGG + Intronic
1103209213 12:119154457-119154479 GCTCTCCCTAGGCCTCCTTGGGG + Intronic
1103641374 12:122355240-122355262 TCTCCTTCAGGGCCTCCTGGAGG + Exonic
1105703843 13:22956564-22956586 TCTCCTTACAGGCCTCCTAGAGG + Intergenic
1105856795 13:24381645-24381667 TCTCCTTACAGGCCTCCTAGAGG + Intergenic
1106083800 13:26522610-26522632 TATCCTCCATGGCTTTCTTGTGG - Intergenic
1108378633 13:49836664-49836686 TCTGCTCCACGGCCTCCTGCAGG + Intergenic
1108870449 13:54977809-54977831 TCTCCTCAAAGACTTCATTGAGG + Intergenic
1109604225 13:64671274-64671296 TCTCCTCCAAAGCCTTCGTGGGG + Intergenic
1110871727 13:80460244-80460266 TCCCCTCTCATGCCTCCTTGTGG + Intergenic
1113388253 13:109870762-109870784 AGTCCTCCACGGCCTCCATGTGG - Intergenic
1113784096 13:112993386-112993408 TCTCCTAAAAGCCCTCCTGGCGG - Intronic
1113878663 13:113609924-113609946 GCCCCTCCAAGGCCTCCTCTTGG + Intronic
1114260332 14:21031951-21031973 TCTCATCAAAGCGCTCCTTGTGG - Exonic
1114399893 14:22400268-22400290 TGTCCTCCAAGGCTTGCATGGGG - Intergenic
1114408922 14:22482406-22482428 TGTCCTGCAAGCTCTCCTTGAGG + Intergenic
1114671824 14:24415568-24415590 CCTCCTCCAGGGCCTGCTGGGGG + Exonic
1115466540 14:33720731-33720753 TTTGCTCCAAGGGCTCATTGGGG + Intronic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118357595 14:65027484-65027506 CCTCCTCCAAAGCCACCTTCTGG - Exonic
1118842589 14:69524292-69524314 TCTGCTGCAAGGACTCCGTGAGG - Exonic
1119435996 14:74598230-74598252 GCTCCTCCTTGGCTTCCTTGAGG - Intronic
1119449397 14:74695575-74695597 CCTGCTCCAAGGCCTCTCTGAGG + Intronic
1120523381 14:85549871-85549893 TCTCCTAAAGGGCCTCCCTGTGG + Intronic
1120833006 14:89014656-89014678 TCTCGTCCACATCCTCCTTGGGG + Intergenic
1121296449 14:92829458-92829480 ACTCCTCAAAGCCATCCTTGAGG - Intronic
1121530602 14:94650003-94650025 TCTCTGCCATGGGCTCCTTGAGG - Intergenic
1122298115 14:100716888-100716910 TCTCCTCCAGGGCCTCCCTCAGG - Intergenic
1122793200 14:104193117-104193139 TCTCCCACAAGGCCTCCCTGGGG - Intergenic
1122845560 14:104495892-104495914 TCTCCTTACAGGCCTCCTAGAGG + Intronic
1124252058 15:28113360-28113382 TCTACACCAAGGCCTGTTTGGGG + Intronic
1128129232 15:65214747-65214769 TCTCTTCCCAGGACTCCTTTGGG + Intergenic
1129269250 15:74410869-74410891 TCTGCTCCACGTTCTCCTTGTGG + Exonic
1129457910 15:75685443-75685465 TCCCCTCGAGGGCGTCCTTGTGG - Exonic
1129476213 15:75786035-75786057 CCTTCTCCATAGCCTCCTTGAGG - Intergenic
1129767370 15:78178872-78178894 TCTCCTCCAAGCCCCCACTGGGG + Intronic
1129972836 15:79795455-79795477 TATCCTCCAAGTTCTCTTTGAGG + Intergenic
1130211532 15:81927269-81927291 TCTTCTCCCAGCCATCCTTGTGG - Intergenic
1130403591 15:83579279-83579301 TTTCCTCCAAGGCTTCCTGTGGG + Intronic
1131426521 15:92349747-92349769 TCACCACCAAGTCCTCCCTGTGG + Intergenic
1131771274 15:95740561-95740583 TCTCCTCCAAGGGCTTGTTCTGG + Intergenic
1131880221 15:96854301-96854323 TCTCCTCCTAGGCCACATTAGGG + Intergenic
1133109274 16:3536115-3536137 TCTCCTCCGAGTCCTCCTATAGG - Exonic
1133396968 16:5455500-5455522 TATTCTCCAAGGCCTCCTTGGGG - Intergenic
1136028450 16:27485266-27485288 GCTCCTCCAAAGCTGCCTTGTGG + Intronic
1137395150 16:48111826-48111848 TCTCCTCCATTAACTCCTTGTGG + Exonic
1137694391 16:50451688-50451710 TCTCATTCAAGGCCTCTGTGGGG + Intergenic
1139504050 16:67390281-67390303 TCTCATCGAAGCGCTCCTTGTGG + Exonic
1140857758 16:78992771-78992793 TGTCCTCTGAGCCCTCCTTGAGG + Intronic
1141556262 16:84838648-84838670 TCTCCTCCTTGTCCTCCCTGGGG - Exonic
1141826540 16:86484624-86484646 TCACCTCCAAGTCCTCTTTCTGG - Intergenic
1141939877 16:87268300-87268322 TCTTCTCCAATGTCTCCTTTTGG - Intronic
1141959147 16:87392699-87392721 CCTCCTCCCAGGCCTCCGAGAGG - Intronic
1142388859 16:89784953-89784975 TCTCCACACAGGCCTCCTTTGGG - Exonic
1143407919 17:6690365-6690387 ACTCCTCCAAGGCCTCTTCCTGG + Intronic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1144742208 17:17590317-17590339 TCTCCTCCTGTGCCTCCTGGAGG + Intronic
1146770716 17:35566632-35566654 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
1147286769 17:39408619-39408641 TCTCATTCAAGGCCACCTGGAGG - Exonic
1147374380 17:40015379-40015401 TTTCCTCCCAGGCCTCCATGGGG + Intronic
1148240609 17:45997355-45997377 TTTCTTCCAAGGCCTCTCTGTGG + Intronic
1149427956 17:56573155-56573177 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
1149993054 17:61393410-61393432 CATTCTCCAAGGCCTCCCTGGGG - Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150343429 17:64386843-64386865 TCTCCTCCCAGTCCTCCTACTGG - Intronic
1151209426 17:72533282-72533304 ACTCGTCCAATGCCTCCTTCAGG - Intergenic
1151276173 17:73036046-73036068 TCTCCTCCAAATCCTCCAAGAGG + Intronic
1151960287 17:77402233-77402255 GCTCCCCCAAGGCGTCCCTGCGG + Exonic
1152695877 17:81794848-81794870 GCTCCTCCCAGGCCTGCCTGTGG + Intergenic
1153370202 18:4306716-4306738 TCTCTTCTAAAGCCTCTTTGAGG + Intronic
1153741070 18:8128425-8128447 TCTCTTTCAAGGGCTGCTTGAGG + Intronic
1153823875 18:8856855-8856877 TCTTTTCCAAGGCCTCCGTGGGG + Intergenic
1153894701 18:9547905-9547927 TCTGCTCCACAGCCTCCTGGTGG + Exonic
1153974232 18:10253272-10253294 TCACATCCAGGGACTCCTTGTGG - Intergenic
1154018437 18:10641092-10641114 CATCCTCAAAGGCCTACTTGAGG + Intergenic
1154186436 18:12188483-12188505 CATCCTCAAAGGCCTACTTGAGG - Intergenic
1160732741 19:648653-648675 TCTCCTCCCAGCCCACCTTCAGG + Intronic
1161216564 19:3097583-3097605 TCTCATCCACTGCCTCCCTGGGG + Intronic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1165311089 19:35030025-35030047 CCTCCTCTAATGCCTACTTGGGG + Intergenic
1166396020 19:42441711-42441733 TCTCCCCAAAGGCCACTTTGAGG - Intronic
1167687489 19:50965738-50965760 AGTCATCCAAGGTCTCCTTGGGG + Intronic
1167693002 19:50998584-50998606 ACTTCTCCAAAGCCTCTTTGAGG + Intronic
1167993839 19:53386348-53386370 TCTTCTCCAATGTCTCCTTTTGG - Intronic
1168006730 19:53495997-53496019 TCTTCTCCAATGTCTCCTTTTGG - Exonic
1202710138 1_KI270714v1_random:14668-14690 TTTTCTCCAAAGCCACCTTGAGG + Intergenic
927067603 2:19489583-19489605 TCTCGTCCAAAGCCTCCCAGGGG - Intergenic
927444767 2:23149431-23149453 TCTCCTTCATGGCCTCCCTGGGG + Intergenic
928607475 2:32956596-32956618 ACTCCTCCAAGTCATCCATGAGG + Intronic
928936936 2:36688544-36688566 TGCCCTCCATGGGCTCCTTGCGG + Intergenic
931050861 2:58412872-58412894 ACTCCTCCAAGTCATCCATGAGG - Intergenic
931113860 2:59143465-59143487 TCTCACCCAAGGCCACCATGTGG + Intergenic
931113964 2:59144557-59144579 TCTCACCCAAGGCCACCATGTGG - Intergenic
932252147 2:70253873-70253895 TCTTCTCCAATGTCTCCTTTTGG + Intergenic
932451045 2:71811054-71811076 TCCCCTCCTAGGCCTCTCTGAGG - Intergenic
933986664 2:87597266-87597288 TCTCCCCGAAGGCCTGATTGTGG + Intergenic
935103422 2:100017854-100017876 TCTGCTCCACTGCCTCCCTGGGG + Intronic
936161291 2:110085926-110085948 TCTCCATCAGGGCCTCCCTGGGG + Intronic
936183372 2:110285428-110285450 TCTCCATCAGGGCCTCCCTGGGG - Intergenic
936307179 2:111353543-111353565 TCTCCCCGAAGGCCTGATTGTGG - Intergenic
937428443 2:121818414-121818436 TCTCCTCCCAGGCATCCCTGTGG - Intergenic
937448332 2:121977194-121977216 TCTCCTCCAAGGATTACTTTGGG - Intergenic
939234026 2:139468113-139468135 TCTCTACCAAGGCTTCCTTATGG - Intergenic
939800279 2:146699560-146699582 GCTCCTCCAATGCCTCCTGAAGG + Intergenic
940714422 2:157203708-157203730 TCTCCTCCAAGACCTCATGAAGG + Intergenic
940785066 2:157972103-157972125 TCACCTCACAGGCATCCTTGAGG - Intronic
944699298 2:202231812-202231834 TCTTCTCCAATGGCTCCTTTTGG - Intronic
945195232 2:207231349-207231371 TTCTCCCCAAGGCCTCCTTGGGG - Intergenic
945360079 2:208886511-208886533 TTTCCTCCTAGGCCTCCAGGAGG - Intergenic
946047678 2:216834758-216834780 TCTCCTCTATGGCTCCCTTGTGG + Intergenic
946371834 2:219285822-219285844 TCCCCTCCTAGGCCTCCCTCTGG - Exonic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
948772349 2:240258165-240258187 TCTCCTCACAGGCCTCCTCCAGG + Intergenic
948772900 2:240260690-240260712 TGTTCTCCAAAGCTTCCTTGGGG + Intergenic
1168841706 20:913962-913984 TCTCCCCCAACACCTCCCTGAGG - Intronic
1170829187 20:19824941-19824963 TCTTCTCCAAGGCCTGCTCGAGG + Intergenic
1171379664 20:24724817-24724839 TCTCCTCAGTGGCCTCCTTCCGG - Intergenic
1172482640 20:35279941-35279963 TCTTCTTCAAGTCCCCCTTGTGG - Exonic
1172596978 20:36156270-36156292 TCTCCTCCAGGACTGCCTTGAGG - Intronic
1174146038 20:48453335-48453357 TCTCCTCCACCTCCTCCTTCAGG + Intergenic
1175608064 20:60327795-60327817 TCTCCTTCAGGGCCTCCAAGAGG - Intergenic
1175672489 20:60917412-60917434 TCTCCTCCAAGACAGCCTGGGGG - Intergenic
1175861808 20:62154477-62154499 TCTCCTCCAGAGCCTCCCTCAGG + Intronic
1176346592 21:5753996-5754018 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176353406 21:5874580-5874602 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176498235 21:7570459-7570481 TCTCCTCTTTGGCCTCCTAGAGG - Intergenic
1176540913 21:8152066-8152088 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176559864 21:8335111-8335133 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1178095986 21:29216521-29216543 TCTCCTCACAGGGCTCCATGTGG + Intronic
1178365096 21:31983591-31983613 TCACCTCATAGGACTCCTTGGGG - Exonic
1178483783 21:33004151-33004173 CCTCTGCCAAGGCCTCCTTATGG + Intergenic
1179596134 21:42444294-42444316 TCACTTCCTAGGCCTCCCTGAGG + Intronic
1179835062 21:44025899-44025921 TCTCCTCCAGGTCCTTCCTGTGG - Intronic
1180782412 22:18528667-18528689 TCCTCACCAAGTCCTCCTTGTGG - Exonic
1180784535 22:18539464-18539486 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1180967874 22:19799958-19799980 TCCCCTCCCAGGCCTCCTCCTGG + Intronic
1181125963 22:20702694-20702716 TCCTCACCAAGTCCTCCTTGTGG - Intergenic
1181128112 22:20713517-20713539 GCTCCTCCTTGGCCTCCTTGGGG - Intronic
1181241438 22:21478821-21478843 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181728533 22:24828023-24828045 TCTCCTGAAAGGCCCCCTTTGGG + Intronic
1181830546 22:25557060-25557082 TCTCCTTCAAGGCCTTGTTTTGG - Intergenic
1183408761 22:37642889-37642911 TCATCTCCAAGGCCTTCCTGTGG - Exonic
1183969725 22:41468031-41468053 TCTACTCAAAGCCCTCTTTGTGG + Intronic
1185135120 22:49065914-49065936 CGTCCTCCATGTCCTCCTTGTGG - Intergenic
1185181072 22:49363697-49363719 TCTTCTCCAAGGACCCCGTGGGG - Intergenic
1203245852 22_KI270733v1_random:68485-68507 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
950448584 3:13052985-13053007 TCTTCTCCAATGTCTCCTTTTGG + Intronic
950705329 3:14776011-14776033 TCTCCTCCCACCCCTCCCTGTGG + Intergenic
952854267 3:37754963-37754985 GCTCCTCCAGGTCATCCTTGGGG - Intronic
952966567 3:38624586-38624608 ATTCCTCCATGGCCACCTTGGGG - Intronic
953020541 3:39110295-39110317 TCTTCTCCCAGGCCTCCAGGGGG - Intronic
953696854 3:45166595-45166617 TCTGCTCCAAGGCCTCACTGGGG + Intergenic
953906197 3:46869369-46869391 TCTCCTCCAAGGCCGGCTCATGG - Intronic
954600414 3:51863301-51863323 TCTCCTCCAGGGCCACTGTGTGG + Exonic
956841071 3:73140873-73140895 TCCCATGCGAGGCCTCCTTGTGG + Intergenic
957026567 3:75188951-75188973 TATCCAACAAGGTCTCCTTGAGG - Intergenic
957053764 3:75429204-75429226 GCTCGTCCAAAGCCTCCATGTGG + Intergenic
959833363 3:110890652-110890674 TTACCTCCAAAGCATCCTTGAGG + Intronic
960902084 3:122563765-122563787 ACTTCTCCAAGGCCTCCAAGGGG - Intronic
961327448 3:126117811-126117833 TCTCCGCCCAGGCCTCCCCGGGG + Intronic
962445521 3:135460141-135460163 TATCCTCCAGGGCCACTTTGAGG + Intergenic
963171707 3:142257742-142257764 TCCCCACCTGGGCCTCCTTGAGG + Intergenic
964048457 3:152360565-152360587 TCTGCTCCCAGGCCTGATTGGGG + Intronic
967205906 3:187121163-187121185 TCTTCTCCAATGCCTCCTTTTGG + Exonic
968452016 4:680327-680349 TGCCCGACAAGGCCTCCTTGGGG + Intronic
968486102 4:863150-863172 ACTCCTCAAAGTCATCCTTGAGG - Intronic
968539585 4:1157821-1157843 ACTCCTCAAAGTCATCCTTGAGG + Intergenic
968570546 4:1338225-1338247 TCTCCACCGAGGCCTCAGTGGGG + Intronic
969267482 4:6074031-6074053 TCTCCTCCAACCTCTCCTTTGGG + Intronic
969430069 4:7148751-7148773 GCACCTCCCAGCCCTCCTTGCGG - Intergenic
969649374 4:8455140-8455162 TCTTCTCCAAGGCCTCCCAAAGG + Intronic
972330004 4:38055859-38055881 CCTCCTCCAGGGCCTCCCTCTGG - Intronic
972574912 4:40342868-40342890 TCTCCTCCCATGCCTCCTTCAGG - Intronic
972983054 4:44728527-44728549 CCTCCTGAAAGACCTCCTTGAGG - Intergenic
976839010 4:89409012-89409034 TCTCCTCCAAGGTATCACTGTGG + Intergenic
977388608 4:96378695-96378717 TCTCCTGCAAGACCTGCCTGAGG + Intergenic
977445795 4:97130426-97130448 TAGACTCCAAGGCCTACTTGAGG + Intergenic
978725523 4:111964951-111964973 TTTCCTCCATTGCCTCCTTTGGG - Intergenic
980397915 4:132239423-132239445 TTTCCTCCAAGGCCTTCTCATGG - Intergenic
980707997 4:136524345-136524367 CCTCTGCCAAGGCCACCTTGTGG + Intergenic
985606547 5:861180-861202 TCTCCTCCAAGACCTCAGTCTGG - Intronic
987255231 5:16143568-16143590 TCTCCTCCAAGGGCACATTCCGG - Intronic
988161292 5:27520853-27520875 TCTCCCCCAGGGCCTCCAGGAGG + Intergenic
988982840 5:36588621-36588643 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
989523305 5:42425007-42425029 TCCCTTCCAAGGTCTCCTGGCGG - Intronic
990610895 5:57455904-57455926 TCTCCTCTGAGACCTCCCTGAGG - Intergenic
991523661 5:67530773-67530795 TCTGCTCCAAGGCCCCTTTCTGG + Intergenic
992257079 5:74931777-74931799 TCTTCTCCAATGTCTCCTTTTGG - Intergenic
1000946622 5:167429945-167429967 TCTTCTCCCAGGTTTCCTTGTGG - Intronic
1001227253 5:169955465-169955487 TCTCCTCCAAGGCCAGTTTGCGG + Intronic
1002092798 5:176814701-176814723 TCTCCTCCAGTGCCTCCCTCAGG + Intronic
1002192963 5:177488328-177488350 TCCCTCCCAAGGCCTCCTGGTGG - Intronic
1004937694 6:20524290-20524312 ATTTCTCGAAGGCCTCCTTGGGG - Intergenic
1006110340 6:31740562-31740584 CCTCCTCCTCGGCCTCCCTGGGG - Exonic
1006162391 6:32046214-32046236 TCTGCTCTACGGGCTCCTTGGGG - Intronic
1007695786 6:43733728-43733750 TCTCCTCCCTGCCATCCTTGGGG + Intergenic
1008007319 6:46424642-46424664 TCTGCTCCATTGGCTCCTTGAGG - Intronic
1008439873 6:51520706-51520728 TCTCTGCCAAGACCTCCTTATGG - Intergenic
1008807496 6:55449417-55449439 TCTCCTCCAAGTGGTCATTGAGG - Intronic
1010212488 6:73373126-73373148 TCTTCTCCAATGTCTCCTTTTGG + Intronic
1010657469 6:78528415-78528437 TCTCCACCATGGCATCTTTGTGG - Intergenic
1012215804 6:96582065-96582087 TCTCCTCAAAGGCTTGTTTGAGG - Intronic
1012562220 6:100597155-100597177 TCTCCCCCCAGGCCGCCTTCTGG + Intronic
1013347263 6:109273432-109273454 ACTCCTCAAAGTCCTCCATGAGG + Intergenic
1017567300 6:155701353-155701375 TCTCCTCCAATTCCTCAGTGTGG - Intergenic
1018767796 6:166947406-166947428 TCTCCTCCCTGGCCTCTTTGGGG - Intronic
1019213997 6:170429606-170429628 TGTCATCCCAGGCCTCCTCGCGG + Intergenic
1019780839 7:2938750-2938772 TGTCCTCCAGGGCCTCCTTGCGG + Exonic
1020265070 7:6555117-6555139 TCTCCTTCTTGGCCTCCTCGGGG + Intergenic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1023188353 7:37554092-37554114 TCTCCTCCAAAGCCAACTTGAGG - Intergenic
1024974428 7:55100278-55100300 ACTTCACAAAGGCCTCCTTGGGG + Intronic
1026805948 7:73429699-73429721 TGTGCACCTAGGCCTCCTTGGGG + Intergenic
1028851722 7:95545160-95545182 TCTCCTACAGTGCCTCCTTTAGG - Intergenic
1030193476 7:106831881-106831903 ACTCCTTCAAAACCTCCTTGTGG + Intergenic
1030601701 7:111600694-111600716 TCTCCTCCACGGCCTACTTTAGG + Intergenic
1033254191 7:139785377-139785399 TCTCCTCCCAAACCTCCTTCTGG + Intronic
1033532878 7:142283358-142283380 TTTCCTCCAAGGCCAGCTTCTGG - Intergenic
1033555920 7:142488544-142488566 TGTCCTCCGAGGTCTCCTTTCGG + Intergenic
1033923335 7:146424059-146424081 TTTCCCCCAAGTTCTCCTTGAGG - Intronic
1034184068 7:149160974-149160996 CCTCCTGACAGGCCTCCTTGGGG - Intronic
1034429979 7:151036371-151036393 ACGCCTCCATGGCCTCCTTGAGG - Intronic
1035378009 7:158419655-158419677 TCTTCTCCAAGTCCTCCATCAGG - Intronic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1037505691 8:19527267-19527289 TCTCCTCCAAGACCTAGCTGAGG - Intronic
1037526022 8:19724988-19725010 TCTCCTCCCTGGCTTCATTGTGG + Intronic
1038896060 8:31783565-31783587 TCTACACCAAGGCCCCTTTGAGG - Intronic
1039548352 8:38425844-38425866 TCTCCAACAACGCCTCCTTCAGG + Intronic
1039878147 8:41605090-41605112 TCTCCATCAAGGTCTCCTTATGG - Intronic
1042765498 8:72316693-72316715 TCTCCTCCAATGCCTCCCATTGG - Intergenic
1042778943 8:72468392-72468414 TCTCCTCCAGGGCCTCCATTTGG - Intergenic
1043376440 8:79654930-79654952 TCTCCTCCAAAGCCTTCTGAAGG - Exonic
1045350824 8:101337612-101337634 TCTTCTCCAATGCCTCCTTTTGG - Intergenic
1050820365 9:9871739-9871761 TCTCCTCCCAGGCCCCTTTCCGG - Intronic
1053132649 9:35626225-35626247 ACTCCTCCAAGTCATCCATGAGG - Intronic
1053346062 9:37378922-37378944 TCTCCCCCAAGGCTTCACTGAGG - Intergenic
1054919983 9:70533216-70533238 ACACCTCCAAGGCCTCATTCTGG - Exonic
1055412820 9:76049653-76049675 TCTGATCCAAGGGCTCCTTGGGG - Intronic
1056796247 9:89660740-89660762 TATGCCCCTAGGCCTCCTTGAGG + Intergenic
1057422750 9:94925701-94925723 TCTCCTCACAGGACTCCATGTGG - Intronic
1058634357 9:107022034-107022056 TCTACTCCATGGCCTGCTAGAGG + Intergenic
1060394145 9:123303856-123303878 TCTCCTCCAATAGCCCCTTGTGG + Intergenic
1061137355 9:128742544-128742566 TCTTGCCCACGGCCTCCTTGTGG + Exonic
1062402255 9:136377848-136377870 TGTGCTCCAGGGCCTTCTTGTGG + Exonic
1203462189 Un_GL000220v1:51556-51578 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1187587326 X:20677858-20677880 TCTCCTCTAAAGCCTTCATGGGG + Intergenic
1188217929 X:27501871-27501893 GCTCTGCCAAGGCCTCCTTATGG - Intergenic
1189362535 X:40363809-40363831 TTACCTCCACTGCCTCCTTGGGG + Intergenic
1190404980 X:50078046-50078068 TCTCCTCCAAGGACTGAGTGAGG + Intronic
1192745679 X:73936113-73936135 TAGCCTCCATGACCTCCTTGTGG - Intergenic
1196832460 X:119786702-119786724 TCTTCTCCAATGTCTCCTTTTGG + Exonic
1197056054 X:122120615-122120637 ACTCATCCAAGGTCTGCTTGGGG - Intergenic
1197748320 X:129947891-129947913 TGGCCTCCAAGGAATCCTTGAGG + Intergenic
1197925176 X:131638549-131638571 TCACCACCAAGGCCTTCTTTGGG + Intergenic
1199510213 X:148613258-148613280 TTCCCACCAAGGCCTCCCTGTGG - Intronic
1199619033 X:149682962-149682984 TCTCATCCCAGAACTCCTTGGGG - Intergenic