ID: 1118253650

View in Genome Browser
Species Human (GRCh38)
Location 14:64185762-64185784
Sequence CTTTGGAAGCCCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119826
Summary {0: 2, 1: 76, 2: 2604, 3: 29993, 4: 87151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118253650_1118253655 -8 Left 1118253650 14:64185762-64185784 CCGTCCACCTTGGGCTTCCAAAG 0: 2
1: 76
2: 2604
3: 29993
4: 87151
Right 1118253655 14:64185777-64185799 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118253650 Original CRISPR CTTTGGAAGCCCAAGGTGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr