ID: 1118253955

View in Genome Browser
Species Human (GRCh38)
Location 14:64188859-64188881
Sequence GAGAACAGTTGGAAGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 559}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118253949_1118253955 29 Left 1118253949 14:64188807-64188829 CCAGTAGCATTTTAGAAATTTGA 0: 1
1: 0
2: 2
3: 30
4: 320
Right 1118253955 14:64188859-64188881 GAGAACAGTTGGAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 45
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118253955 Original CRISPR GAGAACAGTTGGAAGAGAGG AGG Intronic
900351175 1:2235401-2235423 GAGAACAGGTGGCACAGTGGGGG - Intronic
901744026 1:11360780-11360802 GACAACACTGGGAAGAGAGAAGG + Intergenic
901806844 1:11743924-11743946 GAGACCAGTTCCAGGAGAGGAGG + Intronic
902286963 1:15413195-15413217 GAGAGCAGAGGGCAGAGAGGAGG + Intronic
902643604 1:17782203-17782225 GAGAAGAGTTTGAGGACAGGGGG + Intronic
903009842 1:20321842-20321864 GAGCAGAGTGGGTAGAGAGGAGG + Intronic
903182360 1:21611407-21611429 GAGGACAGGTGGAAGACAGGAGG + Intronic
903750870 1:25619520-25619542 GATAAGAAGTGGAAGAGAGGTGG - Intronic
905873200 1:41416511-41416533 GAGCACACTAGGAAGAGAGATGG - Intergenic
906843559 1:49165676-49165698 GAGAAGAGATGGAGGAAAGGAGG + Intronic
907451442 1:54548128-54548150 GAGGGCAGTCTGAAGAGAGGCGG + Intronic
907511058 1:54959881-54959903 GAGAACAGCTTGAAGCCAGGAGG + Intergenic
907514435 1:54984501-54984523 GTGAAGAGCTGGGAGAGAGGAGG - Intronic
907796372 1:57721989-57722011 GAGAGCCTTTGGAAGAGAGTGGG - Intronic
907982456 1:59497496-59497518 GAGAATAGTTTGAAGCCAGGAGG + Intronic
908163458 1:61434788-61434810 GAGAACAGTGGCAATAGAGAAGG + Intronic
908631815 1:66117502-66117524 GAGTGCAGTTGGAAGAGATGTGG + Intronic
908903964 1:68986460-68986482 GAGATCATTTGGAGGAGAAGAGG - Intergenic
909460711 1:75909890-75909912 GAGATAAGATGGAAGAGAGATGG - Intronic
910099044 1:83556980-83557002 TAGAAGAGTAGGCAGAGAGGGGG - Intergenic
912073959 1:105849324-105849346 AAAAACAGTAGGAAGAGAGGGGG - Intergenic
912226306 1:107738156-107738178 GAGAACACTTGGACGAAGGGTGG + Intronic
912762467 1:112381404-112381426 GAGAACAATTGGTATAGAGGTGG + Intergenic
913503838 1:119497632-119497654 AAAAACAATTGGAAGAGGGGTGG + Intergenic
915389690 1:155530644-155530666 GAGAACTGTTTGAACACAGGAGG + Intronic
915570384 1:156742256-156742278 GAGACCAGTAGGAAGAGGGTGGG + Intronic
915730707 1:158052163-158052185 GAGAAGAGAGGGAAGAGAGATGG - Intronic
916804006 1:168241296-168241318 GAGAACAGCTTGAAGCCAGGAGG - Intronic
919172848 1:193977627-193977649 AATAACAGTTGGAAGACAGGAGG - Intergenic
919550945 1:198986834-198986856 GGGAACAGTTGAATGAGAAGAGG + Intergenic
920004706 1:202824512-202824534 GAGAACATTTGGATCAGAAGGGG + Intronic
920044447 1:203124445-203124467 GAGAACTGTTGGATAAGAGCAGG - Intronic
920240423 1:204543738-204543760 GAGAAGAGTGGCTAGAGAGGAGG - Intronic
920300671 1:204986799-204986821 GAGGACAGGAGGAAGAGAAGAGG - Intronic
921254653 1:213328629-213328651 GAGAAAAGTGGGGAGAGAGAAGG + Intergenic
921736298 1:218632839-218632861 GTGATCATTTGGAAGAGAAGAGG + Intergenic
922503386 1:226112536-226112558 GTGTAGAGTTGGAAGAGGGGAGG - Intergenic
922608185 1:226904240-226904262 GATCACACTGGGAAGAGAGGAGG - Intronic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
924204715 1:241699799-241699821 GAGAAGAGTTGGGAAAGATGAGG + Intronic
1063439820 10:6063532-6063554 GAGAATAGCTGGAACCGAGGAGG + Intergenic
1063996941 10:11628557-11628579 GAGAGGAGTTGGAAGACAAGGGG - Intergenic
1064974162 10:21096232-21096254 AAGGACAGTGGGAAGAGAGAGGG - Intronic
1065772371 10:29089572-29089594 GAGAAGAGGTGGAACAGAAGAGG - Intergenic
1065916627 10:30358650-30358672 GAGAAAAGTGGGCAGAGAGCTGG - Intronic
1066198590 10:33125346-33125368 GAGAATCGATGGGAGAGAGGGGG + Intergenic
1066331186 10:34425103-34425125 GAAAAAAATTGGAAGATAGGAGG - Intronic
1067070716 10:43129073-43129095 GAGAACAGTATGAAGAAAGGGGG + Exonic
1067329320 10:45300584-45300606 GCGATCATTTGGAAGAGAAGAGG + Intergenic
1069082440 10:64102615-64102637 GAGAGAAGAAGGAAGAGAGGAGG + Intergenic
1070031798 10:72684187-72684209 GAGAACTGTTTGAACCGAGGAGG - Intergenic
1070338017 10:75472105-75472127 GAGAAGACTTGGAAGAGGGAAGG - Intronic
1070597782 10:77844853-77844875 GAGCACACTGGGCAGAGAGGGGG + Intronic
1070679769 10:78440352-78440374 TAGAGCAGGAGGAAGAGAGGGGG + Intergenic
1071251579 10:83824669-83824691 GAGGCCAGATGGAAGAGATGAGG + Intergenic
1071573608 10:86711129-86711151 GAGAGGAGTTGGAGGAGAAGCGG + Intronic
1073248267 10:102106709-102106731 GGGAAGAGTGGGGAGAGAGGTGG + Intergenic
1073282898 10:102367695-102367717 AGAAACAGTTGGCAGAGAGGGGG - Intronic
1074814679 10:117135033-117135055 GAGGGAAGTGGGAAGAGAGGCGG + Intronic
1074961383 10:118448995-118449017 GAGAAAAGGCAGAAGAGAGGCGG - Intergenic
1076515006 10:131040207-131040229 GAGAACAGGAGGAAGAGGAGTGG - Intergenic
1078057257 11:8018704-8018726 GGAGGCAGTTGGAAGAGAGGAGG + Intergenic
1078262239 11:9720903-9720925 GAGAACCGTTTGAAGCCAGGAGG - Intronic
1078295850 11:10069349-10069371 GAGAACACTTGGAATAGGGTGGG - Intronic
1078710933 11:13790265-13790287 GGCAACAGCTGGAAGAGAGTGGG - Intergenic
1078881819 11:15458205-15458227 GAGAACACATGGACGCGAGGAGG + Intergenic
1079587933 11:22149390-22149412 GAGATTATTTGGAAGAGAAGAGG + Intergenic
1079869642 11:25781206-25781228 GAAGACAGTGGGATGAGAGGTGG - Intergenic
1080006105 11:27408740-27408762 GATATCATTTGGAAGAGAGATGG - Intronic
1080318254 11:30974796-30974818 TAGAATAGTTTGAAGAGAGCTGG - Intronic
1080717369 11:34817389-34817411 GAGAAGATTTGGAAGAGTTGAGG - Intergenic
1081478760 11:43463767-43463789 AAGAACAGTGGGAGAAGAGGAGG + Intronic
1081818299 11:45966113-45966135 GAGAACATTGGGAAGAAAAGGGG - Intronic
1083078765 11:60068893-60068915 GAGAACACTTGGACGCAAGGCGG - Intronic
1084302935 11:68263070-68263092 GCCAACAGTGGGAAGAGAGATGG - Intronic
1085446517 11:76604430-76604452 GGGAGCAGGTGGGAGAGAGGCGG - Intergenic
1085958438 11:81429674-81429696 GAGAACAGTTGGAGGTGGGGTGG + Intergenic
1086414374 11:86574263-86574285 GAGATCATTTGGAGGAGAAGAGG + Intronic
1087263713 11:96039301-96039323 GAGAAGAGAGGGGAGAGAGGAGG + Intronic
1088807452 11:113365404-113365426 GAGAAAAGAGGGAAGAGAAGGGG - Intronic
1089504263 11:118953155-118953177 TAGGAGATTTGGAAGAGAGGAGG + Intronic
1089905844 11:122037700-122037722 GAGAAAGTTTGGAAAAGAGGAGG + Intergenic
1090281005 11:125455898-125455920 GAGAACTGATGAAAAAGAGGCGG - Exonic
1091999374 12:5019916-5019938 AAGAGGAGTTGGAAGAGATGGGG - Intergenic
1092218748 12:6699467-6699489 GAGAGAACTGGGAAGAGAGGAGG + Intronic
1092793458 12:12088844-12088866 GTGAAGAGCTGGAGGAGAGGAGG + Intronic
1093042958 12:14405756-14405778 TAGGGCAGTTGGAAGAGAAGAGG + Intronic
1093771980 12:23028868-23028890 GATAACACTTGGAAGACAGGTGG + Intergenic
1093796754 12:23321968-23321990 CATTACAGTTGAAAGAGAGGAGG - Intergenic
1095523750 12:43099764-43099786 GAGAAGTGCTGTAAGAGAGGAGG - Intergenic
1096218825 12:49814610-49814632 AAGAAGAGGTGGAAGAGGGGTGG - Intronic
1096365043 12:51021870-51021892 GATAACAGTTGGGAGAAATGTGG + Intronic
1096820537 12:54230426-54230448 GAGGTCAGTTGGAAGTTAGGAGG - Intergenic
1097640697 12:62177842-62177864 GAAAAGAGGTGGAAGAAAGGTGG - Intronic
1097980803 12:65736399-65736421 GTGAAGACTTGGAAGAGTGGGGG + Intergenic
1098193505 12:67976114-67976136 GTGATCATTTGGAAGAGAAGAGG + Intergenic
1098781077 12:74687307-74687329 GAAAACAGTTGTAAGAAAAGAGG - Intergenic
1099339549 12:81410882-81410904 GAAAACACATGGAAGAGATGAGG + Intronic
1099656506 12:85499105-85499127 GAAATCAGTTGGAAGAGACTTGG + Intergenic
1100002550 12:89855044-89855066 GAGAGCAGGAGCAAGAGAGGGGG + Intergenic
1100447453 12:94674847-94674869 GAGAACTGAAGGAAGTGAGGGGG + Intergenic
1100725334 12:97402695-97402717 GAGAAGAGATGGGAGAGATGGGG - Intergenic
1101293360 12:103394844-103394866 GAGAACAAGGGGAAGACAGGTGG + Intronic
1102591304 12:113958705-113958727 GAAAACAGTTGCAACACAGGAGG - Intronic
1102809190 12:115809297-115809319 GAGAACAGGAGGCAGAGATGAGG - Intergenic
1103472428 12:121192587-121192609 GGAAACAGTGGGATGAGAGGAGG + Intergenic
1103830765 12:123777264-123777286 GAGTAGAGATGGAAGAGATGAGG + Intronic
1104036953 12:125104299-125104321 GACCAGAGGTGGAAGAGAGGAGG + Intronic
1104051352 12:125195917-125195939 GAGAACAGCAGGAGGAAAGGAGG + Intronic
1104206234 12:126641752-126641774 GCGATCATTTGGAAGAGAAGAGG + Intergenic
1105219121 13:18309205-18309227 GACATCAGGTGGAAGAGAGGAGG - Intergenic
1105581504 13:21701218-21701240 GAGAACAGTTCGAAGAAAACTGG + Exonic
1105886869 13:24649855-24649877 GAGAGGAGGGGGAAGAGAGGAGG - Intergenic
1105898397 13:24737220-24737242 GAGAGCTGTTGGGAGGGAGGAGG + Intergenic
1106108451 13:26756275-26756297 GAGAACTGCTTGAAGACAGGAGG - Exonic
1106439888 13:29757016-29757038 GAGAACAGGTGGACCAGGGGAGG - Intergenic
1107021282 13:35755067-35755089 AAGATCAGTTGGAGGAGTGGGGG - Intergenic
1107205842 13:37786812-37786834 TAGAAGATTTGGAAGAGATGAGG + Intronic
1108709041 13:53015512-53015534 GATAACATTGGGAAGATAGGAGG - Intergenic
1108950753 13:56088794-56088816 CAGAACAGGAGGAAGAGAGGGGG - Intergenic
1109303308 13:60612025-60612047 GAAGAGAGTGGGAAGAGAGGCGG - Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1110264308 13:73520685-73520707 GAGAAAAAGTGGAAGGGAGGGGG + Intergenic
1110337415 13:74347695-74347717 GAGATCATTTGGAGGAGAGGAGG - Intergenic
1110761928 13:79240453-79240475 GAGAACAGTAGAAACAAAGGGGG - Intergenic
1111159700 13:84378365-84378387 GAGAGCAGAAGGAAGAGAGAGGG + Intergenic
1112121620 13:96418699-96418721 AGGAAATGTTGGAAGAGAGGAGG + Intronic
1112320918 13:98406817-98406839 CAGAGCAGTTGGAAGAAATGAGG - Intronic
1112569596 13:100581686-100581708 GAGCACAGTATGAAGGGAGGGGG + Intronic
1112605650 13:100903433-100903455 TAGATCACTTGGAAGAGATGGGG - Intergenic
1113002410 13:105657356-105657378 GATCACAGGTGCAAGAGAGGTGG + Intergenic
1114210713 14:20611920-20611942 GAGAGCAATTGGAAGAGAAGTGG + Intergenic
1114545137 14:23494422-23494444 GAGCACAGTAGGAAAAAAGGGGG - Intronic
1114621811 14:24100683-24100705 GAGGAGAGTTGGAGCAGAGGAGG - Intronic
1114693791 14:24608319-24608341 GAGAAGAGTCGGAAGAGGTGTGG - Exonic
1115758730 14:36556647-36556669 GAGGAGAGTTGGAAGAGGAGAGG + Intergenic
1116233729 14:42251556-42251578 GAGAGCTGATGGAAGAGTGGTGG + Intergenic
1116342922 14:43749568-43749590 GAGAAAAGTGGGAAGAAGGGAGG - Intergenic
1116811291 14:49542076-49542098 CAGAACAGGAGCAAGAGAGGGGG - Intergenic
1117528282 14:56633355-56633377 CAGAACAATGGGGAGAGAGGAGG + Intronic
1118040867 14:61914974-61914996 GGGAAGAGTTGGAGGAGATGAGG - Intergenic
1118056766 14:62087209-62087231 GAGAAGAGTTGGAAGGAAGAGGG + Intronic
1118253955 14:64188859-64188881 GAGAACAGTTGGAAGAGAGGAGG + Intronic
1118821831 14:69350796-69350818 GAGAGAAGATGGAAGAGGGGAGG + Intronic
1118859388 14:69650682-69650704 GAGAAAAGATGCAAGAGAGAAGG - Intronic
1120057161 14:79937895-79937917 GAGAACTGTTGGAAAACATGTGG + Intergenic
1120091951 14:80342319-80342341 GAGGACAATTGTAAGAGATGAGG + Intronic
1120267118 14:82265180-82265202 AAGCAAAGTTGTAAGAGAGGTGG + Intergenic
1121174406 14:91879914-91879936 GTGAACATTTGGAATATAGGAGG + Intronic
1122426221 14:101607653-101607675 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426259 14:101607801-101607823 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426293 14:101607922-101607944 GAGAAGAGGAGGAGGAGAGGTGG - Intergenic
1122426313 14:101608002-101608024 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426326 14:101608055-101608077 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1202895326 14_GL000194v1_random:3218-3240 GAGAACAGTAGACAGGGAGGAGG - Intergenic
1124848586 15:33314279-33314301 AAGAGCAATCGGAAGAGAGGAGG - Intronic
1124994373 15:34708540-34708562 CAGCACAGTTGGAGGAGAGATGG - Intergenic
1125008118 15:34840615-34840637 GGGAGCAGTGGCAAGAGAGGAGG - Intergenic
1125772859 15:42183185-42183207 GAGAACTGCTTGAAGGGAGGGGG - Intronic
1126247007 15:46518632-46518654 GAAAAGAGAGGGAAGAGAGGAGG + Intergenic
1127019287 15:54727685-54727707 GACAAGAGTTGGAAGAGAGGTGG + Intergenic
1127307081 15:57718031-57718053 GAGAATCGTTTGAACAGAGGAGG - Intronic
1127490018 15:59453740-59453762 AAAAAAATTTGGAAGAGAGGAGG + Intronic
1127490027 15:59453779-59453801 GAGAAGAGCTGGAAGAGGGTAGG + Intronic
1128534510 15:68480555-68480577 GAGCACAGTGGGAATGGAGGGGG - Intergenic
1128744397 15:70103374-70103396 GAGAACAGTTGTGAGAAGGGTGG + Intergenic
1129272174 15:74424814-74424836 GAGAACAGCTGGAAGGTAGATGG - Intronic
1129979608 15:79855707-79855729 GAGAACACATGGAAGAAAGAGGG - Intronic
1130031648 15:80319760-80319782 GTGAAGAGATAGAAGAGAGGAGG - Intergenic
1131899536 15:97072514-97072536 GAGAAGATTTTGAAGTGAGGTGG + Intergenic
1132187972 15:99820315-99820337 GAAAAAAGTTGGAAGAGAATAGG + Intergenic
1132984179 16:2755446-2755468 GGGAACGGTTGGAACAGAGGAGG + Intronic
1133200125 16:4199017-4199039 GAGAAGAGCTGGAAGAGCTGAGG - Intronic
1134219171 16:12339918-12339940 CAGATCACTAGGAAGAGAGGTGG + Intronic
1134383533 16:13750213-13750235 GATAACAGTAGGAACAGATGTGG + Intergenic
1134422531 16:14107775-14107797 GGGAACAGTTGCTGGAGAGGAGG + Intronic
1134507618 16:14820975-14820997 GAGAACAAGGGGAAGAGAAGAGG - Intronic
1134695316 16:16219737-16219759 GAGAACAAGGGGAAGAGAAGAGG - Intronic
1134897618 16:17903280-17903302 GAAAACAATTGCAAGAAAGGTGG + Intergenic
1134976516 16:18574949-18574971 GAGAACAAGGGGAAGAGAAGAGG + Intergenic
1135285327 16:21188150-21188172 GAGCACAGCTGGTGGAGAGGGGG + Intergenic
1135992553 16:27226890-27226912 GATCACAGAGGGAAGAGAGGTGG - Intronic
1136427591 16:30179596-30179618 GAGAATAGTTTGAACTGAGGAGG - Intergenic
1136664017 16:31792612-31792634 GAGACCTGTTGGAAAAAAGGTGG - Intronic
1137235622 16:46615002-46615024 CAAAACAGGTGGAGGAGAGGTGG - Intronic
1139418361 16:66832241-66832263 GAGAACAATTGGGAGGGGGGTGG + Intronic
1139707466 16:68751275-68751297 CAGAAGAGTGGGAAGAGATGAGG - Intronic
1140412615 16:74749932-74749954 GAGCACAGCTGGAAGGGACGCGG + Intronic
1140964761 16:79954587-79954609 AAGAAGAGATGGAAGAGAGAGGG + Intergenic
1142025102 16:87808380-87808402 GAGAACAGTGGGAGGTGAGATGG - Intergenic
1142276083 16:89119585-89119607 GAGAAAGGATGGAAGAAAGGGGG + Intronic
1142468010 17:147066-147088 GCGGACAGTGGGAACAGAGGAGG - Exonic
1142852406 17:2710662-2710684 GGGAACAGAAGGAAGAGAAGGGG + Intronic
1143125497 17:4639062-4639084 AAGAAGAGCTGGAAGAGAGAAGG - Exonic
1143194236 17:5063346-5063368 GGCAACAGTTGGAAGAAAAGGGG - Intergenic
1143370717 17:6437290-6437312 GAGAAAGGATGGAAGAGAGAAGG - Intergenic
1143794233 17:9323724-9323746 GACAACACTGTGAAGAGAGGAGG + Intronic
1143989172 17:10942181-10942203 GAGACCAGGGGGAAGAGAGAGGG + Intergenic
1144723931 17:17491845-17491867 GAGCACAGTAGGAAGGGAGGCGG + Exonic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1148080677 17:44966485-44966507 GAGAGCACTGGGAAGGGAGGTGG + Intronic
1148444016 17:47726963-47726985 GAGAACCTTGGGGAGAGAGGAGG + Intergenic
1149229578 17:54518209-54518231 GAGATCATTTGGAGGAGAAGAGG + Intergenic
1149380503 17:56088650-56088672 GAGAACAGGAGGAAGATAGGTGG - Intergenic
1149778512 17:59377727-59377749 TAGGACAGTTGGAAGAGGTGTGG + Intronic
1151354269 17:73549225-73549247 GAGAGGAGTGGGAAGAGAGGAGG + Intronic
1151484158 17:74388087-74388109 GAGAAAAGAAGGAAGAGAGGAGG - Intergenic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1151614092 17:75196840-75196862 GAGAACTGCTGGAAGCCAGGAGG + Intergenic
1153307917 18:3649737-3649759 AAGGGCAGTTGGAAAAGAGGAGG + Intronic
1153635685 18:7110892-7110914 GAGAACAATTAGAAGTGGGGGGG - Intronic
1154072527 18:11165596-11165618 CAAAACAGTTGGAAGAAAGGTGG + Intergenic
1155685787 18:28548240-28548262 GACAAGAGTTGGAAGAGTAGTGG - Intergenic
1156372365 18:36483018-36483040 CAGAATAGTGGGAAGAGAGATGG + Intronic
1156794512 18:41026885-41026907 GAGAAGAGGAGGAGGAGAGGAGG - Intergenic
1156797835 18:41069810-41069832 TAGAACAGTTGATAGAGAAGGGG + Intergenic
1156851760 18:41736930-41736952 GAGGACAGTTGGAAGGCAGGAGG + Intergenic
1157238947 18:45991368-45991390 GAGTAGAGTTGCAAGAGAGACGG - Intronic
1157353675 18:46914375-46914397 CAGAAGAACTGGAAGAGAGGTGG + Intronic
1157410429 18:47458649-47458671 GAGAAGAGAGGGATGAGAGGAGG + Intergenic
1157729400 18:49990621-49990643 GAAAACACTGGGAAGAGTGGGGG - Intronic
1160069360 18:75611821-75611843 GAGAAGAGTTGGCAGAGTGTCGG - Intergenic
1161246817 19:3257321-3257343 GAGAGTAGGTGGAGGAGAGGGGG + Intronic
1161839364 19:6669808-6669830 GAGAGCAGGTGGAGGTGAGGGGG - Intronic
1162273904 19:9638113-9638135 GAGTACAGTTGGAGGAGTGTGGG + Intronic
1162821805 19:13227592-13227614 GAGAACCAAAGGAAGAGAGGTGG + Intronic
1162851001 19:13431037-13431059 GAGGAGAGTGGGAATAGAGGGGG + Intronic
1163061210 19:14763665-14763687 GAGAAGAGAAGGAGGAGAGGAGG - Intronic
1163061232 19:14763766-14763788 GAGAAAAGGAGGAGGAGAGGAGG - Intronic
1164292616 19:23881403-23881425 GAGAAAAGGAGGAAGAGAGAAGG + Intergenic
1164302411 19:23973475-23973497 GATAAGAGTAGGAGGAGAGGAGG + Intergenic
1164322000 19:24157101-24157123 GATAGCATGTGGAAGAGAGGTGG - Intergenic
1164743572 19:30594719-30594741 GAGAAGAGTGGGGAGGGAGGAGG - Intronic
1164750805 19:30653582-30653604 GACAAGAGATAGAAGAGAGGTGG + Intronic
1165156071 19:33788869-33788891 GAGAAGACAGGGAAGAGAGGAGG + Intergenic
1165445525 19:35855155-35855177 GAGAGCAGTTGGGAGAGGGGAGG - Intronic
1165850493 19:38847730-38847752 TGGACCAGTGGGAAGAGAGGGGG - Intronic
1166708634 19:44923142-44923164 GAGAACTGGAGGAAGTGAGGAGG - Intergenic
1166710633 19:44934938-44934960 GAGAACTGGAGGAAGTGAGGAGG - Intergenic
1166932648 19:46310474-46310496 AAGGACAGAAGGAAGAGAGGGGG - Intronic
1167608490 19:50494381-50494403 GAGAAGAGGAGGAAGAGAGGAGG + Intergenic
1168661489 19:58170874-58170896 AAGAATAGAGGGAAGAGAGGAGG + Intergenic
925246507 2:2388342-2388364 CAGAACAGGAGCAAGAGAGGGGG + Intergenic
925267863 2:2579835-2579857 GAGAGCAGGTGGAAGCGAGAAGG - Intergenic
925603210 2:5629902-5629924 GAGACTAGTTGTAAAAGAGGAGG + Intergenic
926244394 2:11112536-11112558 GAGGAAAGTTGAAAGAGATGAGG + Intergenic
926873280 2:17446614-17446636 GTGATCATTTGGAGGAGAGGAGG - Intergenic
926878410 2:17512329-17512351 GAGAAAAGTTGGAAGATACTGGG - Intronic
927099820 2:19779502-19779524 GAGAAGAGCAGCAAGAGAGGGGG + Intergenic
927244932 2:20949863-20949885 GATTTTAGTTGGAAGAGAGGAGG - Intergenic
927663746 2:25015025-25015047 GTGCACAGTTGGAATACAGGGGG + Intergenic
927860131 2:26555549-26555571 GAGGGCAGTGGGAAAAGAGGTGG + Intronic
928085847 2:28345851-28345873 GGGAGCTGTGGGAAGAGAGGAGG - Intergenic
928616064 2:33040756-33040778 TAGAGCAGTTGGAACAGAGCCGG + Intronic
928971111 2:37030305-37030327 GAGAACACTAGGAAGAGATTAGG + Intronic
929257058 2:39823526-39823548 GAGAAAAGTTGGAAGTGAAGGGG + Intergenic
930046429 2:47176612-47176634 GAGAAGAGTTTGAGGGGAGGGGG - Intergenic
930621505 2:53648714-53648736 GAGAACAGCTGGAACTCAGGAGG + Intronic
930630050 2:53743546-53743568 GACAAAAGTTGGAAAAGCGGGGG + Intronic
930850890 2:55959110-55959132 GAGAACAGTTGGCAAATAGAAGG + Intergenic
931011360 2:57918290-57918312 GAGACCAGAAGGAGGAGAGGGGG + Intronic
931599584 2:63990138-63990160 GAGGAAAGTTGGAGAAGAGGTGG - Intronic
931639074 2:64365555-64365577 GGGAACAGGTGAGAGAGAGGAGG + Intergenic
931679387 2:64731517-64731539 AAGAAGAGATGGAAGAGATGTGG + Intronic
931969203 2:67567190-67567212 GGAGAAAGTTGGAAGAGAGGAGG + Intergenic
933099499 2:78234780-78234802 GAGGACAGAAGGAAGATAGGAGG + Intergenic
933236493 2:79870447-79870469 GAGAACAGGGGGAAAAGGGGAGG + Intronic
933731613 2:85460536-85460558 GAGAATAGCTTGAAGAGGGGAGG + Intergenic
933994939 2:87661260-87661282 GAGAAAAGTTCCAAGAGAGTGGG + Intergenic
934042300 2:88137725-88137747 GAGAGCAGTGGGAAGGGAAGGGG + Intergenic
934677567 2:96260487-96260509 GAGCACAGCTGGAAGGTAGGAGG - Intronic
935526610 2:104177856-104177878 AAGAGCAGTTCTAAGAGAGGAGG - Intergenic
935770790 2:106418036-106418058 GAGAACTGCTGGAAGCCAGGAGG + Intronic
936556171 2:113500052-113500074 GAGAGCAGTAGGTAGCGAGGAGG - Exonic
936718506 2:115219473-115219495 AAGAACAGTAGTAAGAGTGGAGG - Intronic
937114212 2:119392663-119392685 GTTATCAGTTGCAAGAGAGGAGG - Intergenic
937118145 2:119424222-119424244 GTGCAAAGTTGGAAGAGAGAAGG + Intergenic
937329310 2:121015924-121015946 GAGCACAGTGGGGAGAGCGGAGG + Intergenic
937630462 2:124096006-124096028 AAGAGCAGTTTGAAGACAGGGGG - Intronic
937702659 2:124881592-124881614 AAGAACAGGGGGAAGAGAAGTGG + Intronic
937831948 2:126433887-126433909 GAGTGCAGGTGGCAGAGAGGAGG + Intergenic
937895866 2:126976521-126976543 AAGAAAAGCTGGAAGAAAGGAGG - Intergenic
938664894 2:133524612-133524634 GAGAGCAGTGGGAAGAAAGGAGG - Intronic
938763013 2:134442230-134442252 AAGAACAGTGGGAGTAGAGGTGG + Intronic
939459659 2:142483504-142483526 CATGACAGTTGGAAAAGAGGTGG + Intergenic
939682621 2:145157534-145157556 GGGAACAGAGGGAAGAGGGGAGG - Intergenic
939696135 2:145327183-145327205 GAGAAAAGTTGGAGGAGAACTGG + Intergenic
940157524 2:150674958-150674980 GATAACCGTAGGAAGGGAGGTGG - Intergenic
940340114 2:152571216-152571238 GAGAACTGCTGGTGGAGAGGAGG + Intronic
940855876 2:158728455-158728477 GAGAACAAGGGGAGGAGAGGTGG + Intergenic
941029974 2:160499881-160499903 GAGCAGAGTTGGAGGAGAGTTGG + Intergenic
942192172 2:173481189-173481211 GGGAAGAGTAGTAAGAGAGGAGG + Intergenic
942984840 2:182127590-182127612 AAGAACAGTGGGAAGAAAAGGGG + Intronic
943960552 2:194257216-194257238 GAAAACACTGGGAAGAGAGAAGG + Intergenic
944998721 2:205324737-205324759 GAGGAGGGTTAGAAGAGAGGAGG - Intronic
945122240 2:206468929-206468951 CAGAACAGGAGGAAGAGAGATGG + Intronic
946152584 2:217786251-217786273 GAGAAGAGTGGGACAAGAGGAGG - Intergenic
946426401 2:219600150-219600172 GAGAACAGCTGGAAGCCAGGAGG - Intronic
946467879 2:219928424-219928446 GGGAACTCTTGGGAGAGAGGGGG - Intergenic
947274358 2:228373431-228373453 CAGAGCAGGAGGAAGAGAGGGGG + Intergenic
947295408 2:228625330-228625352 GAGTTCAGTTGGAAGGGAAGGGG + Intergenic
947983826 2:234432249-234432271 GAGAACACGTGGACGACAGGAGG + Intergenic
948557079 2:238820443-238820465 GTGAATAATTGGAAGACAGGAGG + Intergenic
1168744100 20:221437-221459 GAGAAAAGGAGGGAGAGAGGAGG + Intergenic
1169175303 20:3506532-3506554 GAGAACAATTTGAACCGAGGAGG + Intronic
1169252636 20:4072169-4072191 GAGAACAGATGGAATTTAGGAGG + Intronic
1169561211 20:6802810-6802832 AAGAAGAGTAGGAGGAGAGGAGG - Intergenic
1169916580 20:10689602-10689624 GAGGGCAGTTAGAAGAGAGTGGG - Intergenic
1170584600 20:17724996-17725018 GACAGCAGTGGGGAGAGAGGAGG - Intronic
1171397791 20:24849726-24849748 GCAATCATTTGGAAGAGAGGAGG + Intergenic
1171810228 20:29741240-29741262 GAAAACAGAGGGAAGAGAGCCGG - Intergenic
1172425230 20:34851434-34851456 GAGAGCAGTTGGAAGGGTTGTGG - Intronic
1172433441 20:34911905-34911927 GAGAATAGCTTGAAGGGAGGTGG - Intronic
1172460916 20:35117995-35118017 GAGAAAAGTGGGAAGAGATAAGG - Intronic
1173021807 20:39273648-39273670 GAGCACAGAGGGAAGAGAGGAGG + Intergenic
1173140999 20:40482786-40482808 GAGTGTAGTTGGAATAGAGGTGG - Intergenic
1173478485 20:43380544-43380566 GAGATCAGTTAGTAGAGAGATGG - Intergenic
1173883015 20:46433113-46433135 GACAACAGGTGGATGAGATGGGG + Intergenic
1173934908 20:46852755-46852777 AAGAAAACTTGGAAGAAAGGTGG - Intergenic
1174650591 20:52121560-52121582 GAGAAAAGTTGGAAGGTAAGAGG + Intronic
1175134791 20:56815138-56815160 GAGTAACATTGGAAGAGAGGAGG + Intergenic
1175360752 20:58410504-58410526 GAGAACAGTTTGAACCCAGGAGG - Intronic
1175629238 20:60519285-60519307 GAGAACAGATGCCAGTGAGGTGG - Intergenic
1175763696 20:61578651-61578673 GAGATGAGATGGAGGAGAGGTGG - Intronic
1175919101 20:62441740-62441762 AAGAATAGCTGGAGGAGAGGAGG - Intergenic
1176615024 21:9019205-9019227 GAGAACAGTAGACAGGGAGGAGG - Intergenic
1177124308 21:17177349-17177371 GAAAACATATGGAAGACAGGAGG + Intergenic
1177646852 21:23909657-23909679 GAGAATAGTTTGAAGCCAGGAGG + Intergenic
1177872710 21:26592599-26592621 GAGAACAGCTTGAAGCCAGGAGG + Intergenic
1178787184 21:35664489-35664511 GACTACAGATGGAAGAGAGAAGG - Intronic
1178919578 21:36729702-36729724 AAGAACAGATGAAAGAGAGAGGG - Intronic
1179630212 21:42673236-42673258 CAGAGGAGTAGGAAGAGAGGAGG - Intronic
1181067208 22:20312584-20312606 GAGGAGAGGTGGGAGAGAGGAGG + Intergenic
1181093260 22:20488751-20488773 GAGAAGAGAGGGAAGAGAAGAGG + Intronic
1181094599 22:20496533-20496555 GGGAACAAGTGGAGGAGAGGAGG - Intronic
1182127158 22:27824495-27824517 GAGAACAGGAGCAAGAGAGAAGG - Intergenic
1182341558 22:29625809-29625831 GAGAACAGTGGCAAAAGAGTTGG - Intronic
1182780755 22:32865645-32865667 GAGAGCAGTGGGAAGGGATGTGG - Intronic
1183782398 22:40007264-40007286 GAGGAAAGGAGGAAGAGAGGAGG - Intronic
1184981828 22:48100680-48100702 GAGCACAGCTGGGAGAAAGGTGG - Intergenic
1185037356 22:48486449-48486471 GAGATCAGATTGAAGAGATGGGG - Intergenic
1185078527 22:48696330-48696352 GAGAAAAGAGGGAAGAGTGGAGG - Intronic
949202315 3:1394067-1394089 GGGGACAGATGGAGGAGAGGGGG + Intronic
950195347 3:11005599-11005621 GAAAACAGGAGGAAGAAAGGAGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
952248035 3:31618589-31618611 CAGAACAGCAGGAACAGAGGAGG - Intronic
952989622 3:38820526-38820548 GATAGCAGATGGAAGAGTGGTGG + Intergenic
953044387 3:39281734-39281756 GAGCACAGTAGGAAGTGAGAAGG - Exonic
953135359 3:40177181-40177203 GAGAACAGCTTGAGGAAAGGTGG - Intronic
953213577 3:40897500-40897522 GAGAGCAGTTTGAAGCAAGGAGG + Intergenic
953871316 3:46629784-46629806 GAGGAGAGAAGGAAGAGAGGAGG + Intergenic
954510611 3:51121479-51121501 GAAAAGAGTTGGCAGAGAAGGGG + Intronic
954930107 3:54273738-54273760 GAGTACAGGTGTAAGAAAGGAGG - Intronic
955227936 3:57076509-57076531 GAGAACCATTGGAGGAGAGGGGG - Intronic
955410630 3:58653360-58653382 AAGAACAGAAGGAAGGGAGGTGG - Intronic
956131759 3:66060675-66060697 GAGAAAAGTTTGAATTGAGGAGG + Intergenic
956321384 3:68000499-68000521 TAGAACATTTGTAAGAGATGAGG + Intergenic
957008948 3:74983728-74983750 GTGATCACTTGGAAGAGAAGAGG + Intergenic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
957878226 3:86176507-86176529 GAGCACAGTGGGAAAAGATGTGG - Intergenic
958933491 3:100232439-100232461 GGGAAAAGTTGGAGGAGAAGAGG + Intergenic
959864686 3:111252808-111252830 GAGAAAGGGTGGAAAAGAGGAGG + Intronic
959901683 3:111668910-111668932 GAGAACATTTTAAAGACAGGAGG + Intergenic
960164101 3:114382368-114382390 GAGAAAAGTTAGAAGAGATACGG - Intronic
960184963 3:114627092-114627114 GAGTAGAGTTGGAAAAGAGTGGG - Intronic
960279188 3:115762104-115762126 GGGAACAGCTGGATGATAGGAGG - Intergenic
961989061 3:131168146-131168168 GAAAACAATTGAAAGAGAGATGG - Intronic
963008001 3:140744180-140744202 GAGACCAGTAGGAAGGGAGTTGG - Intergenic
963413266 3:144960052-144960074 GAGAACAGGAGCAAGAGATGGGG + Intergenic
963416148 3:144998480-144998502 GCGATCATTTGGAAGAGAAGAGG + Intergenic
963461128 3:145616536-145616558 GTGATCATTTGGAAGAGAAGAGG + Intergenic
963827917 3:149974582-149974604 GAGAAAGGTTGAAAGAGAGGTGG - Intronic
963867440 3:150378029-150378051 GAGGGCAGTTGGCAGAGTGGAGG - Intergenic
964047689 3:152350310-152350332 GAGTAGAATTGGGAGAGAGGAGG + Intronic
964691021 3:159449950-159449972 GAGAAGAGAGGGAAGAGAAGAGG + Intronic
964696868 3:159518281-159518303 GATTGCATTTGGAAGAGAGGAGG + Intronic
964793659 3:160475529-160475551 GATCACAGCAGGAAGAGAGGAGG - Intronic
964895131 3:161586999-161587021 GGGAAGATATGGAAGAGAGGAGG + Intergenic
965321010 3:167251114-167251136 CAGAGCAGTTGGAGGAGAGCTGG + Intronic
966318371 3:178674171-178674193 GAGAAGAGGTAGAAGAGATGAGG - Intronic
967299973 3:188003305-188003327 GAACACACTTGGAGGAGAGGAGG - Intergenic
967895927 3:194396478-194396500 GAGAAGAGGAAGAAGAGAGGAGG + Exonic
969456715 4:7304432-7304454 GAGAACTGATGGAGAAGAGGCGG + Intronic
969656162 4:8499711-8499733 GAGAACAGTGGGCAGAAAGAGGG + Intergenic
969859561 4:10024808-10024830 GGGAAGAGTTGGAAAAGAAGGGG + Intronic
970329329 4:14962986-14963008 AAGAATAGTTGGGAGTGAGGGGG + Intergenic
970714448 4:18905263-18905285 GTGATCATTTGGAAGAGAAGAGG - Intergenic
971234811 4:24831185-24831207 AAGAAGAGCTGGAGGAGAGGTGG + Intronic
971465550 4:26955563-26955585 AAGAAGAGTTGGATGACAGGAGG + Intronic
971881725 4:32383197-32383219 GACCACAGTTGGGAGAGTGGAGG + Intergenic
972229480 4:37054760-37054782 GAGAACAGGGGAAAGAGAGAAGG - Intergenic
972637749 4:40899325-40899347 GAGAACAAATGGGAGAGAAGGGG - Intronic
972977381 4:44653197-44653219 GAGAAAAGTTGAAGGAGATGAGG + Intronic
973185618 4:47324600-47324622 GAGAACAGTTTTAGCAGAGGCGG - Intronic
974822440 4:67084353-67084375 AAGAACAATTGGCAGATAGGAGG - Intergenic
974839471 4:67284208-67284230 GAGAACAGTTTGAACCCAGGAGG - Intergenic
974933581 4:68387595-68387617 GAGAATAGTTTGAACACAGGAGG + Intergenic
975167141 4:71189079-71189101 GAGAACATTTGTAGGAGTGGGGG + Intronic
975272053 4:72447330-72447352 GGTAAGATTTGGAAGAGAGGAGG - Intronic
975367481 4:73545527-73545549 GTGATCCTTTGGAAGAGAGGAGG - Intergenic
975411602 4:74058439-74058461 GAGGAGAGAAGGAAGAGAGGAGG - Intergenic
975417912 4:74127396-74127418 AAGAATTGTTGGAAGTGAGGAGG - Intronic
977801520 4:101239658-101239680 GAGAACAGTTGGGAAAGCAGAGG - Intronic
978206283 4:106084025-106084047 GCGATCATTTGGAGGAGAGGAGG - Intronic
978742515 4:112153259-112153281 GAGAATAGTTTGTACAGAGGAGG - Intronic
980392806 4:132168939-132168961 GTGATCATTTGGAGGAGAGGAGG + Intergenic
980855337 4:138432455-138432477 GCGATCATTTGGAAGAGAAGAGG - Intergenic
981035022 4:140160532-140160554 GTGCAGAGGTGGAAGAGAGGCGG + Intergenic
981710265 4:147701961-147701983 GAGGAGGGTAGGAAGAGAGGAGG + Intergenic
981710269 4:147701977-147701999 GAGGAGGGTAGGAAGAGAGGAGG + Intergenic
981710273 4:147701993-147702015 GAGGAGGGTAGGAAGAGAGGAGG + Intergenic
982314538 4:154018827-154018849 GAACACAGATGGCAGAGAGGAGG + Intergenic
982328590 4:154156617-154156639 GAGAACACATGGAAGAGAAAGGG - Intergenic
984590097 4:181607502-181607524 GAGAACCGTTTGAAGCCAGGAGG - Intergenic
984705852 4:182846597-182846619 GAGAGCCGTGGGAAGTGAGGAGG + Intergenic
984959636 4:185083343-185083365 GAGAACTGTAGGAAGAGAAATGG - Intergenic
985117335 4:186605124-186605146 GAGAACTGTTTGAAGCCAGGAGG + Intronic
985721136 5:1489851-1489873 GATCAGAGCTGGAAGAGAGGAGG + Exonic
985894485 5:2740352-2740374 GGGAACAGTCGCAGGAGAGGGGG - Intergenic
988922023 5:35952260-35952282 GCGAACATTTGGAAAAGAGTGGG + Exonic
992390230 5:76324511-76324533 GAGAAGAGTTTGGATAGAGGAGG + Intronic
992762686 5:79965017-79965039 GACAACAGTGGGAAGAGACAGGG - Intergenic
992869980 5:80996048-80996070 GAGATAAGGTGGAAGAGTGGAGG - Intronic
992888380 5:81181766-81181788 GAGAAGATTTGGAAGGGAGGAGG - Intronic
994935921 5:106254115-106254137 CAGAGCAGGAGGAAGAGAGGGGG - Intergenic
995501855 5:112815844-112815866 GAGAATAGTTGGAACCCAGGAGG + Intronic
995985597 5:118167813-118167835 GAGAACAGAAGAAAGAGAAGGGG + Intergenic
996422903 5:123281438-123281460 GAGAACTGGTGGGAGAGAGAAGG - Intergenic
997382296 5:133446541-133446563 GAGAACACTTGGAGGAGTGGGGG - Intronic
998622179 5:143806938-143806960 TGGAAGAGATGGAAGAGAGGAGG - Intergenic
999435406 5:151559581-151559603 AGGAAGAGCTGGAAGAGAGGAGG - Intronic
999727347 5:154447162-154447184 GAGAGAAGTTGGAAAAGAGCCGG - Intronic
999846076 5:155481636-155481658 TAGAACAGTTTGAAGAGCTGTGG - Intergenic
999905859 5:156140942-156140964 CAGAACAGTTTTAAGAGGGGGGG + Intronic
1000200070 5:158999849-158999871 GTGAACAGTAGGAAAAGAGTTGG - Intronic
1000412749 5:160950604-160950626 GAGACCTGTGGGAAGAGAGGAGG + Intergenic
1000896866 5:166865814-166865836 GAGAAAAGTGGGAAGAGAGATGG + Intergenic
1001434428 5:171688275-171688297 GAGAAGAGTAGGAAGATGGGAGG + Intergenic
1001570237 5:172725970-172725992 GAGAACAGTGCTAGGAGAGGAGG - Intergenic
1001626012 5:173133096-173133118 AAGAAATGTTGGAAGAGAAGAGG - Intronic
1001686809 5:173599515-173599537 TAGAACAGCAGAAAGAGAGGAGG - Intergenic
1001837614 5:174845192-174845214 GGGCAGAGTGGGAAGAGAGGAGG - Intergenic
1001851617 5:174972522-174972544 CAGAACAGTGGGAAGACAAGTGG - Intergenic
1001957080 5:175855139-175855161 GAGAGCAGCTGGATGAGAGCAGG + Intronic
1002874454 6:1199358-1199380 GAGAAGAGATGGAAGAGGGGAGG + Intergenic
1003980159 6:11381837-11381859 GACGACAGTAGGAAGAGGGGAGG + Intronic
1004013250 6:11709468-11709490 GAGAACAGGAGCAAGAGAGATGG + Intergenic
1004146221 6:13069267-13069289 CAGAAGAGGTGCAAGAGAGGTGG - Intronic
1004755227 6:18603179-18603201 GAGAGCATTTGGAAGAAAAGGGG + Intergenic
1004794925 6:19070807-19070829 GAGAACAGACAGAAGAGAGTGGG - Intergenic
1005143669 6:22663150-22663172 GAGCACAGTTGTGAGAGAAGAGG + Intergenic
1006347662 6:33496176-33496198 GACACCAGATGGAAGGGAGGTGG - Intergenic
1006801158 6:36760474-36760496 GAGGACAGAAGGAAGAAAGGAGG + Intronic
1007028465 6:38603127-38603149 AAGAACAGTAGGAAGGCAGGGGG + Intronic
1007176046 6:39898345-39898367 GCGTACAGTTGGAAGAGTTGGGG + Intronic
1008352016 6:50502992-50503014 GGGAACAGTTGGAGGAGAATTGG - Intergenic
1008373439 6:50763414-50763436 AAGAAAAGTTGGAGGGGAGGAGG - Intronic
1008407926 6:51139966-51139988 GAGAACAGAAGGAACAGAGTGGG + Intergenic
1009731676 6:67615915-67615937 GAGAAAAGAGGAAAGAGAGGAGG + Intergenic
1010030065 6:71264613-71264635 GAGGAGAATTGGAAGAGAGCTGG + Intergenic
1010180357 6:73079475-73079497 CAGAACATTTGTCAGAGAGGGGG + Intronic
1010887377 6:81261597-81261619 GAGGAGAGTAGGAAGAGAAGAGG + Intergenic
1011149866 6:84259112-84259134 GAGAACAGCTGAAAGAGGGCTGG - Intergenic
1011187608 6:84696357-84696379 GAGAACAATTGGAAACCAGGAGG - Intronic
1011732174 6:90275877-90275899 GAGAACAGTTTGAACCCAGGAGG + Intronic
1012881923 6:104800801-104800823 GTGAGCAGTTGGAGGAGAAGAGG - Intronic
1013070069 6:106721078-106721100 GAGAAGAGTGGGAAGAGCAGTGG - Intergenic
1013070297 6:106723237-106723259 GAGAAGAGTGGGAAGAGCAGTGG + Intergenic
1013477301 6:110520935-110520957 GAGAGCAGGTAGAAGAGAGAAGG - Intergenic
1013693536 6:112673573-112673595 GAGAAGTGTTGGCAAAGAGGTGG + Intergenic
1014101178 6:117513619-117513641 GAGAATAGTAGGAAGTTAGGTGG + Intronic
1015168852 6:130228849-130228871 GAGCCCACTTGGGAGAGAGGTGG - Intronic
1015280617 6:131430493-131430515 GTGAACAGCGGGAAGAGACGAGG + Intergenic
1015624014 6:135161027-135161049 GAGACCAGTTGGTAAAGATGAGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016446979 6:144143711-144143733 GAGAACGGGTGGGAGGGAGGTGG + Intergenic
1016936470 6:149451910-149451932 GAGAACGGTGGGAACTGAGGCGG - Intronic
1017209415 6:151838332-151838354 GAGAGCAGCAGGAAGAGAGGAGG + Intronic
1017516109 6:155156964-155156986 GAGAACTGTGGGAGGAGAGTGGG - Intronic
1017978622 6:159378947-159378969 CAGACCAGCTGGAAGAGAGAAGG + Intergenic
1018099687 6:160426449-160426471 GGGAAGAGTGGGAATAGAGGAGG - Intronic
1018171475 6:161146611-161146633 GAGAGCAGCTAGCAGAGAGGAGG + Intronic
1018179104 6:161205170-161205192 GAGATCAGGTGGACGAGAGGCGG - Intronic
1018578369 6:165283912-165283934 GAGATCATTTGGAGGAGAAGAGG - Intronic
1018584375 6:165339694-165339716 AAGATCATTTGGAAGAGAGAAGG - Intronic
1019419120 7:942550-942572 GAGAGTAGGAGGAAGAGAGGAGG + Intronic
1019419234 7:942981-943003 GAGAGTAGGAGGAAGAGAGGAGG + Intronic
1019419274 7:943138-943160 GAGAGTAGGAGGAAGAGAGGAGG + Intronic
1020979533 7:15050777-15050799 GAAGACAGATGAAAGAGAGGCGG - Intergenic
1021904925 7:25323789-25323811 GAAAACAGTTAGAAAAGAGAAGG - Intergenic
1021918315 7:25457336-25457358 GGGAACACTTGGTAGGGAGGTGG + Intergenic
1022245755 7:28557681-28557703 GGAAACACTTGGAAGAGATGAGG + Intronic
1022306109 7:29147975-29147997 GAGCCCTGTGGGAAGAGAGGAGG - Intronic
1023095306 7:36654286-36654308 GAGAAAAGGAGGAAGAGAAGAGG - Intronic
1023130030 7:36993482-36993504 GAGAACAGTTTGAAGCGATCTGG - Intronic
1023207300 7:37764355-37764377 GTGATCATTTGGAAGAGAAGAGG - Intronic
1023904554 7:44513106-44513128 GGGAAAAGTTGGATGAGAAGTGG + Exonic
1023966267 7:44964522-44964544 GAGGACAGATGGAGGGGAGGGGG + Intronic
1025934304 7:66022376-66022398 GAGAAAAGTTGGCAGGGATGTGG + Intergenic
1028458394 7:91063074-91063096 CATGAAAGTTGGAAGAGAGGAGG + Intronic
1029217210 7:98959200-98959222 GAGGTCAGGCGGAAGAGAGGTGG + Intronic
1029539646 7:101175042-101175064 GAGAATAGTTTGAAGCGGGGAGG - Intronic
1029604349 7:101589776-101589798 GAGAACAGCTGGAACCCAGGAGG - Intergenic
1029835203 7:103301990-103302012 GAGAACACTTGGACACGAGGTGG - Intronic
1030522740 7:110618462-110618484 GAGAACTGTTGAAAGAGCAGGGG - Intergenic
1031404904 7:121373464-121373486 GAAAATAGTTGTAGGAGAGGAGG - Intronic
1031433638 7:121705451-121705473 TAGGACAGTGGGAAGAGAGGGGG + Intergenic
1031600442 7:123701413-123701435 GAAAACAGTTGAAAAACAGGTGG + Intronic
1031628794 7:124021391-124021413 GGTAAAAGTTGGGAGAGAGGAGG - Intergenic
1031966918 7:128033062-128033084 GAGAACTGGGGGAAGGGAGGCGG + Intronic
1032367846 7:131316541-131316563 GCGATCATTTGGAGGAGAGGAGG - Intronic
1032419609 7:131767574-131767596 GAAAACAGGAGCAAGAGAGGAGG + Intergenic
1032731344 7:134646447-134646469 GCGGACTCTTGGAAGAGAGGAGG - Intergenic
1032776942 7:135122980-135123002 GCGATCATTTGGAGGAGAGGAGG - Intronic
1032838343 7:135694172-135694194 GGGAACAGTTGTCAGAGAAGAGG - Exonic
1032918370 7:136517609-136517631 GAGAACAGATGGAGAAAAGGAGG - Intergenic
1032975897 7:137221862-137221884 GAGAATAGTTACTAGAGAGGTGG - Intergenic
1033390852 7:140925715-140925737 GAAAACAATTGGGAGAGAAGAGG + Intergenic
1033590370 7:142803612-142803634 GAGAAAGGTTGGGAAAGAGGAGG + Intergenic
1034760099 7:153664344-153664366 GAGAACACTTGGCAGAGAGTTGG - Intergenic
1035052903 7:156013657-156013679 GAGAACACCAGGAAGAGAGGAGG - Intergenic
1036059608 8:5301318-5301340 GAGAAAAGTTGAAAAACAGGAGG + Intergenic
1037834186 8:22206744-22206766 GACAAGAGATGGAAGAAAGGAGG + Intronic
1038287813 8:26221390-26221412 GAGAATAGTTTGAAAACAGGAGG + Intergenic
1039290566 8:36089903-36089925 GAGAGCAGTTGGAGGACAGTTGG - Intergenic
1041977980 8:63821162-63821184 GAATACAGTTGTAAGAAAGGGGG + Intergenic
1043472380 8:80575645-80575667 GGGAACATTTGGAACAGAGGTGG - Intergenic
1043529609 8:81135027-81135049 GAGAAAAGTTGGCAGATATGGGG - Intergenic
1044464310 8:92485794-92485816 GTGAACAATGGTAAGAGAGGTGG + Intergenic
1044919452 8:97153372-97153394 AAGAACAGTTGGAAAACAAGTGG + Intergenic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1045343639 8:101275154-101275176 GAGAGCAGATGGGAGAGAAGGGG - Intergenic
1045497403 8:102719992-102720014 GAGAAGAGTTGGAGAAGAGTTGG - Intergenic
1046112120 8:109737907-109737929 GGGAAAAGTTGGAAAAGATGAGG + Intergenic
1046332045 8:112730411-112730433 GAAAATAGTTGGAAGTGAGTAGG + Intronic
1046595158 8:116252609-116252631 AAGAACAACTGGAAGAGTGGAGG + Intergenic
1046657584 8:116912422-116912444 GAGATCATTTGGAGGAGAAGAGG + Intergenic
1046659475 8:116933703-116933725 GAGAACACTTAGAAGAGAGCAGG - Intergenic
1046692740 8:117304150-117304172 AATTAGAGTTGGAAGAGAGGAGG + Intergenic
1047609993 8:126511643-126511665 CAGGACAGTGGGAAGAGAGGAGG - Intergenic
1047826996 8:128587622-128587644 AAGAACAGTAGGAACAGAAGAGG - Intergenic
1048307213 8:133292736-133292758 GAGTTCTGTTTGAAGAGAGGTGG - Intronic
1048445565 8:134490330-134490352 GACGACAGTTGGAAGAGATTGGG - Intronic
1048734829 8:137487726-137487748 CAGAACAGTTCCAAGAGTGGTGG + Intergenic
1049334180 8:142073805-142073827 CAGAGCAGGAGGAAGAGAGGTGG + Intergenic
1049896855 9:117311-117333 GAGAGCAGTAGGTAGCGAGGAGG + Exonic
1049999537 9:1062285-1062307 GAGAACAGGGTGAAGAGAAGGGG - Intergenic
1050099402 9:2102397-2102419 GAGAACAGTTCTCAGAGTGGAGG + Intronic
1051546066 9:18276707-18276729 GAGAACAGGAGCAAGAGAGGAGG + Intergenic
1051681410 9:19611453-19611475 GAGGATAGGAGGAAGAGAGGAGG + Intronic
1052554280 9:29993707-29993729 GAGAACTGTAGGAAGAGAGATGG + Intergenic
1052813682 9:33083501-33083523 GAGAACACTTGGACATGAGGTGG + Intergenic
1054196062 9:62033321-62033343 GAAAGCAGTTCGAAGGGAGGAGG - Intergenic
1054642343 9:67555368-67555390 GAAAGCAGTTCGAAGGGAGGAGG + Intergenic
1054986273 9:71265377-71265399 GAAATCATTTGGATGAGAGGTGG + Intronic
1055359233 9:75471604-75471626 GAAACCATTTGGAAGAGAGAAGG + Intergenic
1055395964 9:75875675-75875697 GAGAACAGTTGAAAGGGACCTGG - Intergenic
1057134757 9:92680033-92680055 CTGAACGGTTGGAAGAGAGGAGG + Intergenic
1058113518 9:101057910-101057932 GAGTACATTTGGAGGTGAGGAGG + Intronic
1058309968 9:103487331-103487353 AAAAAGAGTTGGAAGAGAGTTGG - Intergenic
1058349749 9:104008158-104008180 GAGAGAAGTGGGAAGAGAGAAGG + Intergenic
1058818009 9:108703422-108703444 GAGGCCAGCTGGAAGAGTGGAGG + Intergenic
1059395527 9:114031980-114032002 GAGAGCACTTGGAAGAGGGTGGG + Intronic
1059836719 9:118163065-118163087 GAGAATAGTTTGAACACAGGAGG - Intergenic
1060542118 9:124438158-124438180 GAGAAGAGTTGGGGGAGAGCTGG - Intergenic
1060651091 9:125327897-125327919 GAGAACAGATGAAAGAAAGCTGG - Intronic
1060985668 9:127817741-127817763 GAGACCTGAGGGAAGAGAGGCGG - Intronic
1061075343 9:128337989-128338011 GAGGACAGGTGGAAGTGAGATGG - Intergenic
1061541191 9:131278449-131278471 GAGAGCAGTTTGGGGAGAGGTGG + Intergenic
1062561222 9:137142922-137142944 AACATCAGCTGGAAGAGAGGAGG + Intronic
1062582554 9:137234947-137234969 GAGAAAATGTGGAAGTGAGGAGG - Intronic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186997688 X:15141122-15141144 GAGCAGAGGTGGAAGAGAAGAGG - Intergenic
1187250953 X:17597500-17597522 GTGAGCATTTGGAAGAGAGCTGG + Intronic
1187284620 X:17892943-17892965 GTGGAGAGGTGGAAGAGAGGTGG + Intergenic
1187431423 X:19228678-19228700 AAGAACAGCCGGCAGAGAGGTGG + Intergenic
1187960671 X:24563828-24563850 GGGAACAGATGGCAGTGAGGCGG + Intronic
1189882838 X:45509611-45509633 GAGAACAGGTGAGAGAGAGGAGG + Intergenic
1189918523 X:45880707-45880729 GAGAGCAGAGGCAAGAGAGGGGG - Intergenic
1190224943 X:48538112-48538134 GGGACCAGTTGAAAGAGAAGTGG - Intergenic
1190232184 X:48590646-48590668 GAGGACAGATTGAGGAGAGGGGG + Intronic
1190529744 X:51362382-51362404 GAGACCACTTGGAAGAGAAAAGG - Intergenic
1192000361 X:67143565-67143587 ACAAAGAGTTGGAAGAGAGGAGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193011583 X:76681562-76681584 GACAACAGTTGGAAAGAAGGAGG + Intergenic
1193615887 X:83687970-83687992 GTGAACCTTTGGAAGAGAAGAGG + Intergenic
1194323519 X:92481222-92481244 CAGTACAGTGGGGAGAGAGGAGG + Intronic
1194421211 X:93674479-93674501 AAGAACAGTGGGATGGGAGGGGG + Intronic
1194899983 X:99498018-99498040 TAGAACAATTGGAAGAGCAGTGG - Intergenic
1195410791 X:104566424-104566446 GCGAACAGGAGGGAGAGAGGTGG + Exonic
1196197192 X:112848547-112848569 GCGAAGAGTGGGAAGAGAGTGGG - Intergenic
1196315468 X:114217201-114217223 GAGCATAGGTGAAAGAGAGGTGG - Intergenic
1196774450 X:119325710-119325732 GACCACAGTTGGCAGAGAGTTGG - Intergenic
1197479945 X:126970389-126970411 GAGAACAGTTGGACAAAAAGTGG + Intergenic
1197869651 X:131052999-131053021 GAGAATAGTGGGAACAAAGGGGG - Intergenic
1198082330 X:133251678-133251700 CAGACCAGCTGGAAGGGAGGTGG + Intergenic
1198448255 X:136740096-136740118 GAGAATAGTTTGAATCGAGGAGG - Intronic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic
1199886644 X:152027407-152027429 GAGCACAGATGGAAAAGAGGAGG + Intergenic
1199907994 X:152254587-152254609 GAGAGAAGTTGGATGAGAGATGG - Intronic
1199953639 X:152725350-152725372 GAGAGAAGGGGGAAGAGAGGAGG + Intergenic
1199956041 X:152743100-152743122 GAGAGAAGGGGGAAGAGAGGAGG - Intergenic
1200176923 X:154123415-154123437 GAGGACAGGTGGGAGAGGGGAGG + Intergenic
1200631621 Y:5594388-5594410 CAGTACAGTGGGGAGAGAGGAGG + Intronic
1202202098 Y:22363975-22363997 GAGAATGGTTAGAAGAGTGGAGG + Intronic