ID: 1118254741

View in Genome Browser
Species Human (GRCh38)
Location 14:64195833-64195855
Sequence CAGTGGGACTGGAAGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118254741 Original CRISPR CAGTGGGACTGGAAGGATTT AGG Intronic
902685905 1:18077518-18077540 CAGTGGGAAAGGCAGGGTTTAGG + Intergenic
903539158 1:24087079-24087101 CCGAGGGACTGGAAGGATGGGGG - Intronic
903744780 1:25579395-25579417 CAGAGGAACTGATAGGATTTAGG + Intergenic
909350038 1:74641215-74641237 CAGTAGGACTGGCAGCATTACGG + Intronic
910420417 1:87055420-87055442 CATGGGGACTGGAAGGAGATAGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
914377974 1:147089979-147090001 CAGTGGCAGTGGAAAAATTTGGG - Intergenic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915345609 1:155195375-155195397 AAGTGGGTCTGGGAGGACTTCGG + Intergenic
915540892 1:156565335-156565357 CAGTGGGACTGGAACACTCTAGG - Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
916511192 1:165473746-165473768 GAGTGGGATGGGGAGGATTTTGG - Intergenic
917934008 1:179846610-179846632 CAGTGGGGTTGGAAGCATTGAGG + Exonic
919818285 1:201455861-201455883 CAGGGTGCCTGGAAGGATGTGGG - Intergenic
919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG + Intergenic
922062528 1:222105955-222105977 CAGTGGGACTGGAAGCAGAGAGG - Intergenic
922821906 1:228490403-228490425 AAGTGAGGCTGGAAGGCTTTGGG + Intronic
1063794090 10:9491056-9491078 CAGTGGGACCAGAAGGCCTTTGG + Intergenic
1065612986 10:27490950-27490972 CAATGGGACTGGCAGGAATGAGG + Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1068797359 10:61098290-61098312 CAGGGAGATTGGAAGGATATGGG - Intergenic
1070435866 10:76392442-76392464 AAATGGCACTGGAAGTATTTTGG + Intronic
1070635839 10:78126531-78126553 GAGTGGGACTTGAAGGGTATGGG - Intergenic
1071374841 10:84991869-84991891 CAGTGGCAGGGGAAGAATTTAGG - Intergenic
1071685349 10:87749150-87749172 CAGTAGGGCTGGAAGCAGTTGGG + Intergenic
1072219699 10:93316934-93316956 CAGATAGAGTGGAAGGATTTAGG - Intronic
1072394360 10:95023507-95023529 CATTGGGACTGGTTGGACTTTGG - Intergenic
1072670558 10:97426167-97426189 CAGAGCGAGTGGAAAGATTTGGG + Exonic
1074837302 10:117309562-117309584 CACTGGGAATGGAGGGTTTTTGG - Intronic
1076485901 10:130816786-130816808 CAGTGGGTTTGGAAGGAGTCAGG - Intergenic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077974887 11:7237787-7237809 CAGTGTTATTGGAAGCATTTGGG + Intergenic
1078190990 11:9092066-9092088 AGGTGGGAGTGGAAGGAATTGGG + Intronic
1078523253 11:12080491-12080513 CAGAGGGCCTGGAATGTTTTGGG + Intergenic
1081718187 11:45266477-45266499 GAGAGGGAGTGGAAGGATTATGG - Intronic
1083250079 11:61460747-61460769 CAGTGGGGGTGGATGGATCTTGG - Intronic
1085048895 11:73369409-73369431 CAGTGGGCCTGGATGGAGCTTGG + Intergenic
1085746636 11:79120505-79120527 CATTGTTACTGGTAGGATTTGGG + Intronic
1087116231 11:94528081-94528103 CAGTGGCCCTGGAAGGGATTTGG + Intergenic
1087715691 11:101606251-101606273 CAGTATAACTGGAAAGATTTGGG + Intronic
1089157427 11:116413367-116413389 CTGTGGGCCTGGGAGGGTTTGGG - Intergenic
1089462292 11:118660263-118660285 GAGAGGGAGTGGAAGGATTTTGG + Intronic
1089607776 11:119651647-119651669 CAGTGGGAGTGGGGGGATTGGGG - Intronic
1092103055 12:5901953-5901975 CAGTTGCTCTGGAGGGATTTCGG + Intronic
1092982037 12:13805882-13805904 CATTGGGAGTTGAAGGAATTGGG - Intronic
1095367684 12:41427718-41427740 AAGTGGGAATTGAATGATTTAGG + Intronic
1096591832 12:52665223-52665245 GATAGGGACTGGGAGGATTTAGG - Intergenic
1100754572 12:97736200-97736222 CAGTGGCACAGGAAGAATGTGGG + Intergenic
1100781733 12:98033968-98033990 GTCTGGCACTGGAAGGATTTGGG + Intergenic
1100924893 12:99533960-99533982 CACAGGGATTGGAAGGTTTTGGG - Intronic
1102742069 12:115216757-115216779 CTGTGCCACTGGATGGATTTAGG + Intergenic
1103148798 12:118618972-118618994 GAATAGGACAGGAAGGATTTTGG - Intergenic
1103458446 12:121085653-121085675 CCGTGGGGGTGGGAGGATTTGGG - Intergenic
1103971187 12:124673932-124673954 CAGTGGGAGCAGAAGGATCTGGG - Intergenic
1103980830 12:124736129-124736151 CAGTGGGGTGGGAAGCATTTGGG - Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1104730229 12:131101267-131101289 CAGTGGGCCAGGCAGGCTTTTGG + Intronic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1105416516 13:20217904-20217926 AGGTGGGACGGGAAGGAGTTGGG + Intergenic
1105567879 13:21569326-21569348 CAGTGGGAGTTGAAAGGTTTGGG - Intronic
1106021404 13:25919400-25919422 CTGAGAGACTGGAGGGATTTGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1108334976 13:49431125-49431147 CAAAGGGACAGGAAAGATTTAGG - Intronic
1113018135 13:105851525-105851547 CAGTTGTCCTGGAATGATTTGGG - Intergenic
1113811626 13:113146276-113146298 GCCTGGGACTGGGAGGATTTCGG - Intronic
1114499888 14:23160863-23160885 TAGTGGGAGTGGAGGGAGTTAGG - Intronic
1114539928 14:23447511-23447533 CAGTAGGCCTGGAAGGACCTGGG - Intergenic
1115816026 14:37165524-37165546 GAGTGGGACTGGCAGACTTTGGG + Intronic
1115825844 14:37273683-37273705 CAATGTGACTCTAAGGATTTTGG - Intronic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1119180687 14:72603258-72603280 CAGCAAGACTTGAAGGATTTGGG + Intergenic
1119537942 14:75418292-75418314 CAGTGGGTCTGGAAGAATTATGG + Intergenic
1120546077 14:85813057-85813079 CTTTGGGACTGGAAGGAGTAAGG + Intergenic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1121776773 14:96596488-96596510 CACAGTGACTGGAAGCATTTTGG - Intergenic
1123033270 14:105461117-105461139 CAGTGTGACAGGAAGGACTATGG - Intronic
1123807592 15:23890368-23890390 CAGAGGGGCTGTAAGTATTTTGG + Intergenic
1123990360 15:25678906-25678928 CAGTGAGACTGGAAGCCTCTGGG + Exonic
1125753443 15:42046075-42046097 CAGTAGGAGTGGATGGATTCTGG - Intronic
1127391934 15:58512745-58512767 CAGTGGCACTGGAACGAGGTAGG + Intronic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1130567855 15:85012927-85012949 GAGTGGGAGTGGGAGAATTTTGG + Intronic
1131145524 15:90009157-90009179 CGGTGGGACTGCAAGGATATGGG + Intronic
1131677011 15:94680880-94680902 CTGAGAGACTGGAAGGATATAGG - Intergenic
1131835335 15:96384461-96384483 AAGAGGGACTGGAACCATTTTGG + Intergenic
1132957583 16:2603671-2603693 AAGAGGTACAGGAAGGATTTCGG - Intergenic
1132970040 16:2682744-2682766 AAGCGGTACAGGAAGGATTTCGG - Exonic
1133438208 16:5798436-5798458 CAGGTGGACTGGGAGGATATGGG + Intergenic
1134215794 16:12316195-12316217 CAGTGGGGCGGGAAGAATTTGGG + Intronic
1136156857 16:28388848-28388870 CTGTGGGACTGGAAGGTTCTGGG - Intronic
1136206229 16:28726433-28726455 CTGTGGGACTGGAAGGTTCTGGG + Intronic
1136667644 16:31826898-31826920 CAGTGTGATTGGTATGATTTTGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138532634 16:57643131-57643153 CATGGGGACTGGGAGGATGTGGG + Intronic
1140525561 16:75619973-75619995 CATTAGGTCTGGAAGGCTTTGGG - Intronic
1140585350 16:76284520-76284542 CATTGGAATTGGAAGGATTCAGG + Intronic
1141513449 16:84527191-84527213 CAGAGGGACTGGAAGGACTTTGG - Intronic
1142206951 16:88787860-88787882 CAGTGGGACAGGAGTGACTTTGG - Intergenic
1143993215 17:10984756-10984778 CTCTGAGACTAGAAGGATTTGGG - Intergenic
1145875797 17:28317697-28317719 CGGAGGGAATGGAAGGATTGGGG - Intergenic
1149596473 17:57867462-57867484 CAGTGGGACTGGGAGGACTAGGG - Intronic
1149661217 17:58334956-58334978 CAGGGTGACTGGAAGGAGCTGGG + Intergenic
1151763431 17:76120354-76120376 CTGTGGGGCAGGAAGGATTTGGG + Intronic
1152055005 17:78017705-78017727 CAGAGACCCTGGAAGGATTTTGG - Intronic
1152511414 17:80792026-80792048 CAATGGGACTGGAAGGATTATGG - Intronic
1152789650 17:82272441-82272463 CAATGGGATTAGAAGGTTTTGGG - Intronic
1153344612 18:4012117-4012139 CACTGAGACTGGAAGCAGTTAGG - Intronic
1153482825 18:5564751-5564773 CAGTAGGAGTGGGAGGAGTTGGG - Intronic
1154020636 18:10661479-10661501 CAGTGGGAGGGGAATGATCTTGG + Intergenic
1155408316 18:25513965-25513987 GAGTAAGACTGGAAGGATCTTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159019461 18:63131482-63131504 CAGTGGGGCAGGAAGGAGTCAGG + Intronic
1160446707 18:78933850-78933872 CCCTGGGCCTGGAGGGATTTTGG - Intergenic
1161332376 19:3694470-3694492 CGAGGGGCCTGGAAGGATTTTGG - Intronic
1163145713 19:15378402-15378424 CAGTGTGTCTGAAAGGTTTTCGG + Intronic
1164514313 19:28921314-28921336 AGGTGGGCCTGGAAGGATTTGGG + Intergenic
1165636571 19:37345301-37345323 CATTGGGACTGGCTGGGTTTGGG + Intronic
1167854770 19:52228680-52228702 CAGTGTGACTGCTGGGATTTAGG - Exonic
1168095107 19:54109986-54110008 CAGAGGGGCTGGGAGCATTTGGG + Intronic
925543023 2:4987090-4987112 AAGTGGGACTTGGAGAATTTTGG - Intergenic
925670362 2:6304168-6304190 CAATGGGACTAGAAGAAATTTGG - Intergenic
926060732 2:9803107-9803129 CATTTGGACTGGAAGGTCTTCGG + Intergenic
926167538 2:10530854-10530876 CACTGGGACTGCAGGGACTTGGG + Intergenic
926443979 2:12921559-12921581 TAGTGTGACTTGAAGGATGTGGG + Intergenic
927506825 2:23620282-23620304 CAATGGGATTGGAAGGTGTTAGG + Intronic
927561931 2:24079900-24079922 CAGTGGGACTGTACTTATTTTGG - Intronic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
930721437 2:54641838-54641860 CAGTGGGAGTGGAAGGGCCTTGG + Intronic
931382873 2:61769691-61769713 TAGTGGGTAGGGAAGGATTTGGG + Intergenic
931976956 2:67653692-67653714 CACTGGGCCTGGAAGGCTTAGGG + Intergenic
932231878 2:70089629-70089651 CAGTGGGCCGGGGAGGATTGGGG + Intergenic
933147542 2:78873014-78873036 CAGTGAGCCTGGAAGGAGCTTGG + Intergenic
934958181 2:98642283-98642305 CAGTGGCAATGGAAGGACTCTGG + Intronic
935095163 2:99937071-99937093 TGCTGGGACTGGAAGCATTTTGG + Intronic
935250231 2:101254221-101254243 CAACGGGACCTGAAGGATTTAGG + Intronic
935282279 2:101528590-101528612 CTTAGGCACTGGAAGGATTTGGG - Intergenic
935655905 2:105422834-105422856 CAGTGGTTCTGCAATGATTTTGG - Intronic
935814010 2:106829492-106829514 CAAAGGGACTGGATGGATGTGGG + Intronic
935828748 2:106977269-106977291 CAGTGTGATTGGAAGAATCTGGG - Intergenic
939014090 2:136881100-136881122 CATTAGGACTTGAAGGAGTTGGG - Intronic
940997913 2:160170463-160170485 GACTGGCACTGGAGGGATTTAGG - Intronic
941099983 2:161284801-161284823 CAGTGGGAGTGGAAAGGATTAGG - Intergenic
941860011 2:170269376-170269398 CATTGGGAAAGGAGGGATTTAGG - Intronic
943283321 2:185965086-185965108 CAGTGGGAATGGCAGGCTCTAGG - Intergenic
943724454 2:191238542-191238564 CAGTGGGACTAAAAGTATTTAGG + Intergenic
944237542 2:197453720-197453742 TTGGGGGACCGGAAGGATTTGGG + Intronic
947011978 2:225576171-225576193 AAGTGGGACTGAAAGGGTCTTGG - Intronic
1169653237 20:7893162-7893184 CAGTGGGAGTGGGAGAGTTTTGG - Intronic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1171816777 20:29792725-29792747 CAGTGAGGATGGATGGATTTTGG - Intergenic
1172611615 20:36256631-36256653 CAGCGGGACTGGGAAGATTTAGG - Exonic
1172767627 20:37359161-37359183 CTGTGGGACTGGACAGATCTGGG + Intronic
1174412580 20:50345586-50345608 CAGAGGGACTGGGAAGATCTGGG - Intergenic
1174888993 20:54369290-54369312 CTGTGGGATTGGATGGATCTCGG + Intergenic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1179280097 21:39926550-39926572 CTCTGGGAGTAGAAGGATTTGGG + Intronic
1179342662 21:40527165-40527187 CAGTGTGGCTGGAAGCATTTAGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183391102 22:37546103-37546125 CAGCGGGACGGGAAGGAATCTGG + Intergenic
1183709498 22:39494546-39494568 CAGTGAGACTGGAGGGGCTTGGG + Intergenic
1185006212 22:48278354-48278376 CAGTGGAACTGGGAGGACTTGGG - Intergenic
949655914 3:6219253-6219275 CAATGGGTCAGGAAAGATTTGGG - Intergenic
950072670 3:10165027-10165049 GAGTGGGACTGGATGGAGTTCGG + Exonic
950787977 3:15451471-15451493 CAGTCTGACTGGAAGAATTTAGG - Exonic
951212552 3:19991586-19991608 TATGGGGAGTGGAAGGATTTAGG + Intronic
953918307 3:46934837-46934859 CAGTGGGACTGAAAGAACTCAGG + Intronic
955722953 3:61903029-61903051 CAATGAGACTGGAAGGAGTTTGG - Intronic
956396672 3:68833209-68833231 CAGTGGGACTGGTTGGATAGTGG - Intronic
961226226 3:125250020-125250042 AAGGGGGAATGGGAGGATTTTGG + Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962162897 3:133018279-133018301 CACTTGGACTGGGACGATTTAGG + Intergenic
962354618 3:134683103-134683125 AAGTGGGAATGGAAGTTTTTAGG + Intronic
963643235 3:147883004-147883026 GTGTGGGACTGGAAGGTTCTTGG - Intergenic
964912985 3:161804411-161804433 CAGTGGTAATGGAACTATTTGGG - Intergenic
968554095 4:1238630-1238652 CAGAGGGTCTGGGAGGATCTCGG - Intronic
969431117 4:7154883-7154905 CACTGGGGCTGGAAGGAATGGGG - Intergenic
969577333 4:8044048-8044070 CAGTGGCACTGTCAGGATTAAGG + Intronic
971052517 4:22877362-22877384 CAGTGGGACTGGCAAGAGTAGGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
975430914 4:74289799-74289821 AAGTGTGACTCAAAGGATTTTGG + Intronic
976281651 4:83332739-83332761 CAGTGGGACTTCCAGGATCTGGG - Intronic
977290810 4:95162418-95162440 CGGTGGGACAGAAAGGCTTTGGG - Intergenic
981247624 4:142558335-142558357 CAATGGGAATGTAAGGAATTGGG - Intronic
981707289 4:147673980-147674002 CACTTGGATTGGCAGGATTTGGG - Intronic
982233900 4:153234277-153234299 CAGTGTGACTGCAAGGATAAAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987173205 5:15280269-15280291 CAGTCTGACTGTAAGGGTTTCGG + Intergenic
987291142 5:16509433-16509455 CACTGGCACAGGAAGGATTGTGG + Intronic
987906773 5:24088176-24088198 CAGTGGGAATGAATGGATTGGGG - Intronic
988800383 5:34691060-34691082 CACTGGGAATGGGAGAATTTGGG + Intronic
988852386 5:35192524-35192546 AAGTGTGAATGGGAGGATTTGGG + Intronic
989184163 5:38606736-38606758 CAGTGGGACAGGCATGAATTTGG - Intronic
990499925 5:56385834-56385856 CCTTAGGACTGGAATGATTTTGG - Intergenic
990698868 5:58453539-58453561 CAGTGGCACTGGAAGTGTTTAGG + Intergenic
991126273 5:63073181-63073203 CAGTGGAAGTGGAAAGATATGGG - Intergenic
991575683 5:68101006-68101028 CAGTGTTACTGCAATGATTTGGG + Intergenic
991955763 5:71994705-71994727 CAGTGGGACTGGCTTGGTTTGGG + Intergenic
992201249 5:74386509-74386531 AAGTGGGAATGCAAAGATTTGGG + Intergenic
993668294 5:90728220-90728242 CATGGGGACAGAAAGGATTTAGG + Intronic
994870848 5:105349050-105349072 CACGGGGAATGGAATGATTTGGG - Intergenic
994947827 5:106418437-106418459 CAGTGGTAATGGAACTATTTGGG + Intergenic
995102509 5:108330480-108330502 CAGTTGGCCTAGAAGGTTTTGGG - Intronic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
998416191 5:141947853-141947875 CAGGGGCACTGTAAGGAGTTGGG - Intronic
998690212 5:144579891-144579913 CTGGGGGACTGGCAGAATTTCGG + Intergenic
1000237616 5:159377069-159377091 CAGTGGGACTACCAGGCTTTGGG - Intergenic
1002528176 5:179826958-179826980 CAGAGTGAGTGGCAGGATTTAGG - Intronic
1003806705 6:9733447-9733469 CTGAAGGACTGGTAGGATTTGGG + Intronic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1006320782 6:33318059-33318081 CAGTGGGACTGTAAGGAGCTAGG - Intergenic
1007031955 6:38636600-38636622 CAATGGGAATGGATAGATTTTGG - Intronic
1007389995 6:41545583-41545605 CAGGGGGACTGGAGGGATTGTGG - Intergenic
1008679377 6:53856307-53856329 CAGTGGCTCTTGAGGGATTTAGG + Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1011009452 6:82687288-82687310 CAGTGTGACTGGCAGCATGTGGG - Intergenic
1011420187 6:87163744-87163766 CATTGGATCTTGAAGGATTTTGG + Intronic
1013735355 6:113220938-113220960 CAGTGGCACAGAAAGTATTTTGG + Intergenic
1014320056 6:119916304-119916326 CAGTGGGATAGGTAGGAATTGGG - Intergenic
1014635869 6:123845699-123845721 CAGTGAGTCTGCATGGATTTTGG + Intronic
1014947437 6:127515454-127515476 GAGTGGGCCTGGGAGGATTAGGG - Intronic
1016798876 6:148147760-148147782 CAGTTGGACTGTAAGTATATGGG + Intergenic
1021234882 7:18130651-18130673 CATCGGGAATGGAGGGATTTAGG - Intronic
1021813596 7:24426596-24426618 CAGTTTGGCTGGAAGGAATTAGG - Intergenic
1023651482 7:42373837-42373859 TAGTCGGAGTGGAAGGACTTTGG + Intergenic
1025978981 7:66392430-66392452 CAGTGGGTATGGGTGGATTTTGG + Intronic
1029558814 7:101289189-101289211 CAGTGGGTCTGGAAGGCTAGTGG - Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030927147 7:115472299-115472321 CAGTGTGCCTTCAAGGATTTTGG + Intergenic
1031116937 7:117679069-117679091 TGGTGGGATGGGAAGGATTTAGG + Intronic
1032698880 7:134361364-134361386 CAGTGGGGCGGGATGGTTTTGGG + Intergenic
1034337919 7:150335275-150335297 CAGTGGGAATGGAATCTTTTGGG - Intronic
1035056749 7:156040834-156040856 TAGTGGGACTGGAATGAGTAAGG + Intergenic
1037902563 8:22696020-22696042 CAGAGGCAGTGGAAGCATTTGGG + Intergenic
1038081656 8:24144120-24144142 CAGTGGGAGTGAAAAGATCTGGG + Intergenic
1039045989 8:33449866-33449888 AAGTGGGCCTTGAAGGATATTGG - Intronic
1040681944 8:49821021-49821043 AGGTGGGACTGGGAGGATTTGGG + Intergenic
1040871392 8:52103090-52103112 CTGTAGGGCTGGAAGCATTTTGG + Intergenic
1049102212 8:140587979-140588001 CAGTGGGCCTGGAAGTAGTGGGG - Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049482532 8:142833657-142833679 CATTGGCACTAGTAGGATTTTGG - Intergenic
1049483181 8:142837364-142837386 CATTGGCACTAGTAGGATTTTGG + Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1057925347 9:99142077-99142099 CAGTGGGAATGGAAGAGTATGGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060192981 9:121604607-121604629 CAGAGGGGCAGGAAGAATTTGGG - Intronic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1062322813 9:135998611-135998633 CAGAGGGGCTGGCAGGATTCTGG - Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1188813650 X:34684377-34684399 CAGTGGGAGTGGTATCATTTTGG + Intergenic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1189407328 X:40736334-40736356 GTGTGGGACTGACAGGATTTGGG - Intergenic
1195268678 X:103210082-103210104 GAGTGAGCCTGGAAGGAGTTGGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1197881603 X:131172337-131172359 CAGGGTTACTGTAAGGATTTTGG + Intergenic
1198488633 X:137114948-137114970 CAGTGTGATTGCAAGGATATTGG + Intergenic
1199670445 X:150143419-150143441 CAGTGTAACTGGAAGAGTTTGGG + Intergenic