ID: 1118239305

View in Genome Browser
Species Human (GRCh38)
Location 14:64040378-64040400
Sequence TACAGTACTTTGAGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118239305 Original CRISPR TACAGTACTTTGAGAACAAA AGG Intronic
903024139 1:20415179-20415201 TACAGAACATTCTGAACAAAGGG + Intergenic
906813167 1:48850154-48850176 GACTATACTTTGAGAACAAATGG + Intronic
907370741 1:54001775-54001797 ATCAGTACTTTAAGAACAACAGG - Intergenic
907549455 1:55292117-55292139 TATTGTACTTTAAGAAGAAAAGG - Intergenic
907612000 1:55880496-55880518 TACAGAACTTAGAGAAACAATGG + Intergenic
908533783 1:65058440-65058462 TACAGTACTGTGATAACTGAAGG - Intergenic
908783228 1:67710894-67710916 TACAATATGTTGAGAATAAATGG + Intronic
908834236 1:68212393-68212415 TCCATTACTTTTAGAACAAAGGG + Intronic
908947717 1:69520403-69520425 TTCAGTATGTTGAGAAAAAAAGG + Intergenic
909201826 1:72699205-72699227 TACAGTTCTTTGAGAGCAAAAGG - Intergenic
910071171 1:83215303-83215325 TACAGTAATTGGAAAACAATTGG - Intergenic
910234432 1:85020650-85020672 TACAGTACACTCAAAACAAAGGG + Intronic
910977611 1:92923585-92923607 TATAAAACTTTCAGAACAAAGGG - Intronic
911341924 1:96649999-96650021 CAAAGTACTTTGAGAATAACAGG - Intergenic
913554724 1:119953753-119953775 TACAGGACTTGGTGAAGAAATGG + Intronic
916473621 1:165147499-165147521 TCCAGTACTTTTAGGACACATGG - Intergenic
916946823 1:169737605-169737627 TACAGGTATTTGGGAACAAAAGG - Intronic
917405653 1:174704534-174704556 TACTGTACTTTGATAAAGAAGGG + Intronic
918855714 1:189754348-189754370 TACATAACTTTGTGAACAAATGG + Intergenic
919064216 1:192672771-192672793 AACAGGACTTGGGGAACAAATGG + Intergenic
919894334 1:201999586-201999608 TACAGTACTTTGATAAGGAAAGG + Intronic
920977847 1:210802668-210802690 TACAATTCTTAGAGAACAATAGG + Intronic
922995770 1:229958773-229958795 TAAAGGGGTTTGAGAACAAATGG + Intergenic
1062949072 10:1483165-1483187 TACGGGACTTTTAGAAAAAAAGG - Intronic
1065501076 10:26382916-26382938 TACAGCAGTGTGAGAACAGATGG + Intergenic
1068296048 10:55073699-55073721 TATAATACTTTGAGAAGAATTGG + Intronic
1068976832 10:63019471-63019493 AACAGTACTTTGAAAACCACTGG - Intergenic
1069039055 10:63675530-63675552 GACAATACTTTGAGAACCAGTGG + Intergenic
1072559992 10:96563306-96563328 TACAGCACTTTGAGAAGCTAAGG - Intronic
1073314677 10:102570931-102570953 TACAGTATTTTCAGTACACAAGG + Intronic
1073755286 10:106574711-106574733 TACCACACTTTGAGAACAACTGG + Exonic
1076214532 10:128682354-128682376 TAGAGTCTTTTGAGAACAACAGG + Intergenic
1076474307 10:130741932-130741954 TGCTGCACTTTGAGAACCAATGG - Intergenic
1077641327 11:3884414-3884436 TCCAGCACTTTGAAGACAAAAGG + Intronic
1077683995 11:4273644-4273666 TTTGGTACTTTGAGAATAAAAGG - Intergenic
1077686047 11:4293120-4293142 TTTGGTACTTTGAGAATAAAAGG + Intergenic
1077869225 11:6247713-6247735 CACAGAACTGTGAGAATAAATGG - Intergenic
1079729766 11:23925377-23925399 TCAAGGACTTTGAGAACAGAGGG - Intergenic
1080073023 11:28112181-28112203 TGTAGTATTTTGAGAACATATGG + Intronic
1080184791 11:29469440-29469462 TACCATACTTTGAGAACAACTGG + Intergenic
1080309202 11:30869748-30869770 TGCAGAACTCTGTGAACAAAGGG + Intronic
1080484239 11:32688482-32688504 TAAAGTATTTTTATAACAAAAGG - Intronic
1080621315 11:33989488-33989510 TAAAATACTTTGAGATAAAAAGG + Intergenic
1080992468 11:37555111-37555133 TTTAGTTCTTTGAGGACAAAAGG - Intergenic
1081365956 11:42235297-42235319 TAAAGTACTTTGAGCAATAATGG - Intergenic
1084028781 11:66468460-66468482 CACAGTACTTTGTGAAAAATGGG - Intronic
1086058301 11:82674375-82674397 TGCAGTAATTTGAGAACCAATGG + Intergenic
1087025757 11:93648107-93648129 AACAGTACTTTGAGGAGTAAGGG + Intergenic
1087751972 11:102016746-102016768 TACAGAAATTTCACAACAAAAGG - Intergenic
1088353656 11:108918782-108918804 CATAGTACTCTGAAAACAAATGG - Intronic
1088685095 11:112278523-112278545 TACTGTACTTAGAAAAGAAAAGG + Intergenic
1088961709 11:114673734-114673756 TACAGCTCTTTGGGAACAAAAGG - Intergenic
1090538803 11:127677641-127677663 TACAATACTTTGAGGAAAGAAGG + Intergenic
1092462107 12:8696355-8696377 TACACTATCTTGAGAACAAAGGG - Intronic
1093222441 12:16438883-16438905 TAGATTACTTTGTGAGCAAAGGG + Intronic
1093376360 12:18432720-18432742 TACAGTATTTTGAAGCCAAATGG + Intronic
1095930791 12:47623363-47623385 TAATGTCCTTAGAGAACAAAGGG - Intergenic
1097569160 12:61309688-61309710 TCCATTGCTTAGAGAACAAAAGG - Intergenic
1097916189 12:65022531-65022553 TACAGTCATTTGAAAACACAGGG + Intergenic
1098453461 12:70646124-70646146 TACAGTAAATTTAGAACAAAAGG + Intronic
1098989958 12:77054795-77054817 TACATGCCTTTGACAACAAAAGG + Intronic
1100038303 12:90280549-90280571 TGCAGAACCTTGAGTACAAAAGG - Intergenic
1101856197 12:108445090-108445112 TACAGTATATTCAGAACAGAAGG - Intergenic
1102411838 12:112726685-112726707 TAAAATACTTTGAGATAAAATGG - Intronic
1102693411 12:114779427-114779449 TGCATTACTGTGAGGACAAAAGG + Intergenic
1102724675 12:115050628-115050650 TACAATATTGTGAGAATAAAGGG - Intergenic
1104257071 12:127148200-127148222 TACAGCTCTTTGGGAACAAAAGG + Intergenic
1104341127 12:127949873-127949895 TACAGCACTTTTAGAAAGAAAGG - Intergenic
1104411743 12:128563994-128564016 TCCAGAACTTTGAGAAATAAAGG - Intronic
1106654794 13:31731839-31731861 TAAAATACTTTAAGAATAAAGGG - Intergenic
1106911116 13:34464625-34464647 AGCAGGACTTTGAGGACAAAAGG + Intergenic
1106968655 13:35106768-35106790 TACATTACTTTAAAAAAAAAAGG - Intronic
1107424609 13:40280826-40280848 TACAATCCTTTGAGAGAAAATGG + Intergenic
1108834019 13:54518161-54518183 TCCAGTACTTTGAGAAGCAGAGG + Intergenic
1108931221 13:55823618-55823640 TACAATATCTTGACAACAAATGG - Intergenic
1110477473 13:75933469-75933491 TACAGTATTTTGAAACCATAGGG + Intergenic
1111264044 13:85783415-85783437 TACAGTACTTTGGGAAAATGAGG + Intergenic
1111478648 13:88790604-88790626 TATAGTACTGTGAAAACTAAGGG - Intergenic
1111934944 13:94548983-94549005 GACTGTACTTTGAGAACCACCGG + Intergenic
1112129516 13:96506262-96506284 AAGAGTATTTTGAGGACAAATGG - Intronic
1112358382 13:98693885-98693907 TACAGCTATCTGAGAACAAAGGG - Intronic
1113388749 13:109875516-109875538 TTCAGTACTTTGACTAAAAAGGG - Intergenic
1115380798 14:32736716-32736738 TACGATGCTTTGAGAAGAAATGG - Intronic
1116289025 14:43008016-43008038 TACAGTGGTTTGAGAACTTATGG - Intergenic
1118239305 14:64040378-64040400 TACAGTACTTTGAGAACAAAAGG + Intronic
1120932528 14:89863743-89863765 TACAGTTGGTTGAGAAAAAAAGG + Intronic
1121527757 14:94631438-94631460 TACAATAGTTTGAAACCAAATGG + Intergenic
1121806049 14:96824353-96824375 TACTGTATTTTGAAAGCAAAAGG + Intronic
1124873162 15:33563965-33563987 TACAGTACCTTCAAAAAAAATGG + Intronic
1125931805 15:43605404-43605426 TACAGCAATTTGACAACAACAGG + Intronic
1126042483 15:44605584-44605606 CACATTACTATGAGAATAAAAGG - Intronic
1126216824 15:46165004-46165026 GACAGTAATTTGAACACAAAGGG - Intergenic
1126548139 15:49895296-49895318 AACTGTACTTTGAGAACCACTGG - Intronic
1126596055 15:50385194-50385216 GTCAGGAGTTTGAGAACAAATGG + Intergenic
1126748118 15:51847753-51847775 TATATTACTTTGATAGCAAATGG - Intronic
1126774472 15:52088213-52088235 TACTGTCCTTTGAGAATAGAGGG - Intergenic
1127238149 15:57078949-57078971 AGCATTACTTTGATAACAAAAGG - Intronic
1127316790 15:57803363-57803385 TAGAGTACTTTGACAATAAAAGG + Intergenic
1127320911 15:57845251-57845273 AAAAGTACTTAGAAAACAAAGGG - Intergenic
1127708644 15:61573147-61573169 TAAAGTACTTAGAGACCAAGTGG - Intergenic
1128581836 15:68816244-68816266 TACAGTATCTTAAGAAAAAAAGG + Intronic
1130241028 15:82191486-82191508 TACGGTACTATGAAAACATAAGG + Intronic
1131205088 15:90437787-90437809 TCCAGTACTTTGAGAAAGAGAGG - Intronic
1131574138 15:93569424-93569446 TCCCTTACTTTCAGAACAAATGG + Intergenic
1131670397 15:94613793-94613815 TAATGAACTTTGAGAATAAAAGG - Intergenic
1137843007 16:51657486-51657508 TAAAGTACTTTTGGAAAAAAAGG + Intergenic
1138728369 16:59165977-59165999 TACAGCACTTTGAGAAGCAGAGG + Intergenic
1139120669 16:64012644-64012666 TACAGCTGTTTGGGAACAAAAGG - Intergenic
1140559777 16:75965504-75965526 TACACTACTTTTAGAACACCTGG - Intergenic
1140671250 16:77281370-77281392 TACAGTATTTTCAGATCAATTGG + Intronic
1142197001 16:88743587-88743609 TTCAGTTTTTTGAGCACAAATGG + Intronic
1150937169 17:69649221-69649243 TACAGAACTTTGGGAGAAAATGG + Intergenic
1151836196 17:76584648-76584670 TCCAGCACTCTTAGAACAAAGGG - Intronic
1151844547 17:76643241-76643263 TACAGGAGTTTGAGAACTGATGG - Intronic
1153741779 18:8137552-8137574 AACAGTACCTTGAGAACAACTGG - Intronic
1156086478 18:33411223-33411245 TTGAATACTTTGAGAACAATAGG - Intronic
1156128810 18:33942240-33942262 TAAAGTATTTTTACAACAAATGG - Intronic
1156418351 18:36922900-36922922 TGCAATACTTTAATAACAAAAGG - Intronic
1156449073 18:37256392-37256414 AATAGCACTTTAAGAACAAAGGG + Intronic
1158867386 18:61650838-61650860 CACTGTACTTTGAAAAGAAAAGG + Intergenic
1160366405 18:78329605-78329627 AGCATTACTTTGAGAAGAAATGG + Intergenic
1163592014 19:18199110-18199132 TCCAGTACTTTGAGAAGCGAAGG - Intronic
1164579338 19:29424862-29424884 TCCAGAACTGTGAGAAAAAAAGG - Intergenic
1167010782 19:46806015-46806037 TACAGCAATCTGGGAACAAAAGG - Intergenic
1168599386 19:57705897-57705919 GCAAGCACTTTGAGAACAAAAGG + Intronic
924981748 2:228991-229013 TAGAGGACTTTCAGAACAAGAGG - Intronic
925403080 2:3589776-3589798 TACAAAACTTTTAGAAAAAATGG - Intergenic
929340303 2:40807674-40807696 TATAGTATTGTGTGAACAAAGGG - Intergenic
930844086 2:55882398-55882420 TACACTGCTTTGAGAAAATATGG - Intronic
934539445 2:95161838-95161860 AACAGTGCTTTGAGATCAAATGG - Intronic
936599113 2:113878120-113878142 TACGGTACTTTGACTTCAAAGGG + Intergenic
936921789 2:117696425-117696447 GGCAGTTCTTTGAGAACACAGGG + Intergenic
937195040 2:120146647-120146669 TACATTACTGTGAGAACCCATGG - Intronic
938652086 2:133393749-133393771 AACATGACTTAGAGAACAAAAGG - Intronic
938682336 2:133704330-133704352 CACAGTACTTTGACATCACAGGG + Intergenic
938937608 2:136140845-136140867 TAAAGTATTATGAAAACAAAAGG - Intergenic
941136823 2:161727838-161727860 TAAAATATTATGAGAACAAAAGG + Intronic
942251622 2:174052211-174052233 GACTGAACTTTGAAAACAAAGGG + Intergenic
942316399 2:174700229-174700251 TACCGTAGTTTGAGAAGAAATGG - Intergenic
942331107 2:174825150-174825172 TACAGTACTATGACATGAAAAGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
944179506 2:196873758-196873780 TACAGTACTTTGAATTCAACAGG - Exonic
944490748 2:200255497-200255519 TGAAGCACTTTGAGACCAAAAGG + Intergenic
944506404 2:200416960-200416982 TACTGCTCTTTGAGAACAAAGGG + Intronic
945949858 2:216028668-216028690 TAGAGTACAGTGAGAAAAAATGG - Intronic
1171119083 20:22552696-22552718 AACAGTAGTTTGAGATCAAATGG + Intergenic
1173171935 20:40733466-40733488 TACAGAATTTTGAGAGGAAAAGG - Intergenic
1173299736 20:41791446-41791468 TTCAGTGCTATGAAAACAAAGGG + Intergenic
1178811775 21:35890218-35890240 TACAATAATATGACAACAAAAGG + Intronic
1178871678 21:36382481-36382503 TACAGGAGATTGAGAACAACGGG - Intronic
1180570645 22:16714919-16714941 TACAGTAGTTGTACAACAAATGG - Intergenic
1182157645 22:28090560-28090582 TAAAGAATTTTGAGACCAAAGGG + Intronic
1182267581 22:29130130-29130152 CACAGTACTGTGAGAATTAAGGG - Intronic
1182966246 22:34523928-34523950 GACAGTGCTTTGAGAGAAAAGGG - Intergenic
1183771837 22:39933343-39933365 TGGAGTGCTTAGAGAACAAAGGG + Intronic
949164055 3:915750-915772 TGGATTGCTTTGAGAACAAAAGG - Intergenic
949368925 3:3313612-3313634 TAAAGCACTTGGAGGACAAAGGG + Intergenic
949389720 3:3545401-3545423 CACAGTACTTTTATAATAAAAGG + Intergenic
951594100 3:24298464-24298486 AATAGTATTTTGAGGACAAATGG + Intronic
952196466 3:31080823-31080845 TCCAGTAGTTTCATAACAAAGGG + Intergenic
952642083 3:35609567-35609589 TGCAGAACTTTGAGAGCCAAAGG - Intergenic
954929918 3:54272482-54272504 TACACTGCTTGGAGAACAGAAGG + Intronic
955304572 3:57816965-57816987 GATAGTACTTTGAGAAAAAGAGG + Intronic
957107921 3:75914771-75914793 TACAGTAGTTGTACAACAAATGG + Intronic
957190413 3:77001170-77001192 TACCGTACTTTGAGGAAAATAGG + Intronic
957720653 3:83993935-83993957 AACAGTATTTTCAGGACAAATGG + Intergenic
958832752 3:99109663-99109685 TACAGAAATTTGAGAATAATTGG + Intergenic
959429367 3:106233779-106233801 TACAGTACTTTTAAAACAGAAGG + Intergenic
964167094 3:153721434-153721456 TACATGCATTTGAGAACAAATGG - Intergenic
964483018 3:157160658-157160680 TACAGTATTTGAAGAACACAGGG + Intronic
964964621 3:162476539-162476561 TGCAGTAGTTTCAGAAGAAATGG - Intergenic
965365317 3:167791594-167791616 TAAAGGAGTTTGAAAACAAATGG - Intronic
968028496 3:195463206-195463228 TACAGCACTTTGAGAAGCCAAGG + Intergenic
969585898 4:8092411-8092433 TACAGTTCTCTGGAAACAAAAGG - Intronic
970645587 4:18116914-18116936 TGAAGGACTTTGAGAACTAAAGG + Intergenic
970700806 4:18735814-18735836 CACAGAACTTCTAGAACAAATGG - Intergenic
970947168 4:21708295-21708317 CATTGTACTTTGAGAAAAAATGG - Intronic
971204511 4:24550859-24550881 TATAGTACTTTTAAAACAACTGG + Intronic
971542537 4:27837928-27837950 TACACTCCTCTGATAACAAAAGG + Intergenic
972881833 4:43433865-43433887 TGCAGTACTTCGAGAAAAAATGG + Intergenic
974080539 4:57207873-57207895 AGCTGTAGTTTGAGAACAAAGGG + Intergenic
975336362 4:73181092-73181114 TAGTGTATTTGGAGAACAAAGGG + Intronic
976156616 4:82152124-82152146 TATAGTCCTTTGAGAATTAAAGG + Intergenic
976349218 4:84041815-84041837 TACAGTCCTGTGATAACCAATGG + Intergenic
976616979 4:87088062-87088084 TACAATACTTTGAAAATAAGTGG + Intronic
977166628 4:93707255-93707277 TGGAGTACTTTGAGAAAAATTGG + Intronic
977201739 4:94124250-94124272 TCCAGGTCTTTGAGTACAAAAGG - Intergenic
978024631 4:103857771-103857793 TACGGTATTTTTAGTACAAAAGG - Intergenic
979011015 4:115368477-115368499 TACTGTGCTTGGAGACCAAAGGG + Intergenic
979084845 4:116395214-116395236 TATAGTAATTTGAGAAAAACTGG - Intergenic
979590977 4:122480079-122480101 TTCAGTCCTTTGACATCAAAAGG + Intergenic
980401932 4:132300635-132300657 TACAGTAATTTGTAAAAAAATGG + Intergenic
980535448 4:134114885-134114907 TACAATTCTTTGATAACAAAAGG - Intergenic
980609805 4:135144565-135144587 TACTGTACTTAGAAAATAAAAGG - Intergenic
980613352 4:135185835-135185857 TACAGCTCTCTGGGAACAAAAGG - Intergenic
981034344 4:140153886-140153908 CAAAGTACTTTGAGAACACGGGG - Exonic
981385373 4:144124083-144124105 TATAGCAGTGTGAGAACAAATGG + Intronic
982478603 4:155881553-155881575 TTCAGTCTTTTGAAAACAAAAGG + Intronic
983062950 4:163178781-163178803 TTCACATCTTTGAGAACAAAGGG + Intergenic
984958993 4:185075794-185075816 TAAAGTCCATTAAGAACAAATGG - Intergenic
987208210 5:15649849-15649871 TGCATTACTTTGACACCAAATGG + Intronic
990090854 5:52046360-52046382 TACTGTGCTTCGAGACCAAAAGG + Intronic
990894126 5:60678994-60679016 TACAGAACTTTTAGAAAAACAGG - Intronic
992487835 5:77212112-77212134 AACGGTACTTTGAGAACATACGG - Intronic
993686072 5:90939578-90939600 TAAAGTACTATGAAAGCAAATGG + Intronic
995877001 5:116800847-116800869 TACATTACTTTTAAAACCAATGG + Intergenic
996789859 5:127281254-127281276 TCCAGTACTTTAAGCAGAAAAGG - Intergenic
996958965 5:129220698-129220720 TATATTACTTTGGGAACCAAAGG + Intergenic
998219024 5:140260832-140260854 TGCAGCATTTTGAGAATAAAAGG - Intronic
998983793 5:147732897-147732919 TACAATGCTTTGAGATCAAATGG - Intronic
999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG + Intergenic
999649535 5:153751808-153751830 TACACTATTTTGTTAACAAAAGG + Intronic
1000165368 5:158643064-158643086 TTCACTCCTATGAGAACAAAAGG - Intergenic
1001882911 5:175260064-175260086 TAAAGTACATTGAGAAAGAAAGG + Intergenic
1006090932 6:31628438-31628460 TACAGTACTCTGCCAAGAAATGG - Intronic
1006759261 6:36444695-36444717 TACAGTGCTTTGAGGAAAATAGG - Intronic
1008428190 6:51383503-51383525 TACCATACTTTGAGAACCAATGG - Intergenic
1010108527 6:72196541-72196563 CACAGTACTTTTAGGGCAAACGG - Intronic
1014277828 6:119406341-119406363 TACAGCTGTTTGGGAACAAAAGG - Intergenic
1015711313 6:136143832-136143854 TACACTACTTGGAAAACTAAAGG + Intronic
1016579019 6:145607270-145607292 TACAGTCATTTGAGTCCAAATGG - Intronic
1017853052 6:158322536-158322558 TATATTACTTTAAGTACAAAGGG - Intronic
1017881960 6:158568273-158568295 TACAGTACTTCAAGGTCAAAAGG - Intronic
1018068413 6:160140044-160140066 CACAGTACTTTGAGAAGCCAAGG + Intronic
1018651960 6:165999525-165999547 TACTGTTCTGTGAGAACAAGAGG - Intergenic
1020147624 7:5656663-5656685 TAATGTATTTTGAGGACAAAAGG - Intronic
1020854399 7:13398979-13399001 TTCAGTTCTTTGAGGACACAAGG + Intergenic
1020971010 7:14938970-14938992 CACATTACTATGAGAATAAAAGG + Intronic
1021541292 7:21761665-21761687 GACAGTTCTTTGACAACAACTGG + Intronic
1022048267 7:26640647-26640669 AACAGTACTTAGGGAACAACTGG - Intronic
1023289874 7:38657707-38657729 TCCAGTACTTTGGGAGCAGAAGG - Intergenic
1023423436 7:40008947-40008969 AACAGTACTATGCCAACAAAGGG - Intronic
1023549455 7:41353766-41353788 AAAAGTATTTTGAGATCAAATGG + Intergenic
1023604544 7:41917423-41917445 TAAAGTACATTGAAATCAAAGGG + Intergenic
1024369718 7:48567245-48567267 TACAGCACTCTGCGAACACAGGG - Intronic
1024375014 7:48627592-48627614 TATAGTATTTTGAAAAGAAATGG + Intronic
1027191981 7:76001888-76001910 TCCAGTACTTTGAGAAGCCAAGG - Intronic
1027288879 7:76680163-76680185 TACAGTAATTGGAAAACAAGTGG - Intergenic
1028409512 7:90513410-90513432 TACAGTAATTTGAGATCATAAGG + Intronic
1029048437 7:97656961-97656983 CACAGTACCTTGTGTACAAAAGG + Intergenic
1030487124 7:110183541-110183563 TTCAGTAATATGAAAACAAATGG + Intergenic
1031052200 7:116955170-116955192 TATAGAACTTTGAGACCAGAAGG - Intronic
1031687259 7:124746737-124746759 CACAGGACTTAAAGAACAAAAGG + Exonic
1032555794 7:132833680-132833702 TAAAATACTTTGAGAATTAATGG - Intronic
1032781143 7:135166228-135166250 GACAGTACTTTGCAAAGAAAAGG - Exonic
1033117070 7:138634788-138634810 TACAGTTTTTTGAGAAGACAGGG - Intronic
1036001007 8:4604839-4604861 TATAGTACTCTGATAGCAAAAGG + Intronic
1037077451 8:14738382-14738404 AAAAGTAATTTGATAACAAATGG - Intronic
1037193710 8:16160274-16160296 TACAGAATGTTGAGAACTAATGG + Intronic
1037487824 8:19364899-19364921 TACAGTTTTTCCAGAACAAATGG - Intronic
1037488172 8:19369389-19369411 TGCAGTAGTTTGAGAAGAATTGG + Intronic
1038217060 8:25572054-25572076 TACATTATTTGGAGCACAAAAGG + Intergenic
1038836482 8:31130444-31130466 TTAAGTAGGTTGAGAACAAAAGG - Intronic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1039722286 8:40177016-40177038 TACAGCTATTTGGGAACAAAAGG + Intergenic
1040598638 8:48863549-48863571 TTCAGTTTTTTAAGAACAAATGG + Intergenic
1040715412 8:50245935-50245957 TACCCTAATTTGAGGACAAAAGG - Intronic
1041179647 8:55234267-55234289 TGCACTACTTTAAGTACAAAAGG - Intronic
1041874425 8:62671587-62671609 TATACTACTTGGAAAACAAAGGG - Intronic
1042632324 8:70831735-70831757 TACACTGTTTTGAGAATAAAAGG - Intergenic
1044355079 8:91212977-91212999 TCCAGCAGTTTGAGAACAAAAGG - Intronic
1045983137 8:108215858-108215880 TAAAGTACCTTTAGAGCAAATGG - Intronic
1047644355 8:126854135-126854157 CAAATTACTTTGAGAATAAAAGG - Intergenic
1048558794 8:135510211-135510233 TACAGTACTTTGAGAGGCTAAGG - Intronic
1050399421 9:5235453-5235475 GATTGTTCTTTGAGAACAAAGGG + Intergenic
1051731991 9:20153548-20153570 TACAGTATTTTGAAAATGAAGGG + Intergenic
1052222013 9:26036088-26036110 CATAGCACTTTGAGAAGAAATGG - Intergenic
1052398949 9:27976420-27976442 TATAGTTTTTTGAGACCAAATGG + Intronic
1053753996 9:41284651-41284673 TACAGCTGTTTGGGAACAAAAGG - Intergenic
1054259514 9:62849013-62849035 TACAGCTGTTTGGGAACAAAAGG - Intergenic
1054332258 9:63771024-63771046 TACAGCTGTTTGGGAACAAAAGG + Intergenic
1057664612 9:97035262-97035284 TAAAAAACTTTGAGAAAAAAAGG + Intronic
1058591400 9:106569061-106569083 TGCAGTAGTTTTAGAAGAAATGG - Intergenic
1058649759 9:107164347-107164369 TGTCCTACTTTGAGAACAAATGG + Intergenic
1059290182 9:113216371-113216393 TAGACTACTTTGAGAAAAGAAGG - Intronic
1185782331 X:2860155-2860177 TACAGTATTTAGACAAAAAAGGG - Intronic
1189294119 X:39906965-39906987 AACAGATCTTTGAGAACGAAGGG - Intergenic
1190145658 X:47889607-47889629 TATAGCAATGTGAGAACAAACGG - Intronic
1190929037 X:54933107-54933129 GTCAGTACCTTGAGAACAACTGG + Exonic
1192625981 X:72729369-72729391 TACACTACATTGAGAATAAAGGG - Intergenic
1192948398 X:75990041-75990063 TACAGTATAGTGAGAACAGAGGG - Intergenic
1193730328 X:85095319-85095341 TTCAGTATTTTGAGGACAAGAGG - Intronic
1194263522 X:91728118-91728140 TACAATAGTTTCAGAAGAAATGG + Intergenic
1194395446 X:93378591-93378613 TAAACAACTTTTAGAACAAATGG + Intergenic
1195309395 X:103616058-103616080 TACAGCTATTTGGGAACAAATGG - Intronic
1198695551 X:139333039-139333061 AACAGTCTTTTGACAACAAAAGG - Intergenic
1199087555 X:143645797-143645819 TGGAGTTCTTGGAGAACAAAAGG - Intergenic
1199333734 X:146593725-146593747 TACAGGATATTGAAAACAAATGG - Intergenic
1200017406 X:153177964-153177986 CATATTACTTTGAGGACAAAAGG + Intergenic
1201773668 Y:17642427-17642449 TACAGTAGTTTCAGAAAACAGGG + Intergenic
1201827888 Y:18263558-18263580 TACAGTAGTTTCAGAAAACAGGG - Intergenic
1202258476 Y:22944453-22944475 TGTAGTACTCTGAGAACAAGTGG + Intergenic
1202379656 Y:24264471-24264493 TACGGTACTATGAAAACATAAGG + Intergenic
1202383491 Y:24300029-24300051 CACAGCAGTTTGAGATCAAACGG - Intergenic
1202411465 Y:24578211-24578233 TGTAGTACTCTGAGAACAAGTGG + Intergenic
1202459317 Y:25091861-25091883 TGTAGTACTCTGAGAACAAGTGG - Intergenic
1202487293 Y:25370092-25370114 CACAGCAGTTTGAGATCAAACGG + Intergenic
1202491126 Y:25405650-25405672 TACGGTACTATGAAAACATAAGG - Intergenic