ID: 1118236556

View in Genome Browser
Species Human (GRCh38)
Location 14:64010439-64010461
Sequence CAGGCTTGACAGAAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118236552_1118236556 -8 Left 1118236552 14:64010424-64010446 CCTGACCCTTCATTGCAGGCTTG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG 0: 1
1: 0
2: 3
3: 37
4: 426
1118236549_1118236556 22 Left 1118236549 14:64010394-64010416 CCTTTGCACTGACTTTCTGTTTA 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG 0: 1
1: 0
2: 3
3: 37
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118236556 Original CRISPR CAGGCTTGACAGAAGGAAGA CGG Intronic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
901078634 1:6571241-6571263 CAGACTTGCCTGAAGGGAGATGG - Intronic
901878155 1:12178869-12178891 CAGGCTTGATTGTAGGAAGGGGG + Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
903346257 1:22686001-22686023 CAGGTTTGAGAGAAGGCAGTGGG - Intergenic
907248837 1:53124523-53124545 CAAGCTTGACACAAGGAATTAGG - Intronic
908068849 1:60436351-60436373 CAGGCGAGAAAGAAGGAAAATGG - Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
909821780 1:80072799-80072821 CCTGTTTGAGAGAAGGAAGAAGG + Intergenic
910678677 1:89841120-89841142 AAGGATTGAGAGAAGGAAAAAGG + Intronic
911388974 1:97214647-97214669 AATGCATGACAGAAGGCAGAAGG + Intronic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
912952909 1:114132864-114132886 CAGGTTTGACATCAGCAAGATGG - Intronic
914372537 1:147041535-147041557 CATGCCTCACAGAAGGAAAATGG + Intergenic
915057894 1:153152656-153152678 CAGGGATGCCAGAAGGAACAGGG + Intergenic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916741619 1:167651380-167651402 CAGGCATGACAGAAGGAGCCAGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917784703 1:178441935-178441957 CAGTCATGGCAGAAGGCAGAAGG + Intronic
918047671 1:180951362-180951384 CAAGCTGGACAGAACTAAGATGG - Exonic
918477521 1:184941096-184941118 CAGTTTTGACAAATGGAAGAAGG + Intronic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
920818782 1:209360701-209360723 TGGGCTTGAGAGGAGGAAGATGG - Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
923000771 1:230004845-230004867 CAGGCTTGAGTGAGGCAAGAGGG + Intergenic
923013420 1:230107008-230107030 GGGGCTGGACAGAAGGAAGCTGG + Intronic
924309024 1:242720810-242720832 CAGTCCTGGCAGAAGGCAGAAGG - Intergenic
924561971 1:245164651-245164673 CAGGCTGGAAAGGAGGCAGATGG + Intronic
1063054353 10:2487498-2487520 TATGCTTTACAGAAGGAAAAAGG - Intergenic
1063235626 10:4112538-4112560 CATCCTTGACAGAATGAGGAAGG - Intergenic
1063512080 10:6655452-6655474 CAGTCATGACAGAAGGTAGAGGG - Intergenic
1063913381 10:10854921-10854943 CAGGCTTGACAGGTGGACGCTGG - Intergenic
1063938927 10:11107719-11107741 CAGGAATGAGAGAAGGAACAAGG - Intronic
1064523356 10:16227306-16227328 GAGGCTTGAGAGGAGGAAAAGGG - Intergenic
1064851418 10:19713119-19713141 TAGGCAAGAAAGAAGGAAGAAGG - Intronic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1066258805 10:33708524-33708546 CAGGCTTGAAAAAAGACAGATGG + Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068174984 10:53446660-53446682 CAGGCTGGACTGAATGAAGGAGG + Intergenic
1068461355 10:57333692-57333714 CAGGCATGGCAGAAGGCAAAGGG - Intergenic
1069112615 10:64465577-64465599 CAGTCATGACAGAAGGTAAAGGG + Intergenic
1069510893 10:69041749-69041771 CAGGCTTGATGGAAGAATGATGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069829491 10:71273826-71273848 CAGACTTGCCAGAAGCAGGAAGG + Intronic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1072260099 10:93661527-93661549 CAGGCTTGCCAAGAGGAATAAGG - Intronic
1072531033 10:96319542-96319564 CAGTCTCGATAGAAAGAAGAAGG - Intronic
1074034898 10:109728663-109728685 CATGCTTCAAAGAAGGGAGATGG + Intergenic
1074543079 10:114382350-114382372 CAGCCTTGACTTAAGGAAGAAGG + Intronic
1074576761 10:114677061-114677083 CAGGCTTTTCAGAAGTAAGAGGG - Intronic
1074873825 10:117598725-117598747 TAACCTTGTCAGAAGGAAGAGGG + Intergenic
1075074629 10:119342703-119342725 CTGGCCTGGAAGAAGGAAGAGGG - Intronic
1075847208 10:125554654-125554676 CAAGATTGACAGGAGGAAGATGG - Intergenic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076513403 10:131028241-131028263 CATGTTTGACAGATTGAAGATGG + Intergenic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1077174154 11:1181120-1181142 AAGGCTGGAGACAAGGAAGAAGG - Intronic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1079062690 11:17263323-17263345 GAGGCTGGACAGAAAGATGAAGG + Intronic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1083554830 11:63617835-63617857 CAGTCATGGCAGAAGGAAAAAGG - Intergenic
1083696362 11:64445399-64445421 AAGGTTTGCCAGCAGGAAGAAGG + Intergenic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085543414 11:77294855-77294877 CATGTTTGACAGAAGTATGAAGG + Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086732020 11:90262570-90262592 CAATCTTGACAGAAGGCAAAGGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088566546 11:111178601-111178623 CAGTCATGACAGAAGGCAAAGGG - Intergenic
1089219171 11:116856465-116856487 CACGCTTGTTAGATGGAAGAAGG - Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1090400363 11:126444933-126444955 CAGGCCTGAGGGAGGGAAGAAGG - Intronic
1092226344 12:6750548-6750570 CAGGCATGACAGCAGGTACAGGG + Intronic
1094213954 12:27921179-27921201 CAGGAATGACAGCAGGGAGAGGG + Intergenic
1094242362 12:28242937-28242959 CAATCATGACAGAAGGCAGAGGG - Intronic
1094278945 12:28712895-28712917 CTGGCTTGATAGAAGACAGATGG + Intergenic
1094727325 12:33133686-33133708 CAGGCAAGAAGGAAGGAAGAAGG + Intergenic
1096252379 12:50041363-50041385 CAGGCCTGACAGAGTGAGGAGGG + Intergenic
1096758909 12:53823555-53823577 CAGACTTGAAAGGAGTAAGAGGG - Intergenic
1097407827 12:59212607-59212629 CAGGTTTGAGAAAGGGAAGAAGG + Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1098132801 12:67368084-67368106 AAGGCATGACTGAAGGAAGGAGG + Intergenic
1098364795 12:69691038-69691060 CAAGGTTGAAATAAGGAAGAAGG - Intronic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1100751471 12:97702902-97702924 CATGCTTGACTGAAGTAAGGAGG + Intergenic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103409511 12:120700871-120700893 CAGGCTAGACAAAAGGCAGCTGG - Exonic
1103789302 12:123458249-123458271 CACGCCGGAGAGAAGGAAGAGGG + Intronic
1104722606 12:131053361-131053383 CAGCCTTGATCGAATGAAGACGG - Intronic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1105834654 13:24198697-24198719 CAGACTTGGCAGAAAGAACAAGG - Intronic
1108592654 13:51924644-51924666 CAGGCAGGACGGAAGGAAGCAGG - Intergenic
1110480055 13:75963473-75963495 CAGGCTTGTCAGATGGAAACAGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1114646145 14:24257272-24257294 GAGGCTGGACAGAAGGTAGCTGG + Intronic
1115807635 14:37069868-37069890 AAGGCTTGACACAAGCAACATGG + Intronic
1115927917 14:38457614-38457636 CAGGCATTAAAGAAGGAAGTAGG + Intergenic
1116018511 14:39433503-39433525 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117186780 14:53247648-53247670 GAGACTAGAAAGAAGGAAGAGGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1120261626 14:82192254-82192276 CTGGTTTCAAAGAAGGAAGATGG + Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1122036249 14:98951227-98951249 CAGGCTTGACAGATGACAGATGG - Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1123921464 15:25072746-25072768 CAGGCCTGCTGGAAGGAAGATGG + Intergenic
1124440868 15:29685493-29685515 CTGGTGTGACAGGAGGAAGAAGG - Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124556634 15:30731874-30731896 CAGCCTTCACAGACAGAAGAAGG + Intronic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1124829267 15:33132179-33132201 CAGCCAGGAAAGAAGGAAGAGGG - Intronic
1125711822 15:41793081-41793103 CTGGCTTAACAGAAGGGAGCTGG - Intronic
1127625356 15:60775094-60775116 AAGGGTTGAAAGAAGAAAGAAGG - Intronic
1128297611 15:66537860-66537882 GAGGTCTGAGAGAAGGAAGAGGG - Intronic
1128474738 15:67987676-67987698 CAGGCATGACATCAGGGAGACGG + Intergenic
1128984535 15:72209598-72209620 CTTCCTTGACACAAGGAAGATGG - Intronic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1129172307 15:73815699-73815721 GAGGCAGGACAGAAGGAAGCAGG + Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130301883 15:82686318-82686340 TAGGATTGAAAGAAGGGAGAAGG + Intronic
1131136025 15:89936382-89936404 CAGGCATCACAGTAGGAACAAGG + Intergenic
1131973471 15:97916791-97916813 CAGGCTTGATAGAAGGTTGGTGG - Intergenic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133547568 16:6822722-6822744 CAGGCTTGAAGGAAGGGAGAGGG + Intronic
1135716273 16:24771045-24771067 CTGGCTTAACAGAAGGTAGGTGG - Intronic
1135762261 16:25146883-25146905 CCTGCCTGACTGAAGGAAGAAGG - Intronic
1135887634 16:26325910-26325932 CAGGCTTAAAAGAAGCGAGAGGG + Intergenic
1136714916 16:32271025-32271047 CAACCATGGCAGAAGGAAGAGGG + Intergenic
1138730947 16:59194572-59194594 CAGGCATGATAAAATGAAGACGG - Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1139302568 16:65958023-65958045 CAGGCTTCAAAGAGGAAAGATGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1141966947 16:87452088-87452110 CCTGCTTGACAGACTGAAGAGGG + Intronic
1142180299 16:88665595-88665617 CAGCCGTGGCAGAAGGAAGGAGG - Intergenic
1203055137 16_KI270728v1_random:918744-918766 CAACCATGGCAGAAGGAAGAGGG - Intergenic
1143318666 17:6053260-6053282 CAGACTTGACCAAAAGAAGAAGG - Intronic
1143688040 17:8535017-8535039 CAGGCCTGACACAGGGAAAATGG + Intronic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1147418633 17:40311085-40311107 CAGGGATGGCAGAAGGAAGGTGG - Intronic
1148049652 17:44763461-44763483 CAGGCTGGACAGAAGTGAGGGGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1149082624 17:52677287-52677309 TAGGCTTGGCATAATGAAGATGG - Intergenic
1149930590 17:60750779-60750801 CAGACCTGAAAGCAGGAAGATGG - Intronic
1151129650 17:71883186-71883208 AAGGCTTGAAAGATGGAGGAGGG + Intergenic
1151275866 17:73033870-73033892 CATGTTTGACAGCTGGAAGAAGG - Intronic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1151908167 17:77063039-77063061 CAGGTCTGACCGAAGCAAGATGG - Intergenic
1153343710 18:4003863-4003885 CAGGCTCTAAGGAAGGAAGATGG + Intronic
1153530706 18:6042689-6042711 AAGGCTTGGCCAAAGGAAGAAGG - Intronic
1153575984 18:6522445-6522467 CAGGCGTGACATCAGCAAGATGG - Intronic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1155138123 18:23017041-23017063 CAGGCGTAACAGCAGGAATAAGG + Intronic
1156017137 18:32559593-32559615 AAGGGTTGAAAGAAAGAAGAAGG + Intergenic
1158367020 18:56747673-56747695 GAGGCTTGACATTAGGAGGACGG + Intronic
1158420560 18:57289243-57289265 CAGGCTTGAGGGTAGGAAGAAGG + Intergenic
1158435227 18:57430641-57430663 CAGGCTTGAGAGAGGGGAAAGGG - Intergenic
1159785049 18:72703952-72703974 CATGCTTAGCAGAAGGAAAACGG - Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1159936279 18:74370388-74370410 CAGGCTTGACAGAATCTTGAGGG - Intergenic
1160042328 18:75357139-75357161 CAGTCGTGGCAGAAGGATGAAGG - Intergenic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1161495440 19:4583770-4583792 CAGGCTAGACAAAAGGCACAGGG - Intergenic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162227100 19:9232211-9232233 CAAGGTTGACAAAAGGAAGATGG - Intergenic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163326371 19:16605994-16606016 CAGTTTTGAGTGAAGGAAGAAGG - Intronic
1165229807 19:34379793-34379815 CAGGCCTGGGAGACGGAAGAAGG - Intronic
1165729157 19:38133331-38133353 AAGGAATGACAGAATGAAGATGG - Intronic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166796811 19:45431218-45431240 CAGGCTTAACAGAAGACAGCTGG - Intronic
1166991527 19:46695678-46695700 CAGGCGGGACAGAAGGCACAGGG + Intronic
1167526347 19:49986593-49986615 CATGGTTGAGAGAAGGAAGTTGG + Intronic
1167671483 19:50856188-50856210 CAGGGTTGACAGGAGGAACTGGG - Intronic
1168014415 19:53560720-53560742 CAGGCTTTGCTGATGGAAGAAGG - Intronic
1168241051 19:55089070-55089092 CAAGCTTGGCAGCAGGAGGAGGG - Intergenic
1168529296 19:57114858-57114880 CAAGTTTAACAAAAGGAAGAAGG + Intergenic
924997404 2:374843-374865 CACGTGTGACAGAAGGAACACGG - Intergenic
925466087 2:4108506-4108528 CAGCCTTGAGAGCCGGAAGAGGG - Intergenic
925466095 2:4108538-4108560 CAGCCTTGAGAGCCGGAAGAGGG - Intergenic
925466103 2:4108570-4108592 CAGCCTTGAGAGCCGGAAGAGGG - Intergenic
925466178 2:4108858-4108880 CAGCCTTGAGAGCAGGAATAGGG - Intergenic
925466194 2:4108922-4108944 CAGCCTTGAGAGCGGGAAGAGGG - Intergenic
925466221 2:4109018-4109040 CAGCCTTGAGAGCCGGAAGAGGG - Intergenic
925542636 2:4982167-4982189 CATGCTTGACAGAAGTAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926384326 2:12321293-12321315 CTGGCCTGGCAGAAGGAAGTGGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928330487 2:30354488-30354510 CAAGCCTGACAAAAGGTAGATGG + Intergenic
928452136 2:31386588-31386610 GAGGAATGACAGTAGGAAGAGGG - Intronic
929570360 2:43018991-43019013 GAGGCTTGAAGGAAAGAAGAAGG + Intergenic
931006452 2:57855455-57855477 CAATCTTGGCAGAAGGAAAAGGG + Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
932338097 2:70942543-70942565 CAGGCTTGCCCAAAGCAAGAGGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
933539483 2:83620176-83620198 CAGACATGACAGAAGGCAAAAGG + Intergenic
933656515 2:84891666-84891688 CTGGCAAGAAAGAAGGAAGAAGG - Intronic
935316566 2:101840583-101840605 CTCGCTGGACAGAAGGAAAACGG - Intronic
935352086 2:102159775-102159797 CAGGCTTGCAAGAAGAGAGAGGG - Intronic
935939434 2:108222662-108222684 CAGCCATGACAGGAGGTAGAAGG - Intergenic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
936734093 2:115419368-115419390 CAGTCATGGCAGAAGGAAAAGGG + Intronic
937478280 2:122234557-122234579 GAAGCTTGATCGAAGGAAGAGGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943661602 2:190565214-190565236 CAAGCCTGATAGAAGAAAGAAGG + Intergenic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944014935 2:195024666-195024688 CATGCTTGACAGTTGGAGGAGGG + Intergenic
944325817 2:198402326-198402348 GATGCTTGACATATGGAAGAAGG + Intronic
944534871 2:200698779-200698801 CAGGCTTAAAAGAAGGCAGCTGG + Intergenic
945125346 2:206503421-206503443 TAGGCCTGACACAAGGTAGAGGG + Intronic
945375632 2:209076887-209076909 TAGGTTTGAAAGAAGGAAAAGGG - Intergenic
945469532 2:210211643-210211665 CAGTCATGGCAGAAGGCAGAGGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946146167 2:217732795-217732817 GAGGCATGACAGAAGGCTGAAGG + Intronic
946469488 2:219944973-219944995 CTGGCTTGGCAAATGGAAGATGG + Intergenic
947260314 2:228214496-228214518 CAGTCATGACAGAAGGCAAAGGG + Intergenic
947457741 2:230270996-230271018 CAGGCTTTGAAGATGGAAGAAGG + Intronic
947468080 2:230372010-230372032 CAGGCTTTGAAGATGGAAGAGGG + Intronic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
1168953283 20:1817240-1817262 CAGCCTTGGCAGAAGGAGGTGGG + Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169431824 20:5543054-5543076 CAGGTTTGGTAGAAGGAAGGAGG + Intergenic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1170869529 20:20192431-20192453 GAGCCCTGACAGAAGGAGGAGGG + Intronic
1171723841 20:28596158-28596180 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1171754220 20:29086888-29086910 CAGGCTTGTCAGGAGCAAAAGGG - Intergenic
1171859513 20:30383753-30383775 CAGGCTTGACAGGAGCAAAAGGG - Intronic
1172200740 20:33124389-33124411 CAGGCATGGCAGAAAGAAGGTGG - Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1175013451 20:55763804-55763826 CAGTCATGACAGAAGGCAAAAGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1179006837 21:37522777-37522799 CAGGCTTTTGAGAAGGAAGGAGG - Intergenic
1180297397 22:10954849-10954871 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1180411035 22:12608947-12608969 CAGGCTTGACAGGAGCAAAAGGG - Intergenic
1180988006 22:19916982-19917004 CAGGCTTGCCAGTGGGGAGAAGG - Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182486254 22:30640842-30640864 CAGGCCTGGGAGAAGGAAGTGGG + Intronic
1182956793 22:34434240-34434262 AAGGGTTGACAGCAGCAAGAGGG - Intergenic
1183185339 22:36288588-36288610 GAGGCTAGAAAGAAGGAATATGG + Intronic
1183342470 22:37289231-37289253 GAGGCAAGAAAGAAGGAAGATGG - Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183861288 22:40672148-40672170 CAGGAGTGACAGTAGAAAGAAGG + Intergenic
1184107368 22:42375997-42376019 CAGGCTTGAACCCAGGAAGAAGG + Intergenic
1184307878 22:43619552-43619574 CATACTTGAAAGAAAGAAGAAGG + Intronic
1184677284 22:46050631-46050653 CTGGCTTTAAAGACGGAAGAAGG - Exonic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1184912374 22:47544825-47544847 AAGGGTTGAGAGAAGGGAGATGG + Intergenic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
949119084 3:363773-363795 GAGGCATGACAGAATGAGGAGGG + Intronic
950617175 3:14169883-14169905 CAGGCCAGACAGAAGGAATCAGG + Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
951130589 3:19038466-19038488 CAGGTTTGACAAAAGTCAGATGG + Intergenic
951342159 3:21501245-21501267 TAGGCAAGAAAGAAGGAAGACGG - Intronic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952739206 3:36719572-36719594 CAGGGATGAGAGAAGGAAGGAGG - Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953043105 3:39272409-39272431 CAGGCATGAGAAAAGGAAGTAGG - Intronic
953836602 3:46351580-46351602 CAGGCTTAAAAGAAGCAACAGGG - Intergenic
954317204 3:49807580-49807602 CTGGCTTCATAGCAGGAAGAGGG + Intronic
954385928 3:50243837-50243859 CAGGCAGGACAGCAGGCAGACGG + Intronic
954476031 3:50746698-50746720 CAGGCATGGCAGAAGGCAAAGGG + Intronic
954876550 3:53806270-53806292 CAGACTTGACAGGAAGATGAGGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956420461 3:69081459-69081481 CAGGCTTTGCAGAAGGCTGAAGG - Intergenic
956502058 3:69897369-69897391 CTTGCCAGACAGAAGGAAGAAGG + Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
959829849 3:110847796-110847818 GAGGTTTGCCAGAAGAAAGAAGG + Intergenic
960035078 3:113094115-113094137 TAGGCATGATAGGAGGAAGAGGG + Intergenic
960255961 3:115511977-115511999 CATGCTTGAGAGGAGAAAGATGG + Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961395075 3:126580795-126580817 CAGGCTGGAAAGCATGAAGATGG + Intronic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
962041878 3:131715986-131716008 CATTCTTGACAGATGGATGAGGG - Intronic
962838837 3:139215237-139215259 CAGACTTGATGGAAGGAAGCTGG + Intronic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
962968326 3:140374867-140374889 AAGGTTTGAGAGAAGGAAGTTGG + Intronic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965582022 3:170278789-170278811 CAGTCTTGGCAGAAGGCAAAGGG + Intronic
968596597 4:1489239-1489261 CACGCTTGACAGAATGGAGATGG - Intergenic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969577667 4:8046097-8046119 CAGGCGTGACAGCAGCAAAAAGG - Intronic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970994130 4:22246242-22246264 CAGGCTTGACAGCAGAAGGAAGG + Intergenic
971035575 4:22689329-22689351 CAGTCATGGCAGAAGGATGAAGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
972419032 4:38868853-38868875 CAGGCTTGATGGAAGAAAGGAGG - Intronic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
975007449 4:69308561-69308583 CAGGCTTGAGAGAACATAGATGG - Intronic
975167394 4:71192675-71192697 AAAACTTAACAGAAGGAAGAGGG - Intronic
976105022 4:81607077-81607099 CGGGCTTGCCAGCAGAAAGAAGG + Intronic
976168982 4:82284383-82284405 AAGGCTTGAAAGAAGGCAGGTGG - Intergenic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
978107572 4:104922402-104922424 CATGGTTGACAGAACAAAGATGG - Intergenic
978321176 4:107497352-107497374 CAGGAGTGACATAAGCAAGATGG - Intergenic
978511701 4:109527409-109527431 CATGTTTGCCAGAAGGCAGATGG - Exonic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979664178 4:123292921-123292943 CAGCCTTGACAGAAGCAACTGGG + Intronic
980885074 4:138753338-138753360 CAGCCTTGTCAAAAGTAAGATGG + Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981244543 4:142518822-142518844 AAGGCTTGACCGGAGCAAGAAGG - Intronic
982204658 4:152988757-152988779 CAGGCTTGTCAGGAGGCAGCTGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
985437658 4:189947440-189947462 CAGGCTTGACAGGAGCAAAAGGG - Intronic
985563457 5:603539-603561 CAGGCTGGACACCAGGCAGACGG + Intergenic
985639080 5:1054807-1054829 CAGGCTGGAGAGAAGATAGAAGG - Intronic
986325451 5:6669978-6670000 CTGGGCTGACAGAAGGCAGAGGG + Intergenic
986345939 5:6835234-6835256 CAAGCATGACACAAGGAAGTTGG + Intergenic
986466756 5:8033891-8033913 CAGGCATGACAGAAGAAGTAAGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990142974 5:52726790-52726812 TAGACATGAAAGAAGGAAGAAGG - Intergenic
991203538 5:64022343-64022365 CTGGCTTGAAAGAAGGCATAAGG - Intergenic
992278480 5:75147038-75147060 CAGGCTTGACAGAGTTAAGCTGG + Exonic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993817912 5:92576099-92576121 AAGGCTTGACAGTAGACAGAAGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
995992971 5:118264717-118264739 CAGGCTTAACATAAGGTATAAGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997022647 5:130019517-130019539 CAGACTTGAACTAAGGAAGAGGG - Intronic
998234158 5:140383487-140383509 CAGCCTTGATAAAAGGAAGGAGG + Intergenic
998678164 5:144433718-144433740 CAGGCATGTAAGAAGGAACAAGG - Intronic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
999394591 5:151219258-151219280 CATGCTAGGCAGAAGGAATATGG - Intronic
999499613 5:152133582-152133604 CACACATGACAGAAGGAAAAAGG + Intergenic
999999031 5:157120133-157120155 TGGGCTTGGCAGAATGAAGATGG - Intronic
1001626952 5:173144268-173144290 AATGCCTGACAGAAGGAAGATGG + Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001801293 5:174546466-174546488 AAGGCTAGACAGAAACAAGAAGG + Intergenic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1005416475 6:25605242-25605264 CATGCATGACATATGGAAGATGG + Intronic
1006017844 6:31096504-31096526 CGGGCATGAAAGAAAGAAGATGG + Intergenic
1006022394 6:31125114-31125136 TAGGCTTGGAAGAAGGAAAATGG + Intronic
1007863823 6:44945234-44945256 GAGGCCTGAGAGAAGAAAGATGG - Intronic
1009044120 6:58216929-58216951 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009219944 6:60971197-60971219 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009752314 6:67888582-67888604 CAAGCCAGACAGAAGAAAGAGGG + Intergenic
1009924580 6:70104334-70104356 CAGTCATGGCAGAAGGGAGAAGG + Intronic
1009964495 6:70564524-70564546 CAGTCATGGCAGAAGAAAGACGG + Intergenic
1010288388 6:74106869-74106891 CAGGCTTTACTGAAAGAAAATGG + Intergenic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1014918373 6:127182005-127182027 CACTCATGACAGAAGGAAAAGGG + Intronic
1016575240 6:145563078-145563100 ACGGCTTGAGAAAAGGAAGAAGG + Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017563413 6:155658159-155658181 CAGCCTTGATAGAAGGAGGGTGG + Intergenic
1017638967 6:156471784-156471806 CAGGCCTGATAGAGGGGAGAGGG - Intergenic
1019156438 6:170042068-170042090 CAGGCATGGCAGAAGGCAGAAGG - Intergenic
1019595767 7:1857650-1857672 CCAGCTGGACAGGAGGAAGAGGG + Intronic
1020149831 7:5673330-5673352 CAGGCTCGACAGAATGGAGTGGG + Intronic
1020159577 7:5759169-5759191 CAATCATGACAGAAGGAAAAGGG - Intronic
1020350134 7:7210461-7210483 TAGGCCAGACAGAAGGGAGAAGG + Intronic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1022364225 7:29695342-29695364 CAGGCCTGACAGCAGGGACACGG + Intergenic
1022697139 7:32718390-32718412 CAGGCCTGACAGCAGGGACACGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024311435 7:47973118-47973140 CAGTCATGACAGAAGGCAAAGGG - Intronic
1024658654 7:51473203-51473225 CAGGGATGAGAGAAGGGAGATGG + Intergenic
1025705417 7:63858235-63858257 GAGGGTTGACAGGAGGAAAAGGG + Intergenic
1026188822 7:68105810-68105832 CAGGCTTGACAAATGCAAGGAGG + Intergenic
1026451407 7:70532687-70532709 CATGTTGGAGAGAAGGAAGAAGG - Intronic
1026735640 7:72946846-72946868 CAGGCTTGGCAGGAAGAAAACGG - Intronic
1026785982 7:73301777-73301799 CAGGCTTGGCAGGAAGAAAATGG - Intergenic
1027049510 7:75013063-75013085 CAGGCATGACCCCAGGAAGAAGG + Intronic
1027108081 7:75418165-75418187 CAGGCTTGGCAGGAAGAAAACGG + Exonic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1030282421 7:107790817-107790839 GGGTCTAGACAGAAGGAAGAAGG - Intronic
1031410605 7:121436706-121436728 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032645503 7:133819191-133819213 CAGGGTTGAAAGCAGGAACAAGG - Intronic
1032721600 7:134554631-134554653 GAGGCTTGCCAGGAGGAAGGTGG + Intronic
1032908114 7:136396117-136396139 CAGGCAGGAAGGAAGGAAGAAGG + Intergenic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034272862 7:149811844-149811866 CAGGCTGGACAGGCTGAAGATGG - Intergenic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1039588985 8:38730696-38730718 CCTGTTTGACAGAAGTAAGAAGG + Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041206174 8:55500021-55500043 CAAGCTCTAGAGAAGGAAGATGG - Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1041997287 8:64078430-64078452 AAGGAATGAAAGAAGGAAGAAGG - Intergenic
1042837592 8:73092445-73092467 GAGGGTTGACAGAATGAAGGTGG + Intronic
1043018847 8:74975361-74975383 CAGGCTTGGTAGCAAGAAGAGGG + Intergenic
1043887714 8:85621662-85621684 CATGCTTGATAGAAGTAAGGGGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048367753 8:133753282-133753304 CAGTCATGACAGAAGGCAAAGGG + Intergenic
1049118539 8:140712289-140712311 TAGGCTTAACAGAAGGCAGCAGG + Intronic
1049238493 8:141524703-141524725 CAGGCCTGACGGAAGGAACTCGG + Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049637759 8:143698238-143698260 CAGCCTTGACTGAAAGATGAAGG + Intronic
1050248126 9:3713410-3713432 AAGACGTCACAGAAGGAAGACGG + Intergenic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1053029038 9:34758563-34758585 TGGGCTTGACATAATGAAGATGG + Intergenic
1053328563 9:37181290-37181312 CAGCCTTTACCTAAGGAAGAAGG + Intronic
1053725761 9:40998878-40998900 CAGGCTTGACAGGAGCAAAAGGG - Intergenic
1054755675 9:68955233-68955255 CATGCTTGACTGAACCAAGAAGG + Intronic
1055888680 9:81098471-81098493 CAGACCAGACAAAAGGAAGAGGG + Intergenic
1056310520 9:85336157-85336179 CAGGCTTATCAGAATGAAGAAGG + Intergenic
1056577255 9:87865785-87865807 CAGGCTTAACAGAAAGAATCAGG - Intergenic
1056715152 9:89022330-89022352 CAGGCTTTGAAGAAGGAAGTGGG - Intronic
1057529615 9:95832351-95832373 GAGGCTTGAGGGCAGGAAGAAGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1060739094 9:126086207-126086229 GAGGCATGAGAGAAGGGAGAGGG + Intergenic
1061338984 9:129963596-129963618 AAGGCTGGAAGGAAGGAAGATGG - Intronic
1061417794 9:130457134-130457156 CTGGCTTGACAGAAAACAGATGG + Intronic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1202804418 9_KI270720v1_random:37798-37820 CAGGCTTGACAGGAGAAAAAGGG + Intergenic
1203449056 Un_GL000219v1:93080-93102 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1187111257 X:16302966-16302988 CAGGCTTTGAAGATGGAAGAAGG + Intergenic
1189653257 X:43212401-43212423 CAGGCATTACAGAACGAAAATGG + Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1192259210 X:69494128-69494150 CAGACTTCAGAGAAGAAAGAGGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1194363998 X:92990843-92990865 CAGTCATGACAGAAGGCATAGGG - Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1195935996 X:110126241-110126263 TAGGGCTGACAGAAGGACGAGGG + Intronic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1196298872 X:114031559-114031581 CAGTCATGACAGAAGGCAGAAGG + Intergenic
1196614535 X:117752849-117752871 CAAGAATGACTGAAGGAAGAAGG + Intergenic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic