ID: 1118260224

View in Genome Browser
Species Human (GRCh38)
Location 14:64239343-64239365
Sequence CTATAAACTCAGAGGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118260216_1118260224 1 Left 1118260216 14:64239319-64239341 CCACCCACTCCATGGGAACTCTC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260218_1118260224 -3 Left 1118260218 14:64239323-64239345 CCACTCCATGGGAACTCTCCCTA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260211_1118260224 26 Left 1118260211 14:64239294-64239316 CCATCTATGTCTTTGTCTTCTCC 0: 1
1: 1
2: 7
3: 80
4: 1039
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260219_1118260224 -8 Left 1118260219 14:64239328-64239350 CCATGGGAACTCTCCCTATAAAC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260217_1118260224 -2 Left 1118260217 14:64239322-64239344 CCCACTCCATGGGAACTCTCCCT 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260215_1118260224 2 Left 1118260215 14:64239318-64239340 CCCACCCACTCCATGGGAACTCT 0: 1
1: 1
2: 0
3: 15
4: 184
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177
1118260214_1118260224 5 Left 1118260214 14:64239315-64239337 CCACCCACCCACTCCATGGGAAC 0: 1
1: 1
2: 213
3: 226
4: 583
Right 1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG 0: 1
1: 0
2: 0
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118260224 Original CRISPR CTATAAACTCAGAGGGAACT AGG Intronic
900406027 1:2493399-2493421 CAATAAATTCAGAGGAAACCGGG + Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901495315 1:9617860-9617882 CTACAAAGGCAGAGGGAAGTGGG + Intergenic
901938072 1:12641493-12641515 CGATAAGCTCAGGGAGAACTGGG - Intergenic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
904348497 1:29889783-29889805 CCATAAACTCAGCGGGAAACAGG + Intergenic
905941117 1:41864183-41864205 CTATAAACCCAAAGGAAATTTGG - Intronic
907619381 1:55961000-55961022 CTTTTGACTCAGAGGGACCTGGG - Intergenic
907963400 1:59305674-59305696 CTCATAACTCAGAGGGAATTGGG - Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909159843 1:72132657-72132679 TTATAAAATCAGAGAGAAGTAGG - Intronic
910866483 1:91792752-91792774 CTTCAAAGTCAGAGGGTACTAGG + Intronic
917748210 1:178031230-178031252 TAATAAACTCAGAGTGAAATGGG + Intergenic
919219175 1:194603486-194603508 TAATAAACTCAGAGGGATTTTGG + Intergenic
919377788 1:196816250-196816272 CTAAAAACTCTCGGGGAACTAGG - Intergenic
919387300 1:196938144-196938166 CTAAAAACTCTCAGGGAACTAGG - Intronic
921125906 1:212177795-212177817 CTATTAACTGAGAGAGACCTTGG - Intergenic
922681944 1:227606179-227606201 CAATAAATACTGAGGGAACTCGG - Intronic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
924720478 1:246618347-246618369 ATATAAAATCAGAGAGCACTGGG - Intronic
1067116315 10:43437706-43437728 CTATTTCCTCAGAAGGAACTGGG - Intronic
1067578733 10:47425795-47425817 CTGGAAAATCAGAGGTAACTAGG + Intergenic
1067715726 10:48689962-48689984 CTTTAAAATCAGGTGGAACTAGG - Intronic
1068382648 10:56277056-56277078 CTATCAATTCAGAGGGAAAAAGG + Intergenic
1070206369 10:74266843-74266865 TTATATAATCAGAAGGAACTTGG + Intronic
1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG + Intergenic
1072289269 10:93947679-93947701 CTAGAAACACAGTGGGAAGTAGG + Intronic
1072858763 10:98980099-98980121 ATATAAAGTCAGAGAGATCTTGG + Intronic
1074053140 10:109898051-109898073 TTATAAATTCTGAGGGAACAAGG + Intronic
1074237670 10:111602207-111602229 CTGAAAACTCTGTGGGAACTGGG + Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080503325 11:32890144-32890166 CAATAAACTCAGAAGGAAGTGGG - Intergenic
1081645978 11:44791123-44791145 CCCCAAACTCAGAGGGAACGGGG - Intronic
1081727629 11:45342292-45342314 CTAGAAACTCAGAGGACACGGGG - Intergenic
1083146083 11:60759930-60759952 CAATAAACCCTGAGGGAACTCGG + Intronic
1083457623 11:62789516-62789538 CTCTCAACTCACAGGGCACTGGG + Intronic
1084256176 11:67944353-67944375 CTATAAACACAGCAGGTACTAGG + Intergenic
1084259773 11:67968408-67968430 CAATAAAAACTGAGGGAACTTGG - Intergenic
1084816585 11:71650946-71650968 CTATAAACACAGCAGGTACTAGG - Intergenic
1085484667 11:76851892-76851914 TTCTAAACTCAGAAGAAACTTGG - Intergenic
1089205671 11:116760507-116760529 CTATAAACGCAGAAGCTACTTGG + Intronic
1089342225 11:117765833-117765855 CTCTGGCCTCAGAGGGAACTGGG - Intronic
1089828046 11:121296915-121296937 CTAAAAACTCAGTGGGAAAACGG + Intronic
1091423102 12:360595-360617 TTAAAAACTCAGTGGTAACTTGG + Intronic
1092426409 12:8379085-8379107 CTATAAACACAGCAGGTACTGGG + Intergenic
1095813659 12:46398154-46398176 CTAAAAACTCACAAGAAACTAGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098392383 12:69983098-69983120 CAAAAAACTCAGGAGGAACTGGG + Intergenic
1099769823 12:87036901-87036923 CTATAAAATAATAGGGAACAGGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100282427 12:93130610-93130632 CTATAAACTCCTTGGGAAGTCGG - Intergenic
1101944575 12:109126803-109126825 CTATACTCTCAGAGGGCCCTGGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108549585 13:51530319-51530341 CTAAAAACTCTGAGTAAACTAGG + Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115536523 14:34378454-34378476 CTATAAACTCAGAATGGACTAGG - Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1118763795 14:68896530-68896552 CCATGAACTCTGAGGGATCTAGG + Intronic
1118944693 14:70373462-70373484 CTATGATCTTATAGGGAACTTGG + Intronic
1124249798 15:28099308-28099330 GTAAGAACTCAGAGGGAGCTCGG + Exonic
1126434905 15:48626613-48626635 CTATAAAGTCAGAGGAAGTTAGG + Intronic
1128759632 15:70207358-70207380 CTATGAAGTCAGATGGATCTGGG + Intergenic
1132366157 15:101258550-101258572 CCCTAAACTCTGAGGGAAGTAGG + Intergenic
1133371889 16:5251481-5251503 CTATAAACACAGCAGGTACTAGG - Intergenic
1139274683 16:65716596-65716618 CTAAAGACTCAGTGGGAACAAGG + Intergenic
1144623968 17:16835039-16835061 CAATAAATACTGAGGGAACTCGG - Intergenic
1144882457 17:18437677-18437699 CAATAAATACTGAGGGAACTCGG + Intergenic
1145149777 17:20506709-20506731 CAATAAATACTGAGGGAACTCGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147173692 17:38637486-38637508 CTAAAAACAAAGAAGGAACTGGG + Intergenic
1148808441 17:50275812-50275834 ATATATACAGAGAGGGAACTTGG - Intronic
1149532712 17:57408239-57408261 TTATATACTAAGAGGGAAATGGG - Intronic
1156588328 18:38457701-38457723 ATATAAACTAAGAGGAAACAGGG - Intergenic
1157253112 18:46113932-46113954 CTGTCAACTCAGAGTGACCTTGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158728058 18:59992921-59992943 CTGTAAAATGAGAGGGAAATGGG - Intergenic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
928251129 2:29681702-29681724 TGATAATCTCAGAGGGAAGTGGG - Intronic
928275165 2:29894137-29894159 CAAGAAACCCAGAGAGAACTTGG + Intronic
928587221 2:32772827-32772849 CTGAAAACCCAGAGGGGACTGGG - Intronic
928747719 2:34434667-34434689 ATAAAAAGGCAGAGGGAACTGGG - Intergenic
930350078 2:50240641-50240663 CTCTAGACTCAGAGAGATCTGGG + Intronic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
933703837 2:85275109-85275131 GTCTAAACACAGAGGGCACTGGG - Intronic
935431676 2:102982800-102982822 CCATTAAATCAGAGGGAACCTGG + Intergenic
939238481 2:139528568-139528590 GTATAAAATCAGAGAGAACTGGG + Intergenic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
939476616 2:142695257-142695279 CAATAAATACTGAGGGAACTCGG - Intergenic
941416746 2:165230657-165230679 CTATTAACTGCCAGGGAACTGGG + Intergenic
943736906 2:191366250-191366272 TTATAAAGTCAGAGGCACCTGGG - Intronic
944514854 2:200502666-200502688 CTATAAACTCTGGGAGGACTGGG - Intronic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
947550322 2:231040884-231040906 CTATAAAGTCAACAGGAACTAGG - Intronic
948931869 2:241137199-241137221 CTTTAAGCTCAGAGGGAAGGTGG + Exonic
1168791695 20:581906-581928 CCACAGACTCTGAGGGAACTGGG + Intergenic
1169199722 20:3703007-3703029 ATATAAAATAGGAGGGAACTAGG + Intronic
1170100654 20:12695914-12695936 CTCTAGACTCAGAGGGACTTGGG - Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1177886528 21:26752930-26752952 TTATAACCTCAGAGTGAACAAGG + Intergenic
1179299956 21:40098934-40098956 CTAGAAGTTCAGAGGGAATTTGG + Intronic
1181986882 22:26806146-26806168 CTCTGAAATCACAGGGAACTAGG - Intergenic
1182121401 22:27789502-27789524 CTATAAACTCCAGGGGAAGTAGG + Intronic
1182764505 22:32748984-32749006 CTATTAACAGAGAGGGAATTGGG - Intronic
949373364 3:3359933-3359955 CTCTAGACTCAGAGAGACCTGGG + Intergenic
949793264 3:7816936-7816958 CTGTCATGTCAGAGGGAACTGGG + Intergenic
952101435 3:30017644-30017666 CTAGAACCTCAGAGGGAGCATGG + Intergenic
952905324 3:38136332-38136354 CAATAAATACTGAGGGAACTCGG + Intronic
954493163 3:50926880-50926902 CTATAAACTGCAAGGGAACATGG - Intronic
955693550 3:61613633-61613655 CTATGAAATCAGAATGAACTGGG + Intronic
956269131 3:67431413-67431435 CTAAAAACTCTCAGTGAACTAGG + Intronic
957071093 3:75568390-75568412 CTATAAACACAGCAGGTACTAGG + Intergenic
957705310 3:83772537-83772559 CTATAACCTCAGAATGCACTAGG - Intergenic
960036640 3:113109063-113109085 TTAGAAACTAAGAGGGAAGTGGG + Intergenic
962753835 3:138453397-138453419 CTTTAAACTCAGGAGGCACTTGG + Intronic
965636243 3:170784174-170784196 CTATTATCTCAGAAGGAACTTGG + Intronic
966962575 3:184954668-184954690 CTATAAAGTCAGAGATAATTAGG - Intronic
969014693 4:4096087-4096109 CTATAAACACAGCAGGTACTAGG + Intergenic
969739248 4:9012353-9012375 CTATAAACACAGCAGGTACTAGG - Intergenic
969798432 4:9543866-9543888 CTATAAACACAGCAGGTACTAGG - Intergenic
972386392 4:38570476-38570498 CTAATCACTCAGGGGGAACTAGG + Intergenic
972890826 4:43554111-43554133 CTATAAACTCAAAAGCAAGTTGG - Intergenic
972940050 4:44184861-44184883 TTATAAACTCTGAGGGATATGGG - Intronic
973931454 4:55796647-55796669 CTTTCAACTCAGAGAGACCTGGG + Intergenic
974154458 4:58053135-58053157 CTTGAAACTCTGAGGGCACTGGG - Intergenic
974276656 4:59729183-59729205 CTAGAGACTCAGAGTGATCTTGG - Intergenic
977250677 4:94685259-94685281 CTACAACCACAGAGAGAACTGGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978750007 4:112235695-112235717 CTCTGAATTCAGAGGGACCTGGG - Intronic
978844447 4:113255326-113255348 TTATAAATACAGAGGGAAGTGGG - Intronic
979521062 4:121666974-121666996 CAATAAACTCACAGAGAGCTGGG + Intergenic
981576770 4:146213727-146213749 CTATAAACACCAAGGGAAATTGG - Intergenic
982499146 4:156131436-156131458 CTAGAAAATCTGAGGTAACTAGG + Intergenic
983911327 4:173242781-173242803 CCAGAAATTCAGAGGGAACAAGG - Intronic
986681924 5:10241211-10241233 CTATAAATTAAGAGGGAGCCAGG - Intronic
988633955 5:32961405-32961427 CTACAACATCAGAGGGCACTTGG + Intergenic
989198048 5:38734939-38734961 CTATAGACTGAGAGGTGACTCGG + Intergenic
990759455 5:59112346-59112368 CTTTTAACTCTGAGGGAAATGGG + Intronic
991034488 5:62114481-62114503 CTAAAAACTGAGAGGCACCTGGG + Intergenic
992651116 5:78861572-78861594 CTAAAAACTCTCAGGAAACTAGG + Intronic
993761023 5:91797674-91797696 ATATAAAAACAGAGGGCACTTGG + Intergenic
999574580 5:152961767-152961789 CTGTAAACTCCAGGGGAACTGGG - Intergenic
1000927494 5:167211640-167211662 CTATAGTCTCAGAGGGCAGTGGG + Intergenic
1001383619 5:171319927-171319949 CTATAAACTCAGGCGTAACTAGG - Intergenic
1002996488 6:2290494-2290516 CTAAAAACTCTGAGTAAACTAGG + Intergenic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004290254 6:14360511-14360533 CTATAAACTCAGAAATAAATGGG - Intergenic
1005721086 6:28602790-28602812 CAATAAACTCAGATTGAACTTGG + Intronic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007277388 6:40685158-40685180 CAATAACCACAGAGTGAACTTGG - Intergenic
1013037193 6:106397416-106397438 CTATAGACTCAAAGAGAACTTGG + Intergenic
1013169508 6:107623806-107623828 CCAGAAACTCAGAGTGAAGTAGG + Intronic
1017968991 6:159293520-159293542 ATAAAAACTCAGAGGAAACCAGG - Intergenic
1021826598 7:24559042-24559064 CTATTCAATCAGAGAGAACTGGG - Intergenic
1021946318 7:25731264-25731286 AAATAAAATCAGAGGGAATTTGG - Intergenic
1026736463 7:72952015-72952037 CAATAAAAACTGAGGGAACTCGG + Intergenic
1027107271 7:75413047-75413069 CAATAAAAACTGAGGGAACTCGG - Intergenic
1028951245 7:96637625-96637647 ATTTAAACTGAGAGTGAACTGGG - Intronic
1029073365 7:97917717-97917739 CTATAAACACAGCAGGTACTAGG + Intergenic
1032667469 7:134051339-134051361 GAAGAAACTCAGAGGGAGCTGGG + Intronic
1033482015 7:141751921-141751943 CAATAAATACTGAGGGAACTCGG + Intronic
1036256420 8:7210166-7210188 CTATAAACACAGCAGGTACTAGG + Intergenic
1036308470 8:7668751-7668773 CTATAAACACAGCAGGTACTAGG + Intergenic
1036361064 8:8077326-8077348 CTATAAACACAGCAGGTACTAGG - Intergenic
1036889899 8:12589675-12589697 CTATAAACACAGCAGGTACTAGG + Intergenic
1036897506 8:12647836-12647858 CTATAAACACAGCAGGTACTAGG + Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038191363 8:25324078-25324100 CTAGAAACCCAGAGGGCTCTGGG + Intronic
1041281626 8:56215817-56215839 CTATAAATTCAAAGGAAAGTAGG - Intronic
1042507323 8:69574483-69574505 ATATAAAAATAGAGGGAACTTGG - Intronic
1042652041 8:71053613-71053635 CCACAAACTCAGATGGGACTAGG - Intergenic
1046842671 8:118877512-118877534 CTAAAAGCACAGTGGGAACTGGG + Intergenic
1047291287 8:123532504-123532526 CTATGAACACAGAGGGAATTGGG + Intronic
1049913863 9:297317-297339 CTCTAGAGTCAGAAGGAACTGGG - Intronic
1051284847 9:15485196-15485218 CCATAAAGTCTGAGGGAAATGGG - Intronic
1051725922 9:20088366-20088388 CTAGAGAATCAGAGGCAACTAGG + Intergenic
1054343762 9:63893823-63893845 CTATGCACTCAGAGGCAATTTGG + Intergenic
1056180891 9:84081109-84081131 GTCTAAGCTCAGAGGGAAATTGG + Intergenic
1058710536 9:107675186-107675208 CTAGAAGGTCAGAGAGAACTGGG + Intergenic
1185467013 X:361231-361253 CTATAACCTCAGAGAAAACCTGG + Intronic
1186300045 X:8190665-8190687 CTATGAACTCAGTGTGACCTTGG + Intergenic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1189974522 X:46447869-46447891 CTAGAAACTCTGCGGGAGCTGGG + Intronic
1191227954 X:58065482-58065504 CAATAAACACTGAGGGAACTCGG - Intergenic
1191877350 X:65810013-65810035 CTATAAAATCTGAGGTGACTAGG + Intergenic
1192018894 X:67362960-67362982 CTATAAACACTCAGTGAACTAGG + Intergenic
1192058966 X:67803594-67803616 GTATAAAGTCAAAGGGAATTGGG - Intergenic
1193408662 X:81136306-81136328 CTATAAACTCACAAGGAAAAAGG - Intronic
1194635173 X:96337472-96337494 CAAGAAAATCAGAGGGATCTGGG - Intergenic
1199839049 X:151625069-151625091 CTATAAACCCAGAGAGAAACTGG - Intronic
1202098546 Y:21280847-21280869 CTAAAAACTCTCAGTGAACTAGG + Intergenic