ID: 1118253864

View in Genome Browser
Species Human (GRCh38)
Location 14:64187944-64187966
Sequence ACAGCTGGTCTGCAGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118253864_1118253866 -6 Left 1118253864 14:64187944-64187966 CCTGCTTGCTGCAGACCAGCTGT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1118253866 14:64187961-64187983 AGCTGTTGATGATACTTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 208
1118253864_1118253871 30 Left 1118253864 14:64187944-64187966 CCTGCTTGCTGCAGACCAGCTGT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1118253871 14:64187997-64188019 TCCAGTGCATAACGGGCAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1118253864_1118253869 23 Left 1118253864 14:64187944-64187966 CCTGCTTGCTGCAGACCAGCTGT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1118253869 14:64187990-64188012 TCCAAAATCCAGTGCATAACGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1118253864_1118253868 22 Left 1118253864 14:64187944-64187966 CCTGCTTGCTGCAGACCAGCTGT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1118253868 14:64187989-64188011 ATCCAAAATCCAGTGCATAACGG 0: 1
1: 0
2: 2
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118253864 Original CRISPR ACAGCTGGTCTGCAGCAAGC AGG (reversed) Intronic
902443029 1:16443695-16443717 ACAGATGGCCTACATCAAGCTGG + Exonic
902678791 1:18028664-18028686 CCGGCTGTTCTGCAGCACGCGGG - Intergenic
902825731 1:18972848-18972870 ACAGCTAGTCAGCAGCAAGCAGG + Intergenic
903202588 1:21754640-21754662 GAAGCTGATCTGCAGCAGGCTGG - Intronic
903999674 1:27331877-27331899 GCAGCTGTTCTGCAGGAAGAAGG - Intronic
904207624 1:28865014-28865036 ACAGCTGGGCTGGAGCAGGTGGG - Intergenic
904856112 1:33499440-33499462 ACAGCTGGTTGGCAGGCAGCTGG - Intergenic
905239101 1:36571087-36571109 ACAGCTGGGCTGAGGCAGGCAGG - Intergenic
906240657 1:44240220-44240242 ACAGTTGGGCTGTAGCAAGAAGG - Intronic
906291766 1:44624051-44624073 ACTGCTCACCTGCAGCAAGCTGG + Intronic
907305680 1:53511801-53511823 ACAGCAGGCCTGCAGGAAGGAGG - Intronic
908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG + Intronic
909821106 1:80062220-80062242 ACACCTTGTCTGAAGTAAGCTGG + Intergenic
912589152 1:110797159-110797181 ACATCTGCACTGCAGCAACCTGG + Intergenic
915477485 1:156161402-156161424 CCAGCTGCTCTGCACCCAGCCGG + Exonic
918012762 1:180603160-180603182 AGAGCTGATGTGCAGCAAGTGGG - Intergenic
918188316 1:182147284-182147306 ACAGCTACTCTGCAGGCAGCTGG - Intergenic
918401227 1:184164584-184164606 AGAGCTGGTCTGCAGCCACTGGG + Intergenic
919341009 1:196306578-196306600 CCTACTGCTCTGCAGCAAGCAGG + Intronic
919990338 1:202704855-202704877 ACACCTGCTCTGAAGCAAGGAGG - Intronic
920065204 1:203264387-203264409 GAAGCTGGGCTGCAGCATGCAGG + Intronic
920708906 1:208276353-208276375 ACAACTGGTATGCAGTAAGTTGG - Intergenic
923044875 1:230348409-230348431 ACAGCTGGTCAGCACAGAGCTGG - Intronic
923068414 1:230540875-230540897 GAAGCTGGTCTGCAGAGAGCTGG + Intergenic
1065253611 10:23842207-23842229 AAAACTGGTCTGCAGTAAGAGGG - Intronic
1065500213 10:26373612-26373634 ACAGCTGGTCCGCAGCTGGTGGG + Intergenic
1066540480 10:36441536-36441558 TCAGCTGTTTTGCAGCCAGCAGG - Intergenic
1069815989 10:71194724-71194746 ACAGCTGTCCTGTGGCAAGCTGG + Intergenic
1069902176 10:71712743-71712765 ATAGCTGCTCTGCAGAAAGATGG - Exonic
1070889227 10:79929797-79929819 ACCGCAGGTCTTCAGCATGCTGG + Intergenic
1071305292 10:84294099-84294121 GCATCTGGGGTGCAGCAAGCAGG - Intergenic
1072910278 10:99494847-99494869 AGAGCTGGTATGCAGCATGCCGG - Intergenic
1074390530 10:113053893-113053915 ACAGCTGGGAGGCGGCAAGCTGG + Intronic
1075120557 10:119661444-119661466 ACAGCTGGTGAGCATCAAGGAGG + Intronic
1075590660 10:123688761-123688783 ACAACTGGTCAGCAGCAATTGGG - Exonic
1077293187 11:1809854-1809876 AGAGTTGGTCAGCAGTAAGCAGG + Intergenic
1077296215 11:1827399-1827421 ACAGCTGCCGTGCAGCCAGCAGG - Intergenic
1077552851 11:3209214-3209236 ACAGGTGGTTTACAGGAAGCTGG - Intergenic
1077649042 11:3952956-3952978 ACAGCTAGTCACCACCAAGCAGG - Intronic
1078185476 11:9048442-9048464 ACAGTTGGTTTGCATAAAGCTGG + Intronic
1078548931 11:12267247-12267269 ACATCAGGTGTGGAGCAAGCGGG - Intergenic
1079035910 11:17019963-17019985 AGAGCTGCTCTGGAGCAAGCAGG + Intergenic
1080119678 11:28662770-28662792 TCAGCTGGTATGCAGCAATATGG + Intergenic
1081781426 11:45715819-45715841 AGAGCATGTCTGCAGGAAGCAGG - Intergenic
1082804416 11:57438473-57438495 ACACCTGGGCTGCAGCAAGAAGG + Intergenic
1083022163 11:59518337-59518359 AATGCTGGTCTGCAGAAAGAGGG + Intergenic
1083615172 11:64022512-64022534 ACCGCTGGCCTGCAGGAAGTGGG - Intronic
1084360373 11:68665117-68665139 TTAGCTGGTCTGCAGCACCCAGG - Intergenic
1084594547 11:70109186-70109208 ACAGCAGGTCTGGTGAAAGCTGG + Intronic
1085246452 11:75105493-75105515 CCTGCTGGGCTGCAGCAACCGGG - Intronic
1085776654 11:79372605-79372627 AATGCTGGTCTGCAACAACCAGG + Intronic
1089617975 11:119705907-119705929 ACAGCTTGTCTGCAGGGAGAAGG - Intronic
1089700830 11:120242830-120242852 ACAGGGGCTCTGCAGCAAGGAGG + Intronic
1089842686 11:121431971-121431993 ACTGCTGCTCTGCAGCCAGAAGG + Intergenic
1091279685 11:134374826-134374848 ACAACTCGTCTGCAGCGAGGAGG - Intronic
1094470145 12:30795709-30795731 ACGGCTGCCGTGCAGCAAGCGGG - Intergenic
1096459566 12:51814680-51814702 CCAGCCGGTCTTCAGAAAGCCGG + Intergenic
1096477807 12:51919097-51919119 TCACCGGGTCTGCAGCCAGCCGG - Exonic
1098535502 12:71589972-71589994 ACAGCAGGTCTGTAACAAGTGGG - Intergenic
1098763880 12:74460164-74460186 ACAGCTGGCCATCTGCAAGCTGG + Intergenic
1099219921 12:79901260-79901282 TCACCTGGTCTGGAGAAAGCTGG - Intronic
1099467993 12:83010430-83010452 AGAGCTGGTCAACAGGAAGCAGG - Intronic
1100326595 12:93545301-93545323 GCAGCTGGTTTGCAGCCTGCTGG + Intergenic
1100792544 12:98146505-98146527 AAAGCTGCACTGCAGCAAGCTGG + Intergenic
1102157045 12:110738839-110738861 ACAGATGATCTGCAGCTTGCAGG - Intronic
1102215159 12:111155996-111156018 CCAGCTGGACTGCAGCAACCTGG + Intronic
1105741362 13:23327005-23327027 ATAGCTGGTTTGCAGCAAAATGG + Intergenic
1106172609 13:27301088-27301110 ACAGCTGGTCTCTAGAAAGAAGG + Intergenic
1110253893 13:73410229-73410251 ACAGCTGGGGTGCAGAGAGCAGG - Intergenic
1111117810 13:83803870-83803892 ATTGCTTGCCTGCAGCAAGCAGG + Intergenic
1113929037 13:113956824-113956846 CCAGCTGGTCTGCATCCTGCAGG + Intergenic
1114492607 14:23112874-23112896 ACTGCTGGCCTGCTGCAATCGGG - Intergenic
1118253864 14:64187944-64187966 ACAGCTGGTCTGCAGCAAGCAGG - Intronic
1119637690 14:76290117-76290139 ACAGCAGGTTTCCAGGAAGCAGG + Intergenic
1119853171 14:77880564-77880586 ACAGCTGCTCTGCCTCAAGGTGG - Intronic
1120075219 14:80148837-80148859 ATAGCTGATCTGCAACAAGCTGG - Intergenic
1121225265 14:92317168-92317190 ACACCTGGGCTGCAGCTAACAGG - Intergenic
1121840352 14:97129059-97129081 ACAGCTGAGCTCCAGGAAGCTGG - Intergenic
1122113138 14:99515317-99515339 ACAGGTGGTCTGGAGAAAGCTGG - Exonic
1122609124 14:102969314-102969336 ACTGCTGGGCTGGAGCAGGCAGG + Intronic
1123507965 15:20964385-20964407 ACGGCTGCTCTTCAGCAAGGTGG - Intergenic
1123565183 15:21538127-21538149 ACGGCTGCTCTTCAGCAAGGTGG - Intergenic
1123601446 15:21975414-21975436 ACGGCTGCTCTTCAGCAAGGTGG - Intergenic
1124058107 15:26261040-26261062 GCAGCGGGGCTGCAGAAAGCTGG + Intergenic
1124142518 15:27089283-27089305 ACAGCTCGTCTGCAGGCAACTGG + Intronic
1129156363 15:73720727-73720749 TCCTCTGGTCTGCTGCAAGCAGG + Intergenic
1202973554 15_KI270727v1_random:265233-265255 ACGGCTGCTCTTCAGCAAGGTGG - Intergenic
1132845793 16:2000273-2000295 ACAGCTGGTCAACAGCTATCAGG + Intronic
1134102537 16:11462168-11462190 ACGGCAGGTGGGCAGCAAGCTGG - Exonic
1134531628 16:14988721-14988743 ATAGCTGTTCTGCAGCACGTCGG + Intronic
1135630600 16:24033163-24033185 CCTGTTGGTCTGCAGCAGGCTGG + Intronic
1135841978 16:25885233-25885255 ACAGCTGGGATTCAGCAAGATGG + Intronic
1137721493 16:50630193-50630215 ATAGATGGTGTGCAGCAAGCTGG - Exonic
1137910900 16:52377093-52377115 ACAGCCTGTCTGCTGCATGCTGG - Intergenic
1138183541 16:54959534-54959556 ACAGCTGGTCTCCAGAGGGCAGG - Intergenic
1139401410 16:66684781-66684803 AGAGCAGGGCTGCAGCAGGCTGG - Intronic
1140472033 16:75221162-75221184 ACAGCTGGTCTGAGGGACGCGGG + Intronic
1141503763 16:84461830-84461852 ACAGCAGCTCTGCAGCGAGGAGG - Intronic
1142543914 17:685133-685155 ACAGCTGGAGTGGAGAAAGCGGG + Intronic
1142644858 17:1305046-1305068 ACAGCCGGTCAGCTGGAAGCGGG + Intergenic
1142719099 17:1764375-1764397 ACAGCTGGTCTCCACCCGGCTGG - Intronic
1142856084 17:2731218-2731240 GCAGCTGGGCTGCAGCACCCAGG - Intergenic
1143396728 17:6605241-6605263 ACAGCAGGTCTGCAGTGAGTAGG - Intronic
1147336514 17:39729714-39729736 ACAGCTGGTGTTCTCCAAGCTGG - Exonic
1147530502 17:41271821-41271843 AGAGTTGGTCAGCAGCAAGAAGG - Intergenic
1147552525 17:41454193-41454215 ACAGCCTGTCTGGAGCAAGGAGG + Intergenic
1148111186 17:45145303-45145325 AAGGCTGGACTGCAGCAAGCAGG + Intergenic
1148393789 17:47292429-47292451 TCAGCCCGTCTGCAGCCAGCGGG + Exonic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150266725 17:63837104-63837126 AAAGCTGGGCTGCAGCAGGAAGG - Intronic
1151891322 17:76952222-76952244 ACAGCTGGTCTAGACCAAGCAGG + Intergenic
1152453030 17:80395628-80395650 ACAGCGGGGCTGCAGCTAACGGG + Exonic
1153689834 18:7581140-7581162 AAAGCTGGCCTGCATCAAACAGG + Intronic
1155347769 18:24875607-24875629 ACATCTGGTTTGCAGCCAGCTGG - Intergenic
1156012973 18:32515306-32515328 AGAGCTGGCCTGCAGTAAGAAGG - Intergenic
1156364076 18:36409246-36409268 GCTGCTGGTCTGAAGCATGCAGG + Intronic
1159225503 18:65529317-65529339 ACAGCTGGTCTCCACCACACGGG - Intergenic
1161393637 19:4033643-4033665 CCATGTGGTCTGCAGGAAGCGGG - Intronic
1161743366 19:6039586-6039608 ACACCTGGACTGAATCAAGCAGG - Intronic
1163015417 19:14451389-14451411 CTGGCTGGTCTGCAGCAGGCGGG - Intronic
1164132031 19:22372347-22372369 ACAGCTGGTGTGCAACAGACTGG + Intergenic
1164824213 19:31272806-31272828 ACAGTAGGACTGCAGCAAGCCGG + Intergenic
1166239629 19:41481049-41481071 GCAGCTGGTCTGGAGCAGGAGGG + Intergenic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
926370883 2:12177687-12177709 ACAGCTGCTCTCCTGCCAGCTGG - Intergenic
927887800 2:26729135-26729157 AAAGCTGGTCCCCAGAAAGCAGG + Exonic
927936942 2:27081438-27081460 ACATCCGGTGTGCAGCACGCAGG - Intronic
930720613 2:54634144-54634166 ACAGCTGGTTTCCTGCAGGCGGG + Intronic
932629994 2:73332713-73332735 ACAGCTGGTCTGTAACATTCTGG - Intergenic
934112238 2:88754802-88754824 ACATCTGCTCAGCAGCAAGGTGG + Intergenic
934606311 2:95698195-95698217 AGAACTGCTCTGCAGCAAACAGG - Intergenic
934650730 2:96089939-96089961 GCATCTGGTCAGCAGCTAGCAGG + Intergenic
934767056 2:96885550-96885572 ACGGCAGGTCTGCAGGAATCTGG - Intronic
935434054 2:103008964-103008986 ACAGTTAGTCAGCAGCAGGCGGG - Intergenic
935746290 2:106193104-106193126 ACAGCTGGGCTGTAGCACACAGG + Intronic
936539703 2:113340322-113340344 AGGGCTGCTCTGCAGCAAACAGG - Intergenic
937239739 2:120452344-120452366 GCAGCTGAGCTGCAGCACGCAGG + Intergenic
938175089 2:129118435-129118457 TCAGCTGGAATGCAGCAAGAAGG - Intergenic
940803486 2:158158050-158158072 ACAACTGGTCAGCAGCCTGCAGG + Intergenic
941292820 2:163697575-163697597 AAAGTTGGGCTGCAGAAAGCAGG - Intronic
942383089 2:175413180-175413202 AGTGCTTGTCTGCACCAAGCTGG + Intergenic
942984001 2:182117295-182117317 ATTACTGGTCTGCAGCAAGAAGG + Exonic
943049921 2:182901991-182902013 ACAGCAGGTCTCCAGCATTCAGG + Intergenic
943551027 2:189339713-189339735 AGAGTTGGTCAGCAGGAAGCAGG + Intergenic
944253464 2:197600446-197600468 ACAGCTGGTCTGAAAGTAGCAGG - Intronic
945340023 2:208641120-208641142 ACAACAGGTCATCAGCAAGCTGG - Intronic
947142390 2:227031643-227031665 ACATTTGGTCAGCATCAAGCTGG + Intronic
947583276 2:231335195-231335217 ACAGCTGGTCAGTGGCCAGCAGG + Intronic
948064498 2:235067130-235067152 TCACGTGGTCTGCATCAAGCAGG - Intergenic
948546188 2:238730450-238730472 ACCGCTGTGTTGCAGCAAGCTGG - Intergenic
1168801867 20:648647-648669 ACACCTGGCCTCCAGCAGGCTGG - Exonic
1169143100 20:3237106-3237128 ACAGCTGGACTGGTACAAGCAGG + Intronic
1174415482 20:50363581-50363603 GCAGCTGGACTGCACCAAGCAGG + Intergenic
1178291747 21:31374216-31374238 ACAGCTGGTGTGCAGCGGGCAGG + Intronic
1178548942 21:33518814-33518836 TCAGATTGTCTGCACCAAGCTGG + Intronic
1179841677 21:44080011-44080033 GCTGCTGGTCTGCAGGTAGCTGG - Exonic
1179943979 21:44658256-44658278 GCAGCTGGTCAGCAGCAGGAAGG - Exonic
1179976786 21:44873071-44873093 ACAGCTGGTCGGGGGCAGGCCGG - Intronic
1180617499 22:17138038-17138060 GCAGCTGGTCTTCCGCAAGGAGG - Exonic
1180914077 22:19473161-19473183 ACAGCTGGTCCACAGTAAACTGG + Intronic
1180987322 22:19912560-19912582 ACCGCTGGGCTGCTGGAAGCTGG + Intronic
1181159514 22:20949953-20949975 ACTGCCAGTCTGCAGAAAGCTGG - Exonic
1181817199 22:25447545-25447567 ACAGCAGGTCATCTGCAAGCTGG - Intergenic
1181895223 22:26101256-26101278 ACAGCTAGTAGGCAGCATGCAGG + Intergenic
1183197061 22:36360866-36360888 ACAGCTGGTCAGCACCTCGCTGG - Intronic
1183741608 22:39671539-39671561 ATACCTGGTCTGCAACAAGCTGG - Intronic
1184837540 22:47032797-47032819 ACGTCTGGGCTGCAGCAAGTGGG - Intronic
949332364 3:2936544-2936566 ACAGCTGGTAGACAGCAGGCAGG - Intronic
952585937 3:34892395-34892417 ACACTTGGTTTGCAGCAAACAGG + Intergenic
954630849 3:52047014-52047036 ACAGATGGCCTGAAGCAAGCAGG + Intergenic
955264751 3:57431376-57431398 ACAGCTGGAGTGGAGCAAGGTGG - Intronic
956568401 3:70665743-70665765 ACCCCAGGTCTCCAGCAAGCTGG - Intergenic
958073230 3:88641449-88641471 AAAGCTGGCCAGCAGCAGGCAGG - Intergenic
958455231 3:94322791-94322813 CCAGCTTCTCTGCAGGAAGCAGG + Intergenic
961760364 3:129162684-129162706 ATAGCTGATCTGAAACAAGCAGG + Intergenic
962318014 3:134370857-134370879 ACAGCTGGCCCGCAACCAGCAGG - Exonic
963941521 3:151100285-151100307 ACAGCTGATCTGCAGCACATTGG - Intronic
968828167 4:2914846-2914868 ACATCTGGTCTGCAGGAGCCCGG - Intronic
969536836 4:7761541-7761563 ACAGGTGGGCAGCAGCGAGCTGG - Exonic
969619504 4:8272055-8272077 ACAGCTGGGCTGCAACGGGCAGG - Intronic
969631829 4:8343442-8343464 ACAGCTGCTCTGGAGCAGGTCGG - Intergenic
970386389 4:15561070-15561092 ACAGCTGGTGGGCAGAGAGCTGG + Intronic
972154605 4:36143956-36143978 ACCGCTGGACTGCAGAAATCAGG - Intronic
972841339 4:42933317-42933339 CCAGCTGTTCTCCAGCTAGCGGG - Intronic
976873608 4:89827161-89827183 ACAGCTGGTAAGGAGTAAGCAGG + Intronic
977195512 4:94054240-94054262 ACAGATGGTCTGAATCAGGCAGG - Intergenic
978113070 4:104985855-104985877 AAGGCTGGTTTGCAGAAAGCTGG - Intergenic
980284461 4:130764258-130764280 ACTGCTGGACAGCATCAAGCAGG + Intergenic
980980556 4:139651137-139651159 GCAGCTGGTCTCCCTCAAGCTGG + Intergenic
980994460 4:139766833-139766855 AGAGCTGGTCTGCAGGGAGATGG - Intronic
983158857 4:164384670-164384692 ACCGCTGGTCTGAGGCAAGAAGG + Intergenic
983312962 4:166088757-166088779 ACAGCTGGTCTGGTGCCAACTGG - Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
987024538 5:13910875-13910897 ATGGCTGGTCTGCAGTGAGCAGG + Intronic
992411613 5:76510814-76510836 ACACCTGGCCTCCAGCAGGCTGG + Intronic
998201969 5:140132127-140132149 AGAGCAGGTCTGAAGGAAGCTGG + Intergenic
999234354 5:150081552-150081574 ACATCTGGTCTGCAGCACAGTGG + Intronic
999630821 5:153569496-153569518 ACAGCTGCTCAGCAGCAGGGAGG - Intronic
1000149704 5:158487521-158487543 AGAGCTGTTCTGCAGACAGCTGG + Intergenic
1001206520 5:169768635-169768657 ACAGCTTCCCTGCAGCAAGCCGG + Intronic
1001932640 5:175684133-175684155 ACAGCTCTTCTGCTGCAGGCTGG + Exonic
1002820604 6:720949-720971 ACAAGTGGCCTGCAGCCAGCAGG - Intergenic
1002846287 6:948104-948126 TCAGCTGTTCTGCAGCCTGCAGG + Intergenic
1003260316 6:4510754-4510776 ACAGCTGGATTGCAGAAGGCAGG + Intergenic
1006196724 6:32247530-32247552 ACAGCTACGGTGCAGCAAGCAGG + Intergenic
1011188674 6:84707393-84707415 ACATCTGGGCTGCAGCAAGCTGG + Intronic
1015657879 6:135540368-135540390 ACAGCTGGTCAGCAGAAAACAGG + Intergenic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1018471113 6:164099162-164099184 ACAGCTGATGTGAAGCAAGAAGG + Intergenic
1022496851 7:30858809-30858831 ACAGCTTGTCAGCAGCACACTGG - Intronic
1023005884 7:35867020-35867042 ACAACTGCTCTGCTGCAAACTGG + Intronic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1024062579 7:45709945-45709967 CCAGCTGGTCTGCAGCTGTCCGG + Intronic
1030132950 7:106218709-106218731 AAAGCTGCTCTGCAGCCAGATGG - Intergenic
1035112947 7:156499426-156499448 ACAGGTGGTATGCAGCATACGGG - Intergenic
1035328949 7:158084139-158084161 CCAGCGGGTCTGCAGTAAACAGG + Intronic
1037323538 8:17666068-17666090 GCATCTGTTCTGCAGCATGCTGG - Intronic
1038421628 8:27437520-27437542 ACAACTGGGCTGCAGCATGGGGG + Intronic
1040877366 8:52167481-52167503 CCAGCTGCTCTGCAGGGAGCAGG - Intronic
1044670110 8:94671385-94671407 ATTGCTGATCTGCAGAAAGCAGG + Intronic
1045391306 8:101717662-101717684 GTAGCTGGTCTGCAGCACTCAGG - Intronic
1049003188 8:139838925-139838947 TCAGCTGATGTGCAGCAAGAGGG + Intronic
1050260984 9:3840870-3840892 TCATCTGGTCTGTAGCAAGCTGG + Intronic
1052610139 9:30760711-30760733 ACAGCTGGTCAGGTACAAGCAGG + Intergenic
1060526813 9:124325521-124325543 AAAGCTGGTATGCAGGTAGCTGG + Intronic
1062177939 9:135174677-135174699 GCAGCTGGTCAGCAGCACTCAGG + Intergenic
1062328030 9:136022115-136022137 AGAGCTGGTCTGTGCCAAGCCGG - Intronic
1186497607 X:10024370-10024392 ACTGGTGTTCTGCAGCAACCTGG + Intronic
1187943345 X:24402482-24402504 CCTGGTGGTCTGCAGCCAGCTGG + Intergenic
1188100282 X:26074059-26074081 AGAGCTGGTCTGCAGTCAACTGG + Intergenic
1189227077 X:39421936-39421958 ACAGCTGCCCTGCAGTGAGCAGG + Intergenic
1192552049 X:72062439-72062461 ACAGCTGGTGGGAAGCAAACTGG + Intergenic
1196014258 X:110920640-110920662 AGAGCTGGACTGCAGCCTGCGGG - Intergenic
1196783538 X:119403258-119403280 AGGGGCGGTCTGCAGCAAGCTGG - Intronic
1198174976 X:134146085-134146107 ACCAATGGTCTGCAGCATGCTGG - Intergenic
1198506115 X:137302922-137302944 ACAGCTGGACCACAGGAAGCAGG - Intergenic
1198730186 X:139720190-139720212 AGGGCTGGTCTGCAGCATCCTGG + Intergenic