ID: 1118261255

View in Genome Browser
Species Human (GRCh38)
Location 14:64248908-64248930
Sequence CTTCTAAGCTGCCCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118261249_1118261255 24 Left 1118261249 14:64248861-64248883 CCTTTCTATATCGCATATCTGTG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1118261251_1118261255 -9 Left 1118261251 14:64248894-64248916 CCCTGCCTGAACCTCTTCTAAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1118261250_1118261255 -8 Left 1118261250 14:64248893-64248915 CCCCTGCCTGAACCTCTTCTAAG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1118261252_1118261255 -10 Left 1118261252 14:64248895-64248917 CCTGCCTGAACCTCTTCTAAGCT 0: 1
1: 0
2: 1
3: 22
4: 185
Right 1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118261255 Original CRISPR CTTCTAAGCTGCCCAAAGCC TGG Intronic