ID: 1118236376

View in Genome Browser
Species Human (GRCh38)
Location 14:64008790-64008812
Sequence AACCACATGCGGAAACAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118236376_1118236378 -6 Left 1118236376 14:64008790-64008812 CCGCTTTGTTTCCGCATGTGGTT 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1118236378 14:64008807-64008829 GTGGTTCTGACACCACCTGACGG 0: 1
1: 0
2: 1
3: 7
4: 103
1118236376_1118236382 14 Left 1118236376 14:64008790-64008812 CCGCTTTGTTTCCGCATGTGGTT 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1118236382 14:64008827-64008849 CGGCACCATCCTGTGTGGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 256
1118236376_1118236384 16 Left 1118236376 14:64008790-64008812 CCGCTTTGTTTCCGCATGTGGTT 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1118236384 14:64008829-64008851 GCACCATCCTGTGTGGCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 203
1118236376_1118236381 9 Left 1118236376 14:64008790-64008812 CCGCTTTGTTTCCGCATGTGGTT 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1118236381 14:64008822-64008844 CCTGACGGCACCATCCTGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 152
1118236376_1118236383 15 Left 1118236376 14:64008790-64008812 CCGCTTTGTTTCCGCATGTGGTT 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1118236383 14:64008828-64008850 GGCACCATCCTGTGTGGCTTGGG 0: 1
1: 0
2: 3
3: 24
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118236376 Original CRISPR AACCACATGCGGAAACAAAG CGG (reversed) Intronic
900777348 1:4594812-4594834 AAGCATATGCGGAAACACTGTGG + Intergenic
903509651 1:23865639-23865661 AACCACATGAGCAAAGGAAGTGG + Intronic
904443038 1:30544240-30544262 AAACACATGCATAAACAAACAGG - Intergenic
911225696 1:95303281-95303303 CACCATATGGGGAAAAAAAGTGG - Intergenic
912663754 1:111560687-111560709 AACCAGCTCCGGCAACAAAGTGG - Intronic
915313540 1:155016236-155016258 ATCCACATGCGGAAGCACACGGG + Exonic
915924162 1:160003693-160003715 AACCACATGCCACAACAATGAGG + Intergenic
920298638 1:204975200-204975222 ATCCCCATGCGGCCACAAAGTGG - Intronic
920918336 1:210276746-210276768 AACCATATGAAGATACAAAGAGG - Intergenic
924835274 1:247640710-247640732 AACCACAGGAGAAACCAAAGAGG - Intergenic
1064517083 10:16162390-16162412 ATCCACATGGAGAAATAAAGAGG + Intergenic
1064967684 10:21031330-21031352 AATCCCATGCTCAAACAAAGAGG + Intronic
1065030954 10:21585249-21585271 AACCTCTTTTGGAAACAAAGTGG + Intronic
1067992035 10:51225212-51225234 TACCACATGAGGACACAGAGAGG - Intronic
1078847116 11:15128358-15128380 AATCATATGGGGATACAAAGTGG + Intronic
1086385153 11:86299571-86299593 AACCATATACTGAAAAAAAGTGG - Intergenic
1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG + Intronic
1087883775 11:103452016-103452038 ATTCACATGAGGAAAAAAAGGGG - Intronic
1089994765 11:122895953-122895975 AAACACATGTGGAGACAAATAGG - Intronic
1092335024 12:7624778-7624800 AAGCAGATGCTAAAACAAAGTGG + Intergenic
1093032846 12:14304740-14304762 AAGCACAAGCAGATACAAAGGGG - Intergenic
1096776327 12:53966552-53966574 ATCCAGAGGCGGAAAGAAAGGGG + Intergenic
1098080136 12:66775241-66775263 AAAAACAAGCTGAAACAAAGGGG + Intronic
1098693723 12:73524195-73524217 ATCCACCTGAGGAAATAAAGAGG + Intergenic
1100571997 12:95851776-95851798 AACCACATTGAGGAACAAAGTGG - Intergenic
1102580482 12:113883350-113883372 ACCCACATGTGGCATCAAAGAGG - Intronic
1106902724 13:34371189-34371211 AAACACATGAGGAAACAGAAAGG - Intergenic
1107147421 13:37073492-37073514 AACCACATTCAGAAACAGTGAGG + Intergenic
1108487519 13:50941925-50941947 AACCATAGGCTGAAACAGAGAGG + Intronic
1109572012 13:64205156-64205178 AAGCACATGTGAAAATAAAGTGG + Intergenic
1111590452 13:90341118-90341140 AACCACGGGGGAAAACAAAGGGG + Intergenic
1116299829 14:43164452-43164474 AAAAACATGAGGAAGCAAAGGGG - Intergenic
1117360722 14:54971031-54971053 AACCACATGCAGAATGAAACTGG + Intronic
1118180896 14:63492006-63492028 AAACACATCAAGAAACAAAGGGG + Intronic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1118495865 14:66307702-66307724 CACCACATGAGGACACAGAGAGG - Intergenic
1121118421 14:91359706-91359728 AACTTCCTGCAGAAACAAAGGGG + Exonic
1121222201 14:92294553-92294575 CACCACTTGTGGATACAAAGTGG + Intergenic
1124586307 15:31012207-31012229 ATCCACATGAAGAAATAAAGAGG - Intronic
1126409713 15:48360547-48360569 AACCACATGTGGAAAAAAATAGG - Intergenic
1128985438 15:72217179-72217201 AACCACAGCCAGCAACAAAGGGG + Intronic
1130125110 15:81087288-81087310 AACAACATGCCAAAACAAAAAGG + Intronic
1130512364 15:84600474-84600496 TACCACGTGCGAAAACAAAGGGG + Intergenic
1131371657 15:91886976-91886998 AGACACAGGCAGAAACAAAGAGG - Intronic
1135066460 16:19314357-19314379 TACCACATCCGGAATCAAAAAGG + Intronic
1137418344 16:48307254-48307276 AACAACATGCAGAAAAACAGAGG - Intronic
1141015286 16:80443432-80443454 AAACACATACGGAAGTAAAGAGG + Intergenic
1141145603 16:81527717-81527739 AAACACATGTGGAGCCAAAGAGG - Intronic
1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG + Intronic
1142296660 16:89227852-89227874 AAACACATGCGGACACACACCGG + Exonic
1148831328 17:50433820-50433842 GACCACCTGGGGCAACAAAGTGG - Intronic
1153860619 18:9201034-9201056 AATCAGATGCAGAAACAAAAAGG - Intronic
1156896488 18:42252583-42252605 AAACACAATCAGAAACAAAGGGG - Intergenic
1157477006 18:48029873-48029895 ATCCACATGCGGAAGCACACAGG - Exonic
1158014834 18:52772039-52772061 AACCACATTAGGAAAAAAAGAGG - Intronic
1159271911 18:66163967-66163989 AACCACATGAGGAAGAAAGGGGG + Intergenic
1160551032 18:79693982-79694004 GGCCACAGGCGGAAACAAGGCGG - Intronic
1161467287 19:4438234-4438256 AAGAACATGTGGACACAAAGAGG - Intronic
1161535407 19:4816279-4816301 AACCACATGTGGAACCAGAGAGG - Exonic
1164542201 19:29129419-29129441 GACCACATGAGGACACACAGTGG + Intergenic
1164542271 19:29129808-29129830 GACCACATGAGGAAATAGAGGGG + Intergenic
1166355674 19:42225868-42225890 AACCACCTGCGGACACACACGGG + Exonic
1167795425 19:51705073-51705095 AACATCCTGGGGAAACAAAGAGG - Intergenic
924975461 2:170438-170460 AAACACATGCGTGAACAAATGGG + Intergenic
932422596 2:71610492-71610514 AACTACATGAGGAAGCAAGGTGG - Intronic
933824466 2:86146272-86146294 AACTACTTGCTGAAGCAAAGAGG + Intronic
935948449 2:108307095-108307117 AAGCACATGCAAAATCAAAGAGG - Intronic
938038166 2:128053624-128053646 AACCAACTCCGGACACAAAGGGG - Intergenic
939164522 2:138626328-138626350 AAGGTCATGAGGAAACAAAGGGG - Intergenic
941305523 2:163860487-163860509 AAGGACATGCAGCAACAAAGTGG + Intergenic
942215796 2:173718035-173718057 AACAACAGGAGCAAACAAAGAGG + Intergenic
946439404 2:219682285-219682307 AACTACATGCAGAAAGGAAGGGG + Intergenic
947294969 2:228620776-228620798 AACCAGAGGCGGACATAAAGGGG + Intergenic
1168929793 20:1611758-1611780 AAACACTTGAGGAAACACAGAGG - Intronic
1168968552 20:1915032-1915054 AAACACTTGAGGAAACACAGAGG + Intronic
1169965105 20:11208614-11208636 AACCATGTGAGGAAACAAAAGGG - Intergenic
1170326127 20:15156411-15156433 AACCAAAGGGGGAAAAAAAGTGG - Intronic
1170698112 20:18678686-18678708 AAACAAATGCGGAACCAAAAAGG - Intronic
1170863506 20:20130875-20130897 AAACACAGCCAGAAACAAAGTGG - Intronic
1172985128 20:38980351-38980373 ACACAGATGAGGAAACAAAGAGG - Intronic
1174803199 20:53582288-53582310 AATCACATGCGGACACATAATGG - Exonic
1175943373 20:62547995-62548017 AACCACCTGCAGACACCAAGGGG + Intergenic
1176412491 21:6456682-6456704 AACCACAGGCGGAGGCCAAGAGG + Intergenic
1178792288 21:35711711-35711733 AACCACAAGCAGAAAGGAAGTGG + Intronic
1179687985 21:43065004-43065026 AACCACAGGCGGAGGCCAAGAGG + Intronic
1181037498 22:20176964-20176986 AAACAGATGGGGAAATAAAGTGG - Intergenic
1181594028 22:23902819-23902841 CACCTCATGGGGAAACAAGGAGG - Intergenic
951554409 3:23906177-23906199 AACCAAAGGGAGAAACAAAGGGG + Intronic
951707054 3:25553998-25554020 AAACACATGGGGAAACAGTGTGG - Intronic
954007510 3:47603526-47603548 AAGCACATGGGGAACCACAGAGG - Intronic
954475834 3:50744775-50744797 ATCCACATGCAAAAACAATGAGG - Intronic
955095837 3:55796905-55796927 AACCAAAAGGGGAAACAAAAAGG + Intronic
956084477 3:65595762-65595784 AACTACATGGGGAAGCAAATGGG + Intronic
958472635 3:94540688-94540710 TACCACATGAGGAGACACAGCGG - Intergenic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
963270673 3:143283074-143283096 AAGCATTTGTGGAAACAAAGAGG - Intronic
968500988 4:950013-950035 TCCCACATGCGGATACACAGAGG + Intronic
973026463 4:45279326-45279348 TATCACATGCGGAAACATAAAGG + Intergenic
974889372 4:67861316-67861338 AACCCCATGAGGTAACAAATGGG - Intronic
977517456 4:98039045-98039067 AACCACATTAGGAAAGAAATTGG + Intronic
983592957 4:169435218-169435240 TACCACATACGGATACAAGGAGG - Intronic
984023567 4:174516437-174516459 AAGCACATATGGATACAAAGGGG + Intronic
985245426 4:187975747-187975769 AAGAACATGTGGACACAAAGAGG + Intergenic
987682985 5:21161513-21161535 AACCACAAGGGGGACCAAAGAGG + Intergenic
988636105 5:32986593-32986615 AACCAGATGAGGAAGTAAAGAGG - Intergenic
991466291 5:66915819-66915841 AACCTCAGGCGGACACTAAGGGG - Intronic
994453078 5:99968360-99968382 AAGCACATGCAGGAAGAAAGAGG - Intergenic
995164988 5:109029467-109029489 AACCAGCTTGGGAAACAAAGTGG - Intronic
995409051 5:111833841-111833863 AAAGACATGCAGAAACAAAAGGG - Intronic
998763973 5:145464152-145464174 AAACACATGCTGAATTAAAGAGG + Intergenic
1002793617 6:452799-452821 AACCACATGGAGAGACAAGGAGG - Intergenic
1009733663 6:67645499-67645521 ACCCACATGCATAAATAAAGTGG - Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1014606623 6:123482045-123482067 TCCCACAGGTGGAAACAAAGCGG - Intronic
1014727722 6:124992614-124992636 ATCCACATTCTGAAACAAAATGG - Intronic
1016057685 6:139595712-139595734 GACCACATGCAGATAAAAAGAGG + Intergenic
1016762067 6:147748593-147748615 AACCAGAAGAGGAACCAAAGAGG - Intergenic
1017089460 6:150745702-150745724 AATCACATGCGGAGAAAAATGGG + Intronic
1018722879 6:166587089-166587111 ATCCCCATGTGGAAGCAAAGTGG + Intronic
1021301804 7:18982447-18982469 AACCACATCAGAAAAGAAAGAGG - Intronic
1022516449 7:30977759-30977781 AATCAGATGCAGAGACAAAGAGG + Intronic
1022658798 7:32346735-32346757 AACACCATGCAGTAACAAAGAGG + Intergenic
1024989566 7:55222517-55222539 AACCACAGAAGAAAACAAAGTGG + Intronic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1027546039 7:79528738-79528760 CACCACATGCTGACACCAAGAGG - Intergenic
1028245596 7:88473058-88473080 AACCAAATGAGAAAAAAAAGAGG + Intergenic
1028449490 7:90965169-90965191 AACACCATGCAGAGACAAAGTGG - Intronic
1029403365 7:100358629-100358651 AACCACCTCAGGACACAAAGAGG - Intronic
1029539623 7:101174847-101174869 GCCCAGATGTGGAAACAAAGGGG - Intronic
1029881196 7:103812060-103812082 ATCCACATAAGAAAACAAAGTGG - Intronic
1030551253 7:110963109-110963131 AAGCAAATGCAGAAACTAAGAGG - Intronic
1030981454 7:116189453-116189475 ATCCACATGAAGAAATAAAGAGG + Intergenic
1031956275 7:127945575-127945597 AATCACATACGGAACCAAACTGG + Intronic
1033800099 7:144890910-144890932 AAACAAAGGCGAAAACAAAGAGG - Intergenic
1034695215 7:153047454-153047476 AACCACATGCTGGAGCAGAGAGG + Intergenic
1035155374 7:156907973-156907995 AACCAAATGCGTAAAAAGAGAGG - Intergenic
1035926185 8:3730212-3730234 AACCATATGGGGAATCAAACTGG - Intronic
1037323786 8:17668867-17668889 AAACACATATGGACACAAAGAGG - Intronic
1040857631 8:51965384-51965406 ATCCACATGAAGAAATAAAGAGG - Intergenic
1040947203 8:52895669-52895691 ACCCACATATGGAAACAAGGAGG - Intergenic
1042503174 8:69531814-69531836 CACTACAAGCAGAAACAAAGAGG - Intronic
1044139732 8:88635596-88635618 AAACACATACAGACACAAAGAGG + Intergenic
1044270482 8:90237064-90237086 AACCACATGGAGGAACAGAGAGG - Intergenic
1049565153 8:143334470-143334492 AACCACAAGCGGAAAAAAAGAGG + Intronic
1055492923 9:76824786-76824808 AATCACATGAGGAAACAGACAGG + Intronic
1055562175 9:77531974-77531996 AACCAAATGCGGAGCAAAAGAGG + Intronic
1056750365 9:89346432-89346454 ATACACATGCGGAAACCAATAGG + Intronic
1057043352 9:91864012-91864034 AAGCAGACGCAGAAACAAAGTGG + Intronic
1060258614 9:122054213-122054235 AATCACAAGCGGAAGCAAGGCGG - Intronic
1186073507 X:5850166-5850188 AACCACAGGCGGAAGTACAGTGG + Intronic
1186773718 X:12843144-12843166 AGCCACATGGGGAAGAAAAGAGG + Intergenic
1187166135 X:16805566-16805588 AACCATATGGGGGAACAAAGGGG - Intronic
1190740778 X:53287566-53287588 ACCCACATGCATAAACACAGAGG + Intronic
1191726034 X:64282312-64282334 AACCACATGTGGACACAGGGAGG + Intronic
1193359640 X:80565485-80565507 AAGAACATGTGGACACAAAGAGG - Intergenic
1196057176 X:111368215-111368237 AGCCACATGTGGAAAGACAGGGG + Intronic