ID: 1118259326

View in Genome Browser
Species Human (GRCh38)
Location 14:64232976-64232998
Sequence CTGAGAGTTGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118259315_1118259326 20 Left 1118259315 14:64232933-64232955 CCCTCTGCTAACAAGGGAAACTA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 75
4: 595
1118259318_1118259326 -9 Left 1118259318 14:64232962-64232984 CCTCACACCGACTCCTGAGAGTT 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 75
4: 595
1118259316_1118259326 19 Left 1118259316 14:64232934-64232956 CCTCTGCTAACAAGGGAAACTAT 0: 1
1: 0
2: 2
3: 9
4: 119
Right 1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG 0: 1
1: 0
2: 2
3: 75
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118259326 Original CRISPR CTGAGAGTTGGGAAGGTGGA GGG Intronic
900171395 1:1270866-1270888 TTGGGAGTTGGGAACGAGGAGGG - Intronic
900422808 1:2562926-2562948 AGGGGAGGTGGGAAGGTGGAGGG - Intronic
900475199 1:2873199-2873221 CAGGGAGTTGGGGAGGAGGAAGG - Intergenic
900641931 1:3691668-3691690 CTGCTAATTGAGAAGGTGGAAGG + Intronic
900671610 1:3857932-3857954 CCGAGAGGTGGGAAGAGGGAAGG - Intronic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
901228199 1:7626811-7626833 CAGAGAGTAGTGAAGGTGGGAGG - Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901411620 1:9088249-9088271 CAGAGAGTTGAGAATATGGAGGG - Intronic
901732524 1:11290512-11290534 CTTTGAGTAGGGGAGGTGGATGG - Intronic
903265151 1:22153741-22153763 ATGTGTGTTGGGGAGGTGGATGG + Intergenic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
903463380 1:23534840-23534862 CTGGGAGATGGGAAAGTGTAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904482862 1:30805178-30805200 CACAGAGCTGGGAAGGTGGGTGG + Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
907661183 1:56393978-56394000 CAGATGGTTGGGGAGGTGGAAGG - Intergenic
908338574 1:63152737-63152759 ATGAGAGTTGGGAGCTTGGAAGG - Intergenic
908349175 1:63267135-63267157 GTGGGAGTTGGGGAGGGGGACGG + Intergenic
909503270 1:76359050-76359072 CTGAGAGTAGGGTAGGAAGAAGG + Intronic
909663656 1:78110617-78110639 CTGAGAGTTGCCTAGGTGGGAGG + Intronic
910067789 1:83174350-83174372 CCTTCAGTTGGGAAGGTGGAGGG + Intergenic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910253438 1:85222215-85222237 CAGAGAGTTGGGGATGTGAAGGG - Intergenic
911048732 1:93651369-93651391 CTGGCAGATGGGAAGCTGGATGG + Intronic
911210479 1:95133630-95133652 CTGAGAATGGGGTAGATGGATGG + Intronic
911855235 1:102868420-102868442 ATGAGATTTGGGAAGGGGAAAGG - Intergenic
911979647 1:104551065-104551087 CTGAGGGTTGGGGAGGTGAGGGG + Intergenic
912630052 1:111239018-111239040 CTGAGTGTTGCGAAGGGGAAAGG + Intronic
913068497 1:115279340-115279362 CTGAGAGTTTGGAATTTGGTAGG + Intergenic
915776566 1:158495018-158495040 CTGAGTGTTGGGAAAGAGGCTGG - Intergenic
915892042 1:159781602-159781624 CTGTGAGTTGTGAAGGAGAAGGG + Intronic
916415955 1:164592105-164592127 ATGGGGGTTGGGAAGCTGGAGGG + Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918963182 1:191306529-191306551 CTGAGAGCTGGGAAGATGAGGGG - Intergenic
919880094 1:201895431-201895453 CCCAGTGCTGGGAAGGTGGAGGG + Intergenic
919972666 1:202591147-202591169 GAAAGAGTGGGGAAGGTGGAGGG - Exonic
920528007 1:206683176-206683198 CGCAGGGGTGGGAAGGTGGAAGG - Intronic
920839458 1:209541980-209542002 GAGAGAGTTGGGATGGAGGATGG - Intergenic
920968016 1:210717381-210717403 CTGAGAGTTGGGGAGCAGCAGGG - Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
922025715 1:221746668-221746690 CTGAGACTGGGGAAGTTGTAAGG - Intergenic
922974673 1:229774349-229774371 ACGAAAGTTGGGAGGGTGGAAGG + Intergenic
923079988 1:230644067-230644089 CTCAGAGTGGGAAAGGTGGTGGG - Intronic
923211976 1:231811662-231811684 CTGAGGATTGGGCAGGTGAAAGG + Intronic
923257842 1:232236511-232236533 CTGAGAGCCAGGAAAGTGGATGG - Intergenic
1062811527 10:469989-470011 GTGAGAGGTGGGGAGGTGGATGG + Intronic
1064249609 10:13696809-13696831 CTGAGAATCAGGAAGGTGAAGGG - Intronic
1064875863 10:19993879-19993901 CAGAGAGTAGGGAATGTGCAGGG + Intronic
1066182487 10:32976867-32976889 CTGAGAGTTCAGAATGTGCAGGG + Intronic
1066199682 10:33132860-33132882 GTAAGAGTTGGCCAGGTGGAGGG - Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1067080327 10:43208925-43208947 TTCACAGCTGGGAAGGTGGAGGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067409636 10:46053148-46053170 CTGAGAGGTGGGAAGGGAGCTGG + Intergenic
1067549683 10:47225698-47225720 CTGAGCGCTGGGGATGTGGAGGG - Intergenic
1067667266 10:48289056-48289078 CTGACAGGTGGGCAGGCGGAGGG - Intergenic
1068306051 10:55209703-55209725 TTGAGAGTTGAGAAGGGGCATGG + Intronic
1068498344 10:57813955-57813977 ACTAGAGTGGGGAAGGTGGAAGG - Intergenic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069796548 10:71056304-71056326 TTGATGGTGGGGAAGGTGGAAGG + Intergenic
1070083526 10:73211943-73211965 CCGAAAGGTGGGAAGGTGGGAGG - Intronic
1070086512 10:73243154-73243176 GTGACATTTGGGAGGGTGGAGGG - Exonic
1070278844 10:75034041-75034063 GTGAGAGTGGGTGAGGTGGAGGG - Intergenic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1070678956 10:78435387-78435409 CAGGGAGTTGGGTGGGTGGAGGG - Intergenic
1070754943 10:78986086-78986108 CTCAGAATGGTGAAGGTGGAGGG + Intergenic
1070974426 10:80594908-80594930 TGGGCAGTTGGGAAGGTGGATGG + Intronic
1071553252 10:86583710-86583732 ATGAGAGGAGGGAAGGAGGATGG - Intergenic
1071787314 10:88916227-88916249 CTTAGGGTTGTGAAGGTTGATGG - Intronic
1072192912 10:93090688-93090710 ATTAGAGTTGGGAGGCTGGAAGG - Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1073047801 10:100651060-100651082 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047843 10:100651186-100651208 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047903 10:100651366-100651388 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047915 10:100651402-100651424 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047938 10:100651474-100651496 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047957 10:100651528-100651550 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048005 10:100651675-100651697 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048022 10:100651720-100651742 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048039 10:100651765-100651787 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048056 10:100651810-100651832 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048073 10:100651855-100651877 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048090 10:100651900-100651922 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048107 10:100651945-100651967 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073217018 10:101842082-101842104 TTGAGACCTGGGAAGGGGGAGGG - Intronic
1073446153 10:103581771-103581793 CTAAGAGGTGGGAAGGTGTGTGG + Intronic
1073877454 10:107941499-107941521 CTCAGGGTTGGGAAGATGGGTGG - Intergenic
1074431198 10:113396211-113396233 CTAAGAGTTGGGATGGTGGTGGG - Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075201036 10:120404349-120404371 CTGACAGGTGGAAAGGTGGAAGG + Intergenic
1075231244 10:120680327-120680349 GAGAGAGTTGGGAAGGAGGAGGG - Intergenic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076934101 10:133555958-133555980 GTGAGACCAGGGAAGGTGGATGG - Intronic
1077308465 11:1878203-1878225 CAGAGTGTTGAGGAGGTGGAGGG - Intronic
1077393741 11:2311257-2311279 GCAAGAGTTGGGGAGGTGGAGGG - Intronic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077512476 11:2975828-2975850 CTGAGAGTTTGCCTGGTGGATGG - Intronic
1078153826 11:8781114-8781136 CTTAGAGTTGGAAGGATGGAGGG + Intronic
1078741214 11:14067812-14067834 CTGCAAGTGGGGAAGATGGAGGG + Intronic
1079170356 11:18088315-18088337 CTGAGGTTTGGGAATATGGATGG + Intronic
1079181717 11:18199849-18199871 CAGGGATTTGGGAAGGGGGATGG - Intronic
1079978035 11:27116915-27116937 CTGATAGATGGGATGTTGGATGG - Intronic
1080673805 11:34405838-34405860 TGGAGAGATGGGAGGGTGGAGGG - Intergenic
1081348853 11:42024207-42024229 GTCAGAGGTGGGATGGTGGAAGG - Intergenic
1081576795 11:44323764-44323786 CTGGGAGTTGGTAAGAAGGAAGG - Intergenic
1081842161 11:46210361-46210383 CTGAAAGTTGGGTAAGAGGATGG + Intergenic
1083275476 11:61594728-61594750 CTGAGAGTGAGGACGGGGGAGGG + Intergenic
1083342614 11:61968101-61968123 CAGATGATTGGGAAGGTGGAAGG + Intergenic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083860681 11:65418429-65418451 AGGACAGTTGGGAAGGAGGAAGG + Intergenic
1084317400 11:68353573-68353595 CTGAGAGTGGGGACAGTGGAGGG + Intronic
1084942074 11:72618278-72618300 CTGGGAGTGGGGAGGCTGGAGGG - Intronic
1085045039 11:73347773-73347795 CTGACAGCTGGGAAGGTGGGTGG + Intronic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085219154 11:74859009-74859031 CTCAGGGTGGGGAAAGTGGAAGG - Intronic
1085690005 11:78656968-78656990 CTGAGACGTAGGAATGTGGAGGG - Exonic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087542773 11:99542322-99542344 CAGAGACTTGGGAGGGTGTAAGG - Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1088030049 11:105237578-105237600 CTGAGCCTTGGAAATGTGGAAGG - Intergenic
1088130322 11:106480958-106480980 CTGAGTGTTGGCAATGGGGATGG + Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088992880 11:114969931-114969953 ATGAGAGGTGGGGAGGGGGAAGG + Intergenic
1089259206 11:117211484-117211506 AAGAGAGTGGGGAAAGTGGAAGG - Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089757435 11:120696835-120696857 CTAAGAGTTAGGAAGCTGGTTGG - Intronic
1089809722 11:121121686-121121708 CTGAGGGTTGTGATGGTGGGGGG + Intronic
1090004217 11:122985673-122985695 CTAAGACTTGGGAAGGTGTGTGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090650790 11:128804184-128804206 ATAAGAGTTGGGAAGACGGATGG - Intronic
1091171602 11:133524773-133524795 CTGAGAGACGGGAATGTGCAGGG - Intronic
1091295654 11:134472322-134472344 CTGGGAGTTGAGCAGGTGGTGGG + Intergenic
1091404092 12:198124-198146 CGGAGAGTTGGGATGCAGGAGGG - Intronic
1091624753 12:2113396-2113418 ATAAGAGTTGGGGAGGTGGCTGG + Intronic
1091688471 12:2580078-2580100 GACAGAGTTGGGAAGCTGGAGGG + Intronic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092001243 12:5034046-5034068 CTGTGAGTTAGGAAGCTGTAGGG - Intergenic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1093938372 12:25025868-25025890 CTGAGAGTGAGGATGTTGGAGGG + Intronic
1093943970 12:25086341-25086363 ATGACAGTAGGGAAGGAGGAAGG + Intronic
1094064748 12:26350731-26350753 GGGAGAGTTGGGAAGGAGGAAGG - Intronic
1097172721 12:57126690-57126712 CTGACAGATGGGTAGGGGGAGGG + Intronic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1100190394 12:92184835-92184857 CTGAGGGTTGGCAGAGTGGAGGG - Intergenic
1100797560 12:98198378-98198400 CTGAGATTTTGGAGGATGGAGGG - Intergenic
1100871010 12:98910029-98910051 CAGTTAGCTGGGAAGGTGGAGGG + Intronic
1101168872 12:102067321-102067343 CTGAGAGATGGGATTGAGGAGGG - Intergenic
1101558648 12:105834563-105834585 CTGAGAGTTGGGAGTGGGAAAGG - Intergenic
1102657845 12:114497967-114497989 TAGAGAGTTGGGAAGAGGGAAGG + Intergenic
1103515254 12:121503653-121503675 CTGAGAGGTGAGAAGGGGGAAGG + Intronic
1104606962 12:130196931-130196953 GTGAGAGTGGGGGAGATGGAGGG + Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104766486 12:131333455-131333477 CTGAGTGTCGGGAAGATGAATGG - Intergenic
1106159151 13:27185072-27185094 CTGAGAGTAGGGAAGAAGCATGG + Intergenic
1106285604 13:28316140-28316162 CTGAGCGTAGGGAAGCGGGAGGG - Intronic
1107077694 13:36340971-36340993 TTGAAAGATGGGAAGATGGATGG + Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108313554 13:49218096-49218118 GTGAGAGTTGGGAAGGCCGGGGG + Intergenic
1108513673 13:51177440-51177462 AGGACAGTTGGGAATGTGGAAGG - Intergenic
1109091054 13:58046537-58046559 CTGAGTATTAGGAATGTGGAGGG + Intergenic
1110413964 13:75232328-75232350 CTCAGAGTTGGGCAGGGGGAAGG - Intergenic
1111239777 13:85458423-85458445 ATGAGATTTGGGAAGGAGCAGGG + Intergenic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112547609 13:100386813-100386835 CTGTGAGTTGGGGAGCTGGAGGG + Intronic
1112797405 13:103071333-103071355 CTAGGAGGTGGGTAGGTGGATGG + Intergenic
1113458897 13:110468116-110468138 ATGAGAGTTAGGAAAGTGGACGG + Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1113778630 13:112963170-112963192 CTGAGAGTGGTGGAGGTGGGTGG - Intronic
1113858045 13:113460213-113460235 CAGAGAGTGTGGCAGGTGGAGGG - Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1114713307 14:24800144-24800166 GAGTGAGTTGGGAAGGTGGCTGG + Intergenic
1115156355 14:30343998-30344020 CTGAGAGGTGGGAGGATGGGAGG - Intergenic
1115331315 14:32201621-32201643 CTGAGAGCTGGGGAGGCGGTTGG - Intergenic
1116025424 14:39508553-39508575 CTCAGGGTTGGGAAGGTGAATGG + Intergenic
1116485799 14:45446556-45446578 CAGAGACTGGGGAAGGTGCATGG - Intergenic
1116868721 14:50052004-50052026 CAGAGAGTGGGGCAGGTGGAAGG + Intergenic
1117001165 14:51372914-51372936 CTTAGAGTGGTGACGGTGGAGGG + Intergenic
1117499760 14:56339889-56339911 GAGAGAGGTGGGGAGGTGGAGGG + Intergenic
1117511233 14:56453397-56453419 CTCAGAGCTGGAAAGCTGGAGGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1119182419 14:72613970-72613992 CTGAGAGTGGGGCAGGGGGAAGG - Intergenic
1119663575 14:76468023-76468045 GTGCTTGTTGGGAAGGTGGAGGG + Intronic
1120930604 14:89844640-89844662 CTGAGAGTGAGGAAGGTTGGGGG - Intronic
1121432933 14:93900196-93900218 CTGGGAGTGGGGGTGGTGGACGG + Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1121824625 14:97000412-97000434 CTGAGAGCTGGGAAGATGATGGG - Intergenic
1121895247 14:97640655-97640677 CAGAGAGGTGGGAGGATGGAGGG + Intergenic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122293921 14:100694400-100694422 CTGAGAGTCGGGTGGGGGGAAGG - Intergenic
1122428593 14:101625862-101625884 CTGACAGATGGATAGGTGGATGG + Intergenic
1122879942 14:104686180-104686202 ATGATAGGTGGGTAGGTGGATGG + Intergenic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1124347548 15:28932579-28932601 CTGACAGTGGAGATGGTGGACGG + Intronic
1124998397 15:34746370-34746392 ATGTGAGTTGGGGAGGTGGAAGG - Intergenic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1125592078 15:40860925-40860947 CTGGGAGTTTGGTGGGTGGAGGG + Intergenic
1125712099 15:41795384-41795406 CTTAAAGTTGGTAAGGTGGCTGG + Intronic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1126959636 15:53977190-53977212 CTGATAGCTGGGAATGGGGAGGG + Intergenic
1126974237 15:54156737-54156759 CTGAGAGTAGAGAAGCTGGACGG + Intronic
1127352024 15:58162622-58162644 CTGAGAGATGGCATGGTGCAGGG + Intronic
1127903450 15:63358560-63358582 ATGAGTGCTGGGAAGGCGGATGG - Intronic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1129106028 15:73307904-73307926 ATGAGATTTGGGGAGCTGGAGGG - Intergenic
1129897104 15:79116627-79116649 AGGAGTGTTGAGAAGGTGGATGG - Intergenic
1130250076 15:82294338-82294360 CTGAGAGTCAGGAGGTTGGATGG - Intergenic
1130882188 15:88064871-88064893 CTGACAGTTGAGAGGGAGGAAGG + Intronic
1131122230 15:89829768-89829790 ATGGGAGTTGAGGAGGTGGATGG - Intergenic
1131147747 15:90025111-90025133 TTGAGAGTAGGGGACGTGGAGGG + Intronic
1131635814 15:94231754-94231776 CTGGGAGTTGGGGAGCTGGAGGG + Intronic
1131881935 15:96871169-96871191 CTGGGAGTTGGGGTGGGGGAGGG + Intergenic
1131962187 15:97801226-97801248 AGGCGGGTTGGGAAGGTGGAGGG + Intergenic
1132639268 16:970426-970448 AGGAGAGCTGGGCAGGTGGAGGG - Intronic
1133052238 16:3123878-3123900 CTGAGAGGTAGGAGGCTGGAGGG + Intergenic
1133479858 16:6159625-6159647 CTGAGACGTGGGAAGGTCAATGG - Intronic
1133776229 16:8897391-8897413 CTGAGAGTTGGGAAGGCCCTGGG - Intronic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134396759 16:13872304-13872326 CTGAGAGTTGGGAAAAGGGGAGG - Intergenic
1135136528 16:19889020-19889042 ATGAGGCTTGGGAAGGTTGAGGG + Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1135785449 16:25344933-25344955 CAGAGAGATGGGATGGAGGAGGG - Intergenic
1136290876 16:29270672-29270694 CAGATAGGTGGGTAGGTGGATGG + Intergenic
1136368417 16:29820639-29820661 ATCAGAGTGGGGAAGGAGGATGG + Intronic
1137488327 16:48909953-48909975 CTGAGAGTGGGGATGATGGCAGG + Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137784600 16:51127878-51127900 ATCAGAGTGGGGAAGGTGCAGGG + Intergenic
1137883118 16:52073381-52073403 CTAAGAGTTTGGAAAGTAGAAGG - Intronic
1138399434 16:56733443-56733465 CTGAGTGTTGAGGAGGTGAAAGG + Intronic
1138960706 16:62025457-62025479 CTGAAAATTGGGAAGTTGCACGG - Intronic
1139238562 16:65366560-65366582 CTGACTGTTGGGAAAGTGGATGG - Intergenic
1139311984 16:66035128-66035150 CTGAGAGCTGGAACAGTGGAGGG + Intergenic
1139319384 16:66101199-66101221 CAGAGAGTTGAGAAAGTAGATGG + Intergenic
1140110756 16:72002565-72002587 CACAGAGGTGGGAAAGTGGAAGG + Intergenic
1140627210 16:76808509-76808531 ATGAGAGTTCTGAAGATGGATGG - Intergenic
1140820835 16:78661639-78661661 CTGAGAGGTGGGGAGGGGGTGGG + Intronic
1140856115 16:78979249-78979271 CTGGGAGGTGGGAATGGGGATGG - Intronic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1141396273 16:83707947-83707969 CTGTGAGTTGGCAAGGGGAATGG + Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141810816 16:86374107-86374129 CTGATAGTTGGGGTGGTGGCAGG + Intergenic
1142096753 16:88244170-88244192 CAGATAGGTGGGTAGGTGGATGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142866109 17:2792556-2792578 CTGAGGGCTGGAAAGGGGGAAGG - Intronic
1142928848 17:3265596-3265618 CAGAGAGTTGGGGAAATGGATGG + Intergenic
1143152295 17:4815150-4815172 ATATGAGTTGGAAAGGTGGAGGG + Intronic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143341399 17:6214066-6214088 CTGAGAGGTAGGAGGGTGGGGGG + Intergenic
1143637757 17:8176153-8176175 CTCAGAGATGGGAATGGGGACGG + Intronic
1144669343 17:17124110-17124132 CAGAGAGGTGGAGAGGTGGAAGG + Intronic
1146097661 17:29947408-29947430 CTCAGAAGTGGGAGGGTGGAAGG + Intronic
1146532747 17:33623880-33623902 GTGACAGATGGGAAGGTGGGGGG - Intronic
1146573738 17:33974255-33974277 CTGAGACTTGGGAATTGGGAGGG - Intronic
1146819014 17:35969573-35969595 AGGAGAGGTGGGAAGGTGGAAGG + Intergenic
1147243503 17:39105975-39105997 CAGAGCGTTTGGGAGGTGGACGG - Intronic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1148074425 17:44927330-44927352 CGCAGAGCTGGGCAGGTGGAAGG - Intronic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148382273 17:47208823-47208845 CTGTGAGTTGGGAGGGTGTGGGG + Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1148874906 17:50681298-50681320 CTGAGAGGCAGGAAGGTTGAGGG - Intronic
1149777736 17:59371236-59371258 CTAACAGTAGGGAAGGGGGAAGG + Intronic
1150230830 17:63549653-63549675 CTGTGAGTTGGAAAAGGGGAAGG - Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150782269 17:68133666-68133688 CTGAGGGTTGTGTAGGTGGCTGG + Intergenic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151171682 17:72251695-72251717 CTAAGAGTAGGGAAGCTGGTGGG + Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151384908 17:73749004-73749026 CTGGGAGTTATGAAGGTGAATGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151873427 17:76851842-76851864 CTGAGATCTGGGATGATGGATGG + Intergenic
1152438409 17:80289892-80289914 CTGAGAGTTGTGCAGGGAGAGGG - Intronic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153870023 18:9309787-9309809 CTGATAGTTGGGAAGGCTGTGGG + Intergenic
1155763255 18:29592192-29592214 TTGAGAGGTGGGAGGGTGGTAGG + Intergenic
1155780848 18:29832804-29832826 CTGAGAGTTGGGAGGATGAACGG + Intergenic
1155780895 18:29833967-29833989 CTGAGAGTTGGGATGATGAACGG - Intergenic
1156105683 18:33657337-33657359 CTGAGAATTGGGAGGCTGGCAGG + Intronic
1157297939 18:46459499-46459521 CAGAGAATTGGGAGGGGGGAGGG - Exonic
1157300846 18:46477957-46477979 CAGAGAGGTGGGAGAGTGGAGGG + Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157436395 18:47673321-47673343 CACAGAGTGGGGAAGGTGAAAGG + Intergenic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1158157562 18:54443027-54443049 ATGAGAGTTGAGAAGTGGGATGG - Intergenic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1160409838 18:78667946-78667968 GGGAGAGGTGGGAGGGTGGATGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1160976786 19:1796682-1796704 CTCAGAGATGGGGAGGTGGGTGG + Intronic
1161717164 19:5882538-5882560 CTGGCAGATGGGAAGCTGGAAGG - Intronic
1161829139 19:6590223-6590245 ATGAGAGGTGGAAAGGAGGATGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1162414179 19:10524479-10524501 CTTTGAGTTGGGAAGGAGAAGGG - Intergenic
1162751444 19:12832506-12832528 CTGAGATTAGGGAAGGAGAAAGG - Intronic
1163013102 19:14437610-14437632 GTGAGGGTTGGGAAGATGGTGGG + Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163376376 19:16934733-16934755 CAGAAATTTGGGAAGGTAGAAGG - Intronic
1163438694 19:17310549-17310571 CTGAGGGCTGGGAAGGGTGATGG + Intronic
1163518077 19:17776732-17776754 CGGAGACATGGGGAGGTGGAGGG - Intronic
1163731998 19:18954727-18954749 TGGATGGTTGGGAAGGTGGATGG - Intergenic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1166250603 19:41567801-41567823 CTGACAGTAGGGAAGATGGTGGG + Intronic
1166840706 19:45695404-45695426 GAGAGAGGTGGGAGGGTGGACGG - Intronic
1166898173 19:46036921-46036943 CTGAGAGCTGGGAAGATGACAGG + Intergenic
1166956304 19:46467797-46467819 GTGACAGTTGGGTAGATGGATGG + Exonic
1166980947 19:46631703-46631725 CTCAGAGGTGGGAAGCAGGAGGG + Intergenic
1167304122 19:48696974-48696996 CTGCGAGCTGGGAAGGGGCAGGG + Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
924993866 2:339772-339794 GTGAGAGTTTGGAAAGTGGATGG - Intergenic
925561943 2:5205613-5205635 CTGAGAGTTGGGAGGTGGGTCGG - Intergenic
925745042 2:7036754-7036776 CTGAGATCTGGTAAGGTGAATGG - Intronic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
926784856 2:16508927-16508949 CTGAGAGCCGGGAAGAAGGAAGG - Intergenic
927042758 2:19246160-19246182 CTGAGAGTTGAGAGGCTGGGTGG + Intergenic
927077251 2:19591112-19591134 CTCAGAGTTGTCAAGGTGGATGG - Intergenic
927744614 2:25606057-25606079 CTGAAAGTTGGAAAGCTAGATGG - Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928239917 2:29577433-29577455 CTGAATGGTGGGAAGGTGGTAGG + Intronic
928410696 2:31051916-31051938 ATGAGAGTTGGGTGGGCGGAGGG - Intronic
929485458 2:42349440-42349462 GTGGGAGTTGGGATGGTGGGAGG + Exonic
929851321 2:45592970-45592992 CTTAGAGTTGGGAAGGGGTAGGG + Intronic
931644188 2:64406520-64406542 CTGAGAGCTGGGAAAGGGCAGGG + Intergenic
931996102 2:67840697-67840719 GTGACAGTTGGGCAGGTTGAGGG - Intergenic
932288386 2:70554779-70554801 CTGGAATTTGGGGAGGTGGAGGG + Intergenic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932441870 2:71742720-71742742 CAGTGAGTTGGGGAGATGGAGGG - Intergenic
932590614 2:73064587-73064609 CTGAGAGTTGGGAGGCAGGGGGG - Intronic
933264533 2:80168203-80168225 CTGAGAGCTGTGAGGCTGGAGGG - Intronic
933518408 2:83335953-83335975 CAGAGATTAGGGATGGTGGAGGG - Intergenic
933854987 2:86404319-86404341 CACTGAGTTGGGAAGGTGGAGGG - Intergenic
935244494 2:101206329-101206351 CAGAGAGTTGGGCAGGGGCAGGG + Intronic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
936024313 2:109019747-109019769 CAGATAGTTAGGAAGATGGATGG - Intergenic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936170467 2:110167495-110167517 CGAAGTGCTGGGAAGGTGGAAGG + Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937240315 2:120456613-120456635 GTGAGTGTTTGGAGGGTGGAGGG - Intergenic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937730235 2:125221895-125221917 CTGAGATTTGGGAAGGGCCAGGG - Intergenic
938255538 2:129857449-129857471 CTGGGAATTGGAGAGGTGGAAGG + Intergenic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
941123851 2:161562353-161562375 ATGAGATTTGGGAAGGGGCAGGG + Intronic
941374566 2:164711010-164711032 CAGAGAGTTTGCAAGGTAGAAGG + Intronic
943395987 2:187335113-187335135 CTAAAAGGTGGGAAGGTGGGAGG + Intergenic
943665324 2:190602867-190602889 CTGAAAGGTGGGAAGGAAGAGGG + Intergenic
944098264 2:195994317-195994339 CTGAGCCTTGGGGAGGAGGAAGG - Intronic
946018010 2:216619708-216619730 GAAAGAGTTGGGGAGGTGGAAGG + Intergenic
947452368 2:230220553-230220575 CTGAGAGCTGGGCAGGTAGTTGG + Intronic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1169906849 20:10613190-10613212 GTGACAGTTGGGAGGGTGGAGGG - Intronic
1170569943 20:17627055-17627077 CAGAGAGATGGACAGGTGGATGG + Intronic
1171307903 20:24121523-24121545 CGGAGAGTTGGGAAGATCAAGGG + Intergenic
1172184248 20:33021418-33021440 CTGGGAGGTGGGAAGGGGGCTGG - Intronic
1172811233 20:37649731-37649753 CTGAGGGTTGGGTCGGGGGAAGG + Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173570761 20:44074592-44074614 CAGAGAGATGGGCAGGTGGGTGG - Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174291429 20:49511801-49511823 CTAAGAGATGGAAATGTGGATGG + Intronic
1174387075 20:50193559-50193581 CTGAGAGTTGAGGATGTAGATGG + Intergenic
1175592145 20:60201639-60201661 CTGAGAGTAGGGAAGGGGTGAGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1177997240 21:28116379-28116401 GTGGGAGTGGGGAATGTGGATGG - Intergenic
1178233258 21:30812208-30812230 CTGAGAGTTTTTAAGGTGAAGGG - Intergenic
1178628218 21:34236367-34236389 CACAGGGTGGGGAAGGTGGAGGG - Intergenic
1179161342 21:38902131-38902153 TGGAGAGTTGGGTAGGTGGAAGG - Intergenic
1179170882 21:38971898-38971920 CGGAGAGTAGGGAAGGGAGAGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180083050 21:45495224-45495246 CTGAGAGCTGGGAACGTGTGAGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1181452367 22:23032285-23032307 CTCAAAGCAGGGAAGGTGGAGGG - Intergenic
1181537197 22:23552614-23552636 AGGATAGATGGGAAGGTGGAGGG - Intergenic
1182083270 22:27543881-27543903 CTGAGAGTTGGCAACAGGGAGGG - Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182842783 22:33405308-33405330 CTGACAGGTGGGAGGCTGGAAGG - Intronic
1182939290 22:34259431-34259453 CTGATACCTGGGAAGGTGGGTGG - Intergenic
1183468548 22:37993054-37993076 AAGAGAGTGGGGAAGGTGGAGGG + Intronic
1184521623 22:44997893-44997915 CTGAGAGATGGCAATTTGGAAGG - Intronic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185050996 22:48553890-48553912 CCAAGAGCTGGGCAGGTGGACGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950392670 3:12708931-12708953 CTCAGAGTTGGGAAGGGGAAGGG + Intergenic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950713386 3:14829807-14829829 CTGACAGGTGGGGAGGAGGAAGG - Intronic
951144036 3:19205121-19205143 TAGATAGTTGGGTAGGTGGATGG - Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
951281482 3:20755235-20755257 CTGGGAATTGGGAAAGTTGAAGG + Intergenic
952162527 3:30708433-30708455 CTGAGAGATAGGAAGGCAGAAGG - Intergenic
953446184 3:42969843-42969865 TTAAGAGTTGCGAAGGTGGGCGG - Intronic
953553079 3:43919775-43919797 ATGGGGGTTGGGAATGTGGAGGG - Intergenic
953795557 3:45983153-45983175 CTGTGCGTTGGAAAGGTGAAGGG + Intronic
954071238 3:48144268-48144290 CTGACTGGTGGGAAGTTGGAAGG - Intergenic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954641937 3:52105873-52105895 CTGCGAGTAGGGAAGGTGCTAGG + Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955019227 3:55102671-55102693 CTGTGAGTTGGGGAGATTGATGG - Intergenic
955398175 3:58572428-58572450 CTGACAGTTGAGAATGAGGAAGG + Intronic
956365481 3:68497506-68497528 ATGTCAGTTGGGAGGGTGGAAGG + Intronic
956917807 3:73891507-73891529 CTGAGGGTTGGGGTGGTGGGAGG + Intergenic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
957911504 3:86624778-86624800 CTGGAGGTTGGGAAGGTGAAGGG - Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
961036318 3:123644496-123644518 TTGGGAGTTGGCAAGCTGGATGG - Intronic
961200589 3:125042626-125042648 CTGGGAGTTTGGAAGGGGCAAGG + Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961658542 3:128456446-128456468 CTGGGACTTGGGAAGGTGCCAGG - Intergenic
962366557 3:134789854-134789876 CAGAGAATTGGGATGGTGGTTGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962693567 3:137925794-137925816 CACAGAGCTGGGAAGGAGGAAGG + Intergenic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
963848854 3:150187604-150187626 TTGATAGTTGGGAAGGTTGGGGG - Intergenic
963952590 3:151219415-151219437 CTCACAATTAGGAAGGTGGAAGG - Intronic
964088253 3:152844526-152844548 CTGAGAGTATGGAAGGAGTATGG + Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964835133 3:160929859-160929881 AGGAGAGGTGGGAAGGTGGTGGG - Intronic
965448082 3:168800896-168800918 CTGAGAGGTGGGAGGGTTGCTGG - Intergenic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
967185904 3:186944337-186944359 GTAGGAGTTGGGAAGGTGGAGGG + Intronic
967871787 3:194235874-194235896 CTGATATTTGGGAGGCTGGATGG + Intergenic
968129929 3:196187123-196187145 CTGACAGCTGGGCAGGTGGCAGG + Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968916718 4:3499896-3499918 GAGAGAGTTGGGAAGGTGCGGGG + Intronic
968930254 4:3575207-3575229 GTGGGTGTTGGGCAGGTGGAGGG + Intergenic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
970188024 4:13483794-13483816 CTGAGAGGCGGGAAGCTGAAAGG + Intronic
970217855 4:13778475-13778497 CAGAGAGTTGGGAATGGGGTAGG - Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
972184020 4:36506242-36506264 CTGAGAGTTGTGAAGGTTGTGGG + Intergenic
972340355 4:38147605-38147627 CTTGAAGCTGGGAAGGTGGAGGG - Intergenic
974015259 4:56643392-56643414 TGGAGAGTTGTGAAGATGGAGGG - Intergenic
975506155 4:75140538-75140560 CTGATAGTTGGGAAGATTGCTGG - Intergenic
975682948 4:76895365-76895387 CTGAGAGTTGGTAAAGAGGATGG - Exonic
975972331 4:80055388-80055410 CTGACAGATGGCAAGTTGGACGG - Exonic
976329660 4:83814854-83814876 CTGAGAGTTGAGATGGTGGTGGG + Intergenic
978822078 4:112978510-112978532 CAGAGAGTTGGAAAGGAGAATGG - Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
978923785 4:114217754-114217776 CTGACAGGTGGGAAGGAGGAGGG + Intergenic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
979967003 4:127087354-127087376 ATGAGATTTGGGAGGGTGCAGGG + Intergenic
980437473 4:132796575-132796597 CTGAGAGATGGCAGAGTGGAAGG + Intergenic
980980684 4:139652238-139652260 CTGAGAGTTGGGAGGGCAGGAGG + Intergenic
982129637 4:152216549-152216571 CTTGGAGTTGGGAAGGGGTAGGG + Intergenic
982137427 4:152285087-152285109 CTGAGGGTTGTGAAGATGGCAGG + Intergenic
982215424 4:153079267-153079289 CTGAGAGGTGGGTAGGGGGGCGG - Intergenic
982602289 4:157467793-157467815 GAGAGCGTTGGGAGGGTGGAGGG + Intergenic
983693597 4:170502014-170502036 CTGAGAGCTAGGAATGTGGTGGG - Intergenic
983707200 4:170676093-170676115 CTGACAGCTGTGAAAGTGGAGGG - Intergenic
984135682 4:175935239-175935261 TAGAGAGGTGGGAAGGTGAAGGG - Intronic
984328278 4:178281482-178281504 CTCAGAGTTGGGAAGGAATAGGG - Intergenic
985039809 4:185878850-185878872 CGGAAAGTGGGGAGGGTGGACGG - Intronic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985314631 4:188643634-188643656 TTGAGAGTTGGGAAGGTGGCAGG - Intergenic
985796486 5:1966070-1966092 CAGAGAGCTGGGCAGGGGGATGG + Intergenic
985821566 5:2164120-2164142 CTGAGGGTTTGCAAGGTGCATGG - Intergenic
986202163 5:5588549-5588571 CTGACACTTGGGAAGCTGCACGG - Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986516937 5:8574162-8574184 CTGGGACTTGGAAAGGAGGAAGG + Intergenic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
987033110 5:13993980-13994002 CTCAGAGGTCGGAAGGAGGAAGG + Intergenic
988958512 5:36345142-36345164 CTGAGAGTTGGGAATGGGGAGGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991033203 5:62103355-62103377 CTGAAAGTTGGAAAGGCTGATGG - Intergenic
991306747 5:65184988-65185010 CTGAGAGTTGGAAGTGGGGAGGG + Intronic
991663163 5:68970452-68970474 AAGGGAGCTGGGAAGGTGGAAGG - Intergenic
992071254 5:73151274-73151296 CCTAGGGGTGGGAAGGTGGAAGG + Intergenic
992319358 5:75595790-75595812 TTGATAGTTGGGGTGGTGGAGGG + Intronic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
994079232 5:95687750-95687772 CTGAGAGTTGGTTAGATGGTAGG + Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995170760 5:109109038-109109060 ATCAGAGTTGGCAATGTGGATGG - Intronic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995642147 5:114268964-114268986 CTGAGAGAATGGAAGGTGCACGG + Intergenic
996322362 5:122232996-122233018 CTGAGAGTTGGGTGGGTGAGGGG + Intergenic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
997191375 5:131939420-131939442 ATGAAAGTTTGGAATGTGGAAGG - Intronic
997305631 5:132833875-132833897 CTGATAGGTGGGGAGGTGGTGGG + Intergenic
997551874 5:134760323-134760345 CTTAGAGGTGGGAAGGCGCAAGG + Intronic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
998164253 5:139833656-139833678 CTAAGAGTAGGGAAGGAGGCTGG - Intronic
998213954 5:140223425-140223447 CTGAGGTTTGGAAAGGTGAAGGG + Intronic
999154773 5:149450427-149450449 CTGACAGCTGGGAGGGTGGCTGG - Intergenic
999635515 5:153617884-153617906 ATGTGAGTTTTGAAGGTGGAGGG - Intronic
999750460 5:154624547-154624569 CTGAGAGTTGGGGGTGGGGATGG - Intergenic
999854587 5:155580265-155580287 CTGAGGGCTGGGAAGGTTGGTGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1001548326 5:172584403-172584425 CTGAGATTAGAGAAGGTGGGAGG + Intergenic
1001684808 5:173585435-173585457 ATGAGATTTGGGAAGGTCCAGGG - Intergenic
1002280857 5:178129448-178129470 GTGAGGGTTAGGAAGGAGGAGGG - Intergenic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1002437322 5:179239575-179239597 CAGAGAGCATGGAAGGTGGAGGG + Intronic
1003383571 6:5647227-5647249 AAGAGAGGCGGGAAGGTGGAAGG - Intronic
1003817847 6:9862182-9862204 ATGAGATTTGGGAAGGGGCAGGG - Intronic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1004317176 6:14599732-14599754 AGGAGAGGTGGGGAGGTGGAGGG + Intergenic
1004320122 6:14625633-14625655 CTAAGAGTAGGGAAAGGGGAGGG + Intergenic
1004947997 6:20636670-20636692 CTGAGAGGTGGGATGGGGGAGGG + Intronic
1006116207 6:31777327-31777349 GTGAGAGCTGGGGAGGAGGAAGG + Intergenic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006418734 6:33920418-33920440 CTGGGAGTCAGGAAGGTGCAGGG - Intergenic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1006848911 6:37083319-37083341 CTGAGAGTGGAGAGGGTGAAGGG - Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007784617 6:44272471-44272493 GTGAGGGTTAGGGAGGTGGATGG + Intronic
1007923819 6:45634977-45634999 ATGAGACTAGGAAAGGTGGATGG + Intronic
1008018474 6:46548288-46548310 GTGAGAGCTGGGAGGGTAGAAGG - Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008809504 6:55478236-55478258 CGGAGAGGTGAGAAGGTAGAGGG - Intronic
1009242552 6:61199506-61199528 CTGAGATTTGGGAAGGGCCAGGG + Intergenic
1009273895 6:61650220-61650242 ATGAGAGGTGGGGAGGTTGAGGG - Intergenic
1009689278 6:67007101-67007123 GTGAGAGTTTTGATGGTGGAAGG + Intergenic
1009995214 6:70889118-70889140 CCAAGGGCTGGGAAGGTGGAGGG - Intronic
1010923166 6:81709873-81709895 TGGAGACTTGGAAAGGTGGAAGG - Intronic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011704831 6:89990444-89990466 CACAGGGTTGGGTAGGTGGATGG - Intronic
1011735010 6:90301887-90301909 CAGAGAGGAGGGAAGGTGGCTGG + Intergenic
1012194350 6:96320820-96320842 CTAAGAGTAGAGGAGGTGGAAGG - Intergenic
1012388899 6:98714564-98714586 CTGAGATTTGGAGAGGTGAAGGG - Intergenic
1012624431 6:101389934-101389956 GTGAGAGTTAGGATAGTGGAAGG + Intergenic
1013014951 6:106152482-106152504 ATGAGATTTGGGAAGGGCGAGGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014192273 6:118510597-118510619 CTGGGAGTTGGGGAGTGGGACGG + Intronic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015221749 6:130812427-130812449 ATGAGAGTTGGCACGGTGGGTGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1016103925 6:140138534-140138556 CTGAAACCTGGGAAGGTGAAAGG - Intergenic
1016671833 6:146718415-146718437 CAGAAAGTTGGGAGGGTGGGAGG - Intronic
1017054524 6:150425120-150425142 CTGAGAGCTGGGAAGATGATGGG + Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1017836211 6:158180588-158180610 TTGAGACTTGGGAGGGTGTATGG + Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019138998 6:169931365-169931387 CTGAGAGTGGGGCAGGAGCAAGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019738621 7:2662238-2662260 CAGAGAGATGGGCACGTGGAGGG - Exonic
1020179108 7:5907523-5907545 CTGAGAGTGAGGAAGAGGGAAGG + Intronic
1020303825 7:6817346-6817368 CTGAGAGTGAGGAAGAGGGAAGG - Intronic
1022945537 7:35280075-35280097 GAGAGAGTTGGGAAAGTGAAGGG + Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024327261 7:48118824-48118846 TTGAGGGTTGGGAAGTAGGATGG - Intergenic
1024766533 7:52667590-52667612 CTGAGAGTCAGGAACCTGGAAGG - Intergenic
1026166862 7:67917909-67917931 CTGAAAGGTGGGAGGGTGGGTGG - Intergenic
1026180439 7:68034629-68034651 CTTAGGGTTGGGAAGGTGTAAGG + Intergenic
1026202476 7:68226254-68226276 CTGTGAGTTGGAAAGGATGAAGG - Intergenic
1026832933 7:73621459-73621481 CAGAGAGTTCAGAAGGTGGTGGG - Intronic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027276308 7:76560411-76560433 CCTTCAGTTGGGAAGGTGGAGGG - Intergenic
1027680882 7:81220261-81220283 CAGAGGCTTGGGAAGGTTGAGGG - Intergenic
1027762036 7:82290916-82290938 TTAAGAGTGGGGAAGGTGGCAGG - Intronic
1029664946 7:101989125-101989147 CTGAGGGCTGGGAAGGTTCATGG - Intronic
1032205097 7:129856625-129856647 CTGAGATTTGGACATGTGGAGGG + Intronic
1033595825 7:142856997-142857019 CTGAGAGATGAGTAAGTGGAAGG - Intronic
1033731720 7:144187226-144187248 CAGAGAGTTGGGATGGGGGCAGG - Exonic
1033742570 7:144285809-144285831 CAGAGAGTTGGGATGGGGGCAGG - Intergenic
1033751333 7:144363805-144363827 CAGAGAGTTGGGATGGGGGCAGG + Exonic
1034481269 7:151321696-151321718 CTGAGAGCTGGGAAGATGACAGG + Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035420369 7:158724607-158724629 CTGACAGTTAGGTTGGTGGAAGG + Intergenic
1037291031 8:17349589-17349611 ATGGGATTTGGGAAGGTGGAGGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1039286939 8:36052024-36052046 TGGAAAGTTTGGAAGGTGGAAGG + Intergenic
1039494316 8:37969254-37969276 CTGGGAGTTAGGAAGGTTGCAGG + Intergenic
1039888594 8:41669714-41669736 CTGAGAGGTGGGCGGGTGCAGGG - Intronic
1041099181 8:54379348-54379370 CTGAGAGCTGGGGAAGAGGAAGG + Intergenic
1041134991 8:54748707-54748729 CTGATACTGGGGATGGTGGATGG - Intergenic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1041793974 8:61726815-61726837 TGGAAACTTGGGAAGGTGGAAGG - Intergenic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042391567 8:68241726-68241748 CAGAAAGATGGGAGGGTGGAAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1043794283 8:84516042-84516064 CTGAGAGTGGGAGAGGTGGGTGG + Intronic
1044361014 8:91283728-91283750 CTGAGAGTTGGGAGTGGAGATGG - Intronic
1045017892 8:98014701-98014723 CTAAGGGTTGGGAAGGCTGATGG - Intronic
1046162456 8:110385622-110385644 AGGAGAGTTGGGAATGAGGAGGG - Intergenic
1046577215 8:116045492-116045514 ACTAGAGTTGGGAGGGTGGAAGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046905702 8:119570299-119570321 CTGATAGTGGGGGAGGTTGAAGG + Intronic
1046975838 8:120276352-120276374 CTCAGAGTGGGGAGGGTGGAAGG + Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047175185 8:122534171-122534193 CGGGGTGTTGGGAAGGGGGATGG - Intergenic
1048192652 8:132304143-132304165 CTGAAAGGTGGGAGGGTGGAAGG + Intronic
1048800276 8:138188452-138188474 CAGAGAGTTGGCAAGGTTGTTGG + Intronic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1048848620 8:138623076-138623098 CTGTTAGTTGGGAATGTGCAGGG - Intronic
1048922220 8:139241617-139241639 ATGTGAGTTGTGAAGGTGGGAGG + Intergenic
1049005205 8:139850839-139850861 GTGATTTTTGGGAAGGTGGATGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049437033 8:142591337-142591359 GTGGGAGTTGGGAAGGCGGCTGG + Intergenic
1050716822 9:8538122-8538144 ATGAGATTTGTGAAAGTGGATGG - Intronic
1051131151 9:13862434-13862456 GTGATATTTGGGAATGTGGATGG - Intergenic
1051425510 9:16927891-16927913 GTGGGAGTTGGGAAGGCGAAAGG + Intergenic
1052557998 9:30044871-30044893 CTGTGAGTTGGGGAGAAGGAGGG + Intergenic
1055131150 9:72776600-72776622 CAGAGAGGTGGCAAGGTGTAAGG - Intronic
1055987251 9:82063882-82063904 CTGGAAGGTGGGAGGGTGGAGGG - Intergenic
1056039592 9:82649214-82649236 CTGGGAGTTGGGAATGGGGGAGG - Intergenic
1056192086 9:84194605-84194627 CTGAGAGTGGAGCAGGTGCAGGG + Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057984036 9:99691275-99691297 CTCAGAGTTGGACAGGTGAAGGG + Intergenic
1058261803 9:102842629-102842651 CTGAGTGTTGGAAAGGTAGGTGG + Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1059983652 9:119800349-119800371 CTAACAGCTGGGAAGGTGGCAGG + Intergenic
1060001323 9:119961633-119961655 ATGACAGCTGGGAAGGGGGATGG + Intergenic
1060116999 9:120949830-120949852 CTGGGATTTGGGTAGGTGGGAGG - Intergenic
1060539866 9:124422018-124422040 CTGAGACTTGGGTCTGTGGAAGG + Intergenic
1060970499 9:127734963-127734985 CGCAGACTTGGGAGGGTGGAGGG - Intronic
1061033183 9:128099135-128099157 CTGAGAGTCGAGAAGGCGGGAGG - Intronic
1061509636 9:131052703-131052725 CTGAGAGATGGGGAGGTGAGAGG + Intronic
1061522144 9:131125132-131125154 CTTAAAGTGTGGAAGGTGGAAGG - Intergenic
1185546931 X:953520-953542 CAGATAGATGGGAGGGTGGATGG - Intergenic
1186933070 X:14416056-14416078 CTGAAGGTTGGGAGGGTGGGAGG + Intergenic
1187045087 X:15640045-15640067 CTGAGAGGTAGTAAGGTAGACGG + Intronic
1187802131 X:23075659-23075681 CTGAGCGCTGGGAAGCCGGAAGG + Intergenic
1188294658 X:28432717-28432739 TTCAGAGTTGGCGAGGTGGAAGG + Intergenic
1188601542 X:31972146-31972168 CAGAGAGTTGGGAAGCAGGAAGG + Intronic
1188683623 X:33042845-33042867 TTCAGAGTTGGGATGGTGCAAGG - Intronic
1188901969 X:35744334-35744356 CTCAGAGTTGAAAAGGTTGAAGG - Intergenic
1190065353 X:47237436-47237458 CAGAGAGGTGGGAGGATGGAGGG - Intronic
1191715832 X:64192894-64192916 CTGAGAGCTGGGAAATTGGCAGG + Exonic
1191872316 X:65758712-65758734 CAGCAGGTTGGGAAGGTGGATGG + Intergenic
1193067345 X:77274529-77274551 CTCAGAGTTGGGAAGGCCCATGG - Intergenic
1193238731 X:79140920-79140942 CTGAGAGTTGGCAATGTGCCAGG - Intergenic
1194140423 X:90202526-90202548 CTGATAGTTTGGGAGGTGGCTGG + Intergenic
1195522078 X:105842749-105842771 CAGAGAGTTAAGCAGGTGGATGG + Intronic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1197321019 X:125031104-125031126 CTTAGAGTGGGGAGGGAGGAGGG - Intergenic
1199425498 X:147696478-147696500 CTAAGAGGTGGAAGGGTGGAAGG + Intergenic
1199723337 X:150558856-150558878 ATGAGAGTTGTGAAGGCGGTGGG - Intergenic
1200486168 Y:3771494-3771516 CTGATAGTTTGGGAGGTGGCTGG + Intergenic