ID: 1118234832

View in Genome Browser
Species Human (GRCh38)
Location 14:63992821-63992843
Sequence TCTCCTCCAAGGCCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118234832_1118234837 14 Left 1118234832 14:63992821-63992843 CCTCAAGGAGGCCTTGGAGGAGA 0: 1
1: 0
2: 4
3: 31
4: 311
Right 1118234837 14:63992858-63992880 CATTGTGCCTTACCTGCAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118234832 Original CRISPR TCTCCTCCAAGGCCTCCTTG AGG (reversed) Intronic