ID: 1118251701

View in Genome Browser
Species Human (GRCh38)
Location 14:64168096-64168118
Sequence GCAGATCCTGCTTTTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118251695_1118251701 27 Left 1118251695 14:64168046-64168068 CCTCAGTGCTTATGCTGACATGT 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1118251701 14:64168096-64168118 GCAGATCCTGCTTTTTTTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 219
1118251699_1118251701 -9 Left 1118251699 14:64168082-64168104 CCTGGTGGTTATAGGCAGATCCT 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1118251701 14:64168096-64168118 GCAGATCCTGCTTTTTTTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118251701 Original CRISPR GCAGATCCTGCTTTTTTTGG TGG Intronic
900297903 1:1961404-1961426 CCAGGTGCTGGTTTTTTTGGAGG - Intronic
900399798 1:2468213-2468235 GCAGCTGCTGCTTTCTCTGGGGG + Intronic
900464246 1:2816724-2816746 GCAGAAGCAGGTTTTTTTGGGGG + Intergenic
902889941 1:19435456-19435478 GCAGAGCCTGCTTTAGGTGGTGG - Intronic
903658638 1:24963861-24963883 GCAGCTTTTGCCTTTTTTGGTGG - Intronic
904821163 1:33245459-33245481 GCATATCTCTCTTTTTTTGGTGG - Intergenic
908224422 1:62041500-62041522 GCAGATCCTTGATGTTTTGGAGG + Intronic
910944708 1:92577694-92577716 GCAGATCCTCCCTTTGTTAGAGG - Intronic
911553860 1:99318338-99318360 GCAGATCCTATTTTTTTTGGTGG + Intergenic
912726817 1:112066021-112066043 GGAGATCTTGCTTTGTGTGGTGG + Intergenic
915376356 1:155399651-155399673 TCACATTCTGTTTTTTTTGGGGG - Intronic
916035222 1:160916093-160916115 ACAGATCCTCTTTTTTTTGTTGG + Intergenic
917207000 1:172586148-172586170 TCAGATCAAACTTTTTTTGGGGG + Intronic
917302778 1:173594704-173594726 GAAGTTCCTGCCTTATTTGGAGG + Intronic
917953450 1:180065757-180065779 GCAGATACTTTTTTTTTGGGGGG - Intronic
918487977 1:185049213-185049235 TGAGATCCTGATTTTTTTTGAGG - Intronic
918958506 1:191239884-191239906 GCAGATCATGGTTTTTTTCCAGG - Intergenic
919081523 1:192872092-192872114 CCAGCTCCTGCTTTATTTTGAGG - Intergenic
920202448 1:204267893-204267915 GCAGGTCCTGCTTATTATGGTGG - Intronic
921314305 1:213875884-213875906 TCAGATCTTGCTTCTTTAGGGGG - Intergenic
923770909 1:236936834-236936856 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
923797426 1:237171345-237171367 ACAGATACTGATGTTTTTGGAGG + Intronic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1070429949 10:76327726-76327748 GGAGACCCTGCTTCCTTTGGGGG + Intronic
1070442654 10:76462134-76462156 TCACATTCTGGTTTTTTTGGTGG - Intronic
1071033801 10:81217609-81217631 ACAGATATTACTTTTTTTGGAGG + Intergenic
1072483238 10:95829574-95829596 GCACCTCCTGATTTTTGTGGAGG + Intronic
1074484273 10:113857708-113857730 ACAGAGCTTTCTTTTTTTGGAGG + Intronic
1079612610 11:22451904-22451926 TAAGAACCTCCTTTTTTTGGCGG - Intergenic
1079844019 11:25441287-25441309 TCAGATCCTGCTTTTTTGACTGG + Intergenic
1081285957 11:41270501-41270523 GCAGACCCTGCCTTTTTAAGTGG - Intronic
1081776661 11:45680397-45680419 GCAGACCCTGGTTTTTTCGCTGG + Intergenic
1083798316 11:65031529-65031551 GCAGAACCTCCCTTCTTTGGAGG + Intronic
1084290265 11:68160704-68160726 GCAGAGCCTTCTATTCTTGGTGG - Intronic
1085853098 11:80144122-80144144 GCAGATCATGCTCCTTTTGGTGG - Intergenic
1085981230 11:81728911-81728933 GCATATCCTACTTTGTTTGGTGG + Intergenic
1087409292 11:97770523-97770545 ACACATCCTTCCTTTTTTGGGGG + Intergenic
1089915195 11:122147930-122147952 GGTGAAACTGCTTTTTTTGGGGG + Intergenic
1090091453 11:123701997-123702019 GCAAATACTGCTCTTTTTAGGGG + Intergenic
1091066072 11:132514493-132514515 GCAGAGTCTGCTTTTCTTTGTGG + Intronic
1093414998 12:18909521-18909543 GCAGAGCCGGTTTCTTTTGGAGG + Intergenic
1096917510 12:55049021-55049043 GGTGAACCTGCTTTTCTTGGTGG + Intergenic
1098278974 12:68843811-68843833 GCAGAATCTCTTTTTTTTGGAGG + Exonic
1101264404 12:103068046-103068068 GCAGGTCATGCTTTTTTTGCTGG - Intergenic
1103910968 12:124351986-124352008 GCAGATCCTGGTCTTTGCGGAGG + Intronic
1106431139 13:29681676-29681698 GCAGAGCCTGCTTTTCTTTTCGG + Intergenic
1107192423 13:37605607-37605629 GCATATTCTGCTTTGTTTGCTGG - Intergenic
1108514693 13:51189357-51189379 GCATATCATCCTTTTTTTCGGGG + Intergenic
1110133342 13:72034996-72035018 GCAAATCCACCTTTTTTTGTAGG + Intergenic
1110523207 13:76505292-76505314 GCAGATCCTGCAGGTGTTGGAGG - Intergenic
1110705562 13:78600119-78600141 GAAGTTCCTGCTTTCTTTTGCGG - Exonic
1111839930 13:93436873-93436895 ACAGATAGTGCTTTTTTGGGGGG + Intronic
1112190603 13:97173728-97173750 ACATATCCTGCTGTTTGTGGGGG - Intergenic
1112679984 13:101753082-101753104 ACAGAACCTGCTTTTATTAGGGG - Intronic
1113818671 13:113194645-113194667 GGAGATCCTGGGTTTTATGGAGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1115223598 14:31081451-31081473 GCAAATCGTGCTTGTTTTGAGGG - Intronic
1117288684 14:54311539-54311561 GCTGCTGCTGCTTTTTTTTGAGG - Intergenic
1118251701 14:64168096-64168118 GCAGATCCTGCTTTTTTTGGTGG + Intronic
1119420712 14:74506267-74506289 GCCTAGCCTGCTTCTTTTGGGGG - Intronic
1120481546 14:85055171-85055193 ACACATCCTTCTTTTTATGGTGG + Intergenic
1121345235 14:93130633-93130655 GCAGCTCTTGTTTATTTTGGGGG - Intergenic
1125517531 15:40330836-40330858 ACAGTTCCTTCTTGTTTTGGGGG + Intergenic
1127281467 15:57497074-57497096 CCACATCCTGCTGTGTTTGGCGG + Intronic
1133640069 16:7708176-7708198 GCAGATCTTGATTTTTTATGAGG - Intronic
1137365936 16:47859485-47859507 GCAGATCCTGCTGCTTCTGGAGG - Intergenic
1138557025 16:57776804-57776826 GCAGCTCCTGCCTTTGGTGGAGG - Intronic
1140218676 16:73028117-73028139 GCGGCTTCTCCTTTTTTTGGGGG + Intronic
1144295140 17:13867663-13867685 GCAGATCCAGTGTTTCTTGGTGG - Intergenic
1145235607 17:21206030-21206052 TGAGTCCCTGCTTTTTTTGGGGG + Intronic
1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1148460770 17:47837963-47837985 CCAGATCCTGCTGTTTCTGCTGG + Exonic
1148920951 17:51033143-51033165 GCACGTCATACTTTTTTTGGTGG + Intronic
1148940775 17:51209349-51209371 GCAGATCTTCCTTGTTTGGGAGG - Intronic
1149200435 17:54179437-54179459 GCAGAATATGCTTTCTTTGGTGG + Intergenic
1150536414 17:66046918-66046940 GCAGAACCTGCTTTTCTTGAAGG - Intronic
1151469254 17:74307797-74307819 CCAGATGTTTCTTTTTTTGGGGG + Intronic
1153694251 18:7624483-7624505 TCAGATTCTGCTTTTTTTTTTGG + Intronic
1154034231 18:10783642-10783664 GCAGAGCCTGATTTTCCTGGTGG + Intronic
1155213930 18:23625821-23625843 GCAGACCCAGATTTTTTGGGTGG - Intronic
1155679882 18:28475836-28475858 GCAGTTCCTGCTTTTTGCTGTGG - Intergenic
1156629631 18:38951492-38951514 GCACATTCTGCCTTTTTAGGAGG - Intergenic
1157686913 18:49650302-49650324 GCACCTCCTACTTTTTTTGGAGG - Intergenic
1158305244 18:56098004-56098026 GCAGATGCTGCTGTTCTTGCTGG + Intergenic
1158315019 18:56202645-56202667 GCTAATCCTGATTTTTTTTGTGG - Intergenic
1160567592 18:79796999-79797021 GCAGAGGCTGCTTTTTGGGGGGG - Intergenic
1161077925 19:2295381-2295403 GCAGGTCCAGCTTCCTTTGGGGG - Intronic
1163710558 19:18844275-18844297 GGAGGAGCTGCTTTTTTTGGGGG + Intronic
1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG + Intergenic
1166397326 19:42451201-42451223 GCAGATTCTGATTCTTCTGGTGG + Intergenic
925197365 2:1937167-1937189 GCAGGGGCTGCTTTTGTTGGAGG - Intronic
926539016 2:14151774-14151796 GTAGATCTTTCTTTTTTGGGGGG + Intergenic
927608219 2:24508526-24508548 GCTGATACTGTCTTTTTTGGGGG + Intronic
927874618 2:26647253-26647275 GCAGATCCTGATTTCTATGGGGG + Intergenic
928759599 2:34566513-34566535 GCAAATCTTGCTATATTTGGAGG - Intergenic
928957835 2:36889600-36889622 GCATATTCTTCTTTTTTTTGGGG + Intronic
933536387 2:83580293-83580315 GCAGAGTTTGCTTATTTTGGAGG - Intergenic
936585136 2:113750757-113750779 GCTGTTGCTGCTTTGTTTGGTGG - Intronic
937325355 2:120986854-120986876 GCAGGGTCTGCTTGTTTTGGGGG - Intronic
937371921 2:121304228-121304250 TCAAATCCTGATTTTGTTGGGGG + Intergenic
939877601 2:147595524-147595546 TTACATCCTGCTGTTTTTGGAGG + Intergenic
941920786 2:170848838-170848860 GCAGTTCCTGCTGGGTTTGGAGG - Intronic
942306207 2:174609957-174609979 GCAGATCCTGCTTTTCTCAGTGG + Intronic
942424655 2:175846954-175846976 GCAGATTCTGCCATGTTTGGTGG + Intergenic
943384523 2:187184901-187184923 GCTGATCCTGGGTTTTTTGGGGG + Intergenic
944158947 2:196639117-196639139 GCTGTCCCTGGTTTTTTTGGTGG - Intergenic
945545106 2:211140035-211140057 GCAGATCGTGGTTTTTTTCCTGG - Intergenic
1169342999 20:4810420-4810442 GGGGATTCTGCTGTTTTTGGTGG - Intronic
1170069063 20:12344972-12344994 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1170736297 20:19016519-19016541 TCAGATTCTGCTTTTTATTGGGG + Intergenic
1171010206 20:21505536-21505558 GCAGGCCCTACTTTTGTTGGGGG + Intergenic
1171445777 20:25203895-25203917 GCAGATCCTGCTATTTGGTGGGG - Intronic
1172013469 20:31859937-31859959 GCAGCTCCTTCTGTTTTTGGAGG + Intronic
1173443030 20:43095033-43095055 ACTGGTCCTGCTCTTTTTGGTGG - Intronic
1175739077 20:61408018-61408040 GCAGGTCCTGCTTTTCCTGCAGG + Intronic
1178372108 21:32034915-32034937 ACAGAAACTGCCTTTTTTGGGGG + Intronic
1178943234 21:36925067-36925089 ACAAAACCTGCTTTTTATGGGGG + Intronic
1180351972 22:11813298-11813320 CCACATTCTGCGTTTTTTGGGGG - Intergenic
1180386238 22:12178772-12178794 CCACATTCTGCGTTTTTTGGGGG + Intergenic
1181687114 22:24537024-24537046 GCAGGGCCTTCTTTTTTTGGTGG + Intergenic
1183968746 22:41459914-41459936 GCATTTCCCGTTTTTTTTGGGGG - Exonic
952663653 3:35879065-35879087 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
953450479 3:43001279-43001301 CCAGCTGCTGCTTTTCTTGGTGG + Intronic
953569408 3:44059164-44059186 GCAGAGCCTGCTGCTTTTTGAGG + Intergenic
958581294 3:96027363-96027385 GAAGCATCTGCTTTTTTTGGAGG + Intergenic
960218183 3:115069120-115069142 TTAGAAACTGCTTTTTTTGGAGG - Intronic
961415409 3:126753126-126753148 GCAGATTCTGACTTTCTTGGGGG + Intronic
961458001 3:127033700-127033722 TCAGAGCCTGCTGTTTTAGGGGG + Intronic
963331546 3:143921479-143921501 GCAGGTCCTGTTTTTTTTCCTGG + Intergenic
963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
966278956 3:178208043-178208065 GCAAGTACTGCTTTTTTGGGGGG + Intergenic
967740284 3:192996636-192996658 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
968269797 3:197394636-197394658 GCAGAATCTGCTTTCTTTGGTGG - Intergenic
969538395 4:7770575-7770597 GCAGAACCTTCTTTTTTTTAAGG + Intronic
969880377 4:10168355-10168377 GCAGCTCCTGCTATTGTTTGTGG + Intergenic
969881061 4:10174404-10174426 GCAGCTCCTGCTATTGTTAGTGG + Intergenic
970087369 4:12364781-12364803 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
970375446 4:15452435-15452457 CCAGATCCTTCTTTTTTTAAGGG + Intergenic
971058641 4:22941781-22941803 GCAGATCCTGCAATGTCTGGTGG - Intergenic
972192705 4:36613684-36613706 GCAGATCATGTTTTTTTTCCTGG - Intergenic
972824650 4:42743697-42743719 ACAGATCCTGCTATTTTAGTAGG + Intergenic
973379890 4:49312815-49312837 CCACATTCTGCGTTTTTTGGGGG + Intergenic
973656330 4:53051749-53051771 TCAGAGCCTTCTTTTATTGGTGG - Intronic
974687121 4:65244396-65244418 GCAGATCCTGATTTTGTAGTGGG - Intergenic
974725256 4:65790334-65790356 GCACTTCCTGCTTAGTTTGGAGG + Intergenic
975383824 4:73732176-73732198 GCACTTCCTTCTTTTCTTGGGGG + Intergenic
975934105 4:79558732-79558754 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
976231642 4:82850028-82850050 GTAGACCCTGCCTTTTTTGGTGG - Intronic
976628843 4:87217323-87217345 TCATCTCTTGCTTTTTTTGGGGG + Intronic
977041855 4:92027006-92027028 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
977217308 4:94297736-94297758 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
978302239 4:107283632-107283654 GGAGATCCTGCGTTTGGTGGTGG - Intronic
978733517 4:112058910-112058932 GCAGAACCTGGGTTTTTTGTTGG - Intergenic
979895353 4:126149807-126149829 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
981468389 4:145099930-145099952 GCAAATCCTTCTTTGTTTGCAGG + Intronic
983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG + Intergenic
985775488 5:1839403-1839425 TCAGATCATGCTTTTTCTGTCGG - Intergenic
986448921 5:7847869-7847891 GCAGATTCTGCTCTTTTTCCTGG + Intronic
986888817 5:12274994-12275016 GCACATCCAGCTTTTTTTACTGG + Intergenic
987855921 5:23420785-23420807 GCAGAACATGCTTTCTTTGAAGG - Intergenic
988391314 5:30636417-30636439 GCAGTTCTAACTTTTTTTGGTGG + Intergenic
988520519 5:31941213-31941235 GCAGATCCTCCTCTTGCTGGTGG - Intronic
988625867 5:32873803-32873825 TCACATCTTGGTTTTTTTGGGGG + Intergenic
990699127 5:58456980-58457002 GCAGCTGCTGCTCTTTTTGGTGG - Exonic
991317710 5:65328349-65328371 TTATATTCTGCTTTTTTTGGTGG - Intronic
991946415 5:71902043-71902065 GCAGATCATGGTTTTTTTCTTGG - Intergenic
992699261 5:79324237-79324259 GAAGATCCTGATTTTATTAGAGG - Exonic
993792040 5:92220823-92220845 GCAGATCATGGTTTTTTTCCTGG - Intergenic
997212814 5:132087495-132087517 GCAGATCCCGATTCTCTTGGAGG + Intergenic
999005675 5:147974804-147974826 GCAGATTCTGCTTAATTTGAGGG - Intergenic
999960705 5:156753043-156753065 GCTGATGCTGCTTGTTTCGGCGG - Intronic
1000154045 5:158533384-158533406 CCAAATCCTGCTCTTTATGGAGG - Intergenic
1003430357 6:6032468-6032490 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1006956943 6:37882308-37882330 TCAGATTCTGTTTATTTTGGGGG + Intronic
1007081790 6:39110846-39110868 GCAGATTATGCTATTTCTGGTGG + Intronic
1007509910 6:42366951-42366973 GCAGATCCTGATTTCTTATGGGG - Intronic
1007983504 6:46183787-46183809 GTTGGTCCTGCTTATTTTGGGGG - Intergenic
1008716014 6:54290610-54290632 GCAGATTCTGTTGTTTTGGGGGG + Intergenic
1010741903 6:79516847-79516869 ACATATCTTGATTTTTTTGGTGG - Intronic
1011031968 6:82933061-82933083 GCAGATTTGGGTTTTTTTGGGGG + Intronic
1011669649 6:89670804-89670826 TCACATCCTGCTATTTGTGGTGG + Intronic
1012509838 6:99990952-99990974 GCATCTCCTGCTTTATTTGGAGG + Intronic
1013627023 6:111948803-111948825 TCAAATCCTGGTTTTCTTGGGGG + Intergenic
1015142547 6:129951566-129951588 GCAGTCCCTGCTTATTTAGGGGG + Intergenic
1016133987 6:140515430-140515452 GCATGTGCTGGTTTTTTTGGAGG - Intergenic
1016387339 6:143541500-143541522 ACCTATACTGCTTTTTTTGGAGG - Intronic
1016881384 6:148915526-148915548 ACATTTCCTGCTTTTTTTGAAGG - Intronic
1018999735 6:168739669-168739691 GCTGCTGCTTCTTTTTTTGGTGG - Intergenic
1021978047 7:26028707-26028729 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1027735790 7:81931514-81931536 GCAGTTCCTTCTAGTTTTGGAGG + Intergenic
1030638493 7:111977295-111977317 GCTGATCATGTTTTTGTTGGGGG - Intronic
1033018543 7:137697753-137697775 AAAGATTCTGCTTTTATTGGAGG + Intronic
1036173067 8:6509011-6509033 GCTGATGCTGCTTATTTTGCCGG + Exonic
1037435187 8:18855120-18855142 GGGGATCCTGCTATTTTTGTTGG + Intronic
1038621112 8:29143907-29143929 TCAGAGCATACTTTTTTTGGGGG - Intronic
1039024104 8:33239011-33239033 GAAGATCTTGCCTTTCTTGGTGG - Intergenic
1040998121 8:53422142-53422164 TCAGATCCTCTTTCTTTTGGGGG - Intergenic
1043689894 8:83137751-83137773 GAAAATCCTGTTTTTTTTTGTGG + Intergenic
1044475242 8:92618149-92618171 GCAGATCCTGGATTCTTTAGGGG + Intergenic
1045084286 8:98664266-98664288 GCTGATCCCCTTTTTTTTGGTGG - Intronic
1047002355 8:120585727-120585749 GCAAATCCTGTTTTTTTTGCTGG + Intronic
1048198654 8:132353244-132353266 TAAAATCCTACTTTTTTTGGCGG - Intronic
1049044914 8:140142043-140142065 GCAGATGATGCTATTCTTGGAGG - Intronic
1049767560 8:144362012-144362034 GCAGCTCCAGCTCTTTTTGTGGG - Intergenic
1050895893 9:10885835-10885857 GCAAGTACTGCTTTTCTTGGGGG + Intergenic
1051252237 9:15172245-15172267 GCAGATTCTGGTTCTGTTGGGGG + Intronic
1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1056782921 9:89564799-89564821 GCAGAGCCAGCTTTGTTTGGAGG + Intergenic
1056960392 9:91117695-91117717 GGAGATCCTGCTCGTTTTGCCGG - Intergenic
1057074461 9:92129692-92129714 GCTATTCCTGCTCTTTTTGGGGG + Intergenic
1057084833 9:92199916-92199938 GCTATTCCTGCTCTTTTTGGGGG - Intergenic
1058396047 9:104555833-104555855 TCAGCATCTGCTTTTTTTGGGGG - Intergenic
1059768865 9:117409287-117409309 GCAGATGGTAATTTTTTTGGAGG - Intronic
1061656919 9:132099077-132099099 GCACAACCAGCTTGTTTTGGTGG + Intergenic
1062343613 9:136104729-136104751 CCAGATGCTGCTTTCTTGGGGGG - Intergenic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1203479939 Un_GL000224v1:3344-3366 CCACATTCTGCGTTTTTTGGGGG - Intergenic
1203481865 Un_GL000224v1:15957-15979 CCACATTCTGCGTTTTTTGGGGG - Intergenic
1203416873 Un_KI270330v1:1271-1293 CCACATTCTGCGTTTTTTGGGGG + Intergenic
1203549981 Un_KI270743v1:158702-158724 CCACATTCTGCGTTTTTTGGGGG + Intergenic
1185948126 X:4401098-4401120 CCAGCTGCTTCTTTTTTTGGGGG - Intergenic
1186628821 X:11325929-11325951 GCAGATCATTCTTTTTTGTGAGG - Intronic
1188122234 X:26321790-26321812 GCTACTCCTGCTTTTTTTGGGGG - Intergenic
1188713140 X:33426949-33426971 TCATATACTGATTTTTTTGGGGG - Intergenic
1189343282 X:40220871-40220893 ACAGATTCTGCCTTGTTTGGAGG - Intergenic
1190606142 X:52144985-52145007 GAATTTCCTTCTTTTTTTGGTGG + Intergenic
1195461145 X:105126053-105126075 GCAGAACATGCTATTTTTGTAGG + Intronic
1196012801 X:110906219-110906241 TCAAATCCTTCTTTTTTGGGAGG + Intergenic
1196288543 X:113912068-113912090 TCATATTCTGCTTTTTTTGTTGG + Intergenic
1196798839 X:119524076-119524098 GAATATCCTGCTTTTTTTCCAGG - Intergenic
1197307898 X:124865836-124865858 GCAAATCCTGCTCTTTTTTTTGG - Intronic
1197352252 X:125393523-125393545 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1198151389 X:133913811-133913833 GGAGAGCCTGCTCTCTTTGGTGG + Intronic
1198801849 X:140456130-140456152 GCAGAGCCCGCCTTTTTTTGTGG + Intergenic
1200930631 Y:8693817-8693839 GCACAGCCTTCTTTTTGTGGAGG - Intergenic
1201366005 Y:13206865-13206887 GCAGATTCTGATGTCTTTGGAGG + Intergenic
1201417582 Y:13762756-13762778 GCAGATTCTTCTTTTTTGAGTGG + Intergenic
1202076751 Y:21044144-21044166 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic