ID: 1118261409

View in Genome Browser
Species Human (GRCh38)
Location 14:64250708-64250730
Sequence CTGAGTTCGGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118261409_1118261422 28 Left 1118261409 14:64250708-64250730 CCCTCCTCCTTCCCCGAACTCAG 0: 1
1: 0
2: 5
3: 51
4: 505
Right 1118261422 14:64250759-64250781 GGAAGAGCCTCTGACACCACTGG 0: 1
1: 0
2: 0
3: 17
4: 178
1118261409_1118261421 7 Left 1118261409 14:64250708-64250730 CCCTCCTCCTTCCCCGAACTCAG 0: 1
1: 0
2: 5
3: 51
4: 505
Right 1118261421 14:64250738-64250760 CCAGCGATGGCAGTATTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 112
1118261409_1118261419 6 Left 1118261409 14:64250708-64250730 CCCTCCTCCTTCCCCGAACTCAG 0: 1
1: 0
2: 5
3: 51
4: 505
Right 1118261419 14:64250737-64250759 TCCAGCGATGGCAGTATTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 85
1118261409_1118261418 -6 Left 1118261409 14:64250708-64250730 CCCTCCTCCTTCCCCGAACTCAG 0: 1
1: 0
2: 5
3: 51
4: 505
Right 1118261418 14:64250725-64250747 ACTCAGGGCATTTCCAGCGATGG 0: 1
1: 0
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118261409 Original CRISPR CTGAGTTCGGGGAAGGAGGA GGG (reversed) Intronic
900117659 1:1035335-1035357 CTGAGTTCGGGGGACCTGGATGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903046179 1:20565902-20565924 CGGAGGTTGGGGAAGGAGTAGGG + Intergenic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904458827 1:30663492-30663514 CTCAGTTTGGGGAAGAGGGAGGG - Intergenic
904475447 1:30762057-30762079 CTGGGTTCGGGGCAGGAGACAGG - Intergenic
904488990 1:30846730-30846752 CTGCGTTCTGGGCAGGAGGAAGG + Intergenic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
905201325 1:36319178-36319200 TGGGGTTGGGGGAAGGAGGAGGG + Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907187415 1:52620497-52620519 CTGAGATCAGAGAAGGAGGTAGG + Intergenic
908796857 1:67838682-67838704 CTGAGTTCTGGAAATGAGCAAGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
911061381 1:93751097-93751119 CTGAGTTCTGGTCAGGATGAAGG - Intronic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911635572 1:100231870-100231892 CTGCGCTAGGGAAAGGAGGATGG - Intronic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915515532 1:156410345-156410367 CTGATGTCGGGGCAGGGGGATGG - Intronic
915552926 1:156645585-156645607 CTGGGTTCGAGGAAGGAGTCTGG + Intronic
916702183 1:167308537-167308559 GTGAGACCAGGGAAGGAGGAAGG - Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917224805 1:172770156-172770178 TGGAGTTAGGGGAAGGAGCAAGG + Intergenic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
919841323 1:201611287-201611309 AAGAGCTTGGGGAAGGAGGATGG + Intergenic
919946119 1:202320095-202320117 CTGAGTTGGGGCAGGGAGAAAGG + Intergenic
920203019 1:204272039-204272061 CTTAATCCGGGGAAGGGGGAGGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920551999 1:206869799-206869821 GTGAGGTGGGGGAAGAAGGAAGG - Intergenic
921108444 1:212008584-212008606 CTGACGTCGGGGCAGGAGGACGG - Intronic
921582478 1:216911427-216911449 CAGAGGTTGGGCAAGGAGGAGGG + Intronic
922007087 1:221542129-221542151 CTGAGATTGGGAAAGTAGGAAGG - Intergenic
922032868 1:221820760-221820782 GTTAGTTGGGGGAGGGAGGAAGG - Intergenic
922994847 1:229947703-229947725 CTATGTTCGAGGAAGGAAGAAGG + Intergenic
924431708 1:244002913-244002935 CTGAATTGGGGGAAGGAATATGG + Intergenic
924583377 1:245341049-245341071 CTGGGATTGGGAAAGGAGGATGG - Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1064428611 10:15252360-15252382 CAGAGTTCAGTGAAGGTGGATGG - Intronic
1065970681 10:30803829-30803851 CTGAGTTAGAGGCAGCAGGAGGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1067043930 10:42974150-42974172 CTCAGTTTGGGGAAGGAGCTGGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070133051 10:73668095-73668117 CTGTATCCGGGAAAGGAGGATGG + Intergenic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1072127262 10:92457899-92457921 CTGAGTTCCTGGAAAGAGGCTGG - Intronic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1073288444 10:102401946-102401968 CTCAGATCGGGAAAGGAGGCTGG - Intronic
1074516929 10:114179197-114179219 CTGCTTCCGGGGAAGGCGGAGGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075208375 10:120466876-120466898 CTCAGTTCTAGGAAGGAGGGAGG - Intronic
1075257846 10:120939505-120939527 GAGAGCTCAGGGAAGGAGGAAGG - Intergenic
1075914344 10:126154577-126154599 CTGCCCTCTGGGAAGGAGGAAGG - Intronic
1076530195 10:131139908-131139930 CTGAGTTCAGGGAATGTGGCTGG + Intronic
1076738298 10:132468418-132468440 GGGAGTTCGGGGAGGGAGAAGGG + Intergenic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1078540876 11:12211973-12211995 CTGAGTTCTGGGTTGGATGAAGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1081492936 11:43581202-43581224 CTGAGTTGGGGGATCGCGGACGG + Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083397151 11:62399963-62399985 GAGAGTTCAGGGAAGGAGGTGGG - Intergenic
1083481074 11:62947334-62947356 CTTAGGTCGGGGAATTAGGAGGG - Intronic
1083545452 11:63545823-63545845 CTGATTTGGGGCAAGGAAGAAGG - Intronic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083798872 11:65034972-65034994 CCAAGTTCTGGGAAGGTGGAAGG - Intronic
1084260997 11:67978515-67978537 CAGAGTTCCGGAAAGGTGGAGGG - Intergenic
1084447438 11:69212097-69212119 TTGGGTTGGGGGACGGAGGAGGG - Intergenic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084560295 11:69901495-69901517 GAGAGTTGGGGGAAGGCGGAAGG - Intergenic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1086661549 11:89425647-89425669 ATGATTTGGGGGTAGGAGGAGGG + Intronic
1086980536 11:93192372-93192394 ATGAGTGCGGGGGAGGAGTAGGG + Intronic
1087692585 11:101338796-101338818 ATGGGTTCAGGGTAGGAGGAAGG + Intergenic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088741418 11:112770446-112770468 CAGAGGTCGGTAAAGGAGGAAGG - Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090885829 11:130875693-130875715 GTGAGGTCGGGGGAGGGGGAAGG + Exonic
1091791341 12:3273858-3273880 CTGAGATCGGGGAGGGAGCAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092030191 12:5277410-5277432 CTGATTTCAGGGGAGGAGGAGGG + Intergenic
1092160408 12:6312493-6312515 CTGGGTTGCGGGAAAGAGGAGGG + Intronic
1092262908 12:6962063-6962085 CTGACATGGGGGAAGGAAGAGGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093783629 12:23166976-23166998 CTAAGTTTGGGTAAGGAGGTAGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096972493 12:55678921-55678943 CTAAGTTCGGGGCTGGAGCAGGG + Intergenic
1097257792 12:57693903-57693925 CTGAAATTGGGGAACGAGGAGGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102469832 12:113153409-113153431 GTGAGTCCGGGGCAGGAGGCTGG + Intronic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102693574 12:114780699-114780721 CTAATTTCGGGGAAGGAAGCGGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103995910 12:124829941-124829963 CTGAATTCCGGGCAGCAGGAAGG - Intronic
1104467033 12:128999064-128999086 CTGAGTTCTGGACAGGAAGAAGG - Intergenic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104597931 12:130132653-130132675 CCATGTTCTGGGAAGGAGGAAGG - Intergenic
1104736396 12:131138264-131138286 CCGAGCCTGGGGAAGGAGGATGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106076131 13:26462671-26462693 CTCAGTTCTGGGGAGGAGCAAGG + Intergenic
1106100339 13:26689858-26689880 CTGAGCTCTGGGAGGCAGGAAGG + Intergenic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1107237697 13:38192753-38192775 ATGAGGTCAGGGAAGGAGGGCGG - Intergenic
1107842614 13:44474737-44474759 GGGAGGTAGGGGAAGGAGGACGG + Intronic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109992206 13:70073408-70073430 TGGGGTTCGGGGAGGGAGGAGGG + Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113741381 13:112714470-112714492 CAGGGTTCGGGGAGTGAGGAGGG - Intronic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1114446729 14:22794328-22794350 CTGAGTTCCAGGAAGGAGAGCGG - Intronic
1115030163 14:28785272-28785294 CAGGCTTCGGGGAAGGAGGGAGG + Intronic
1115496864 14:34013509-34013531 CTCAGTGTGGGGAAAGAGGACGG - Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117812104 14:59558168-59558190 GTGTGTTCGAGGAAGAAGGATGG + Intronic
1118138059 14:63049522-63049544 CTGAGTTGGGGGGAGCAGAAAGG - Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119739373 14:77004214-77004236 CTGAGTTGGGGGTTGGGGGAAGG + Intergenic
1120401436 14:84037444-84037466 CTGAGCTCTGGGAAGCAAGAGGG - Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120836290 14:89040934-89040956 CTGAGTCCGTGGAAAGAGGCTGG + Intergenic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1122087324 14:99316876-99316898 CTGGGTTCGGGGAAAGAGGGCGG + Intergenic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1122955811 14:105070456-105070478 CTGTGTTCCAGGAATGAGGAAGG + Intergenic
1123434724 15:20246815-20246837 ATGAGTGCAGGGAAGGAGCAAGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1125944835 15:43704414-43704436 CTGAGTTGGGAGCAGGAGGGAGG - Intergenic
1127033147 15:54886349-54886371 GTGAGGTCGGGGGAGGGGGAAGG + Intergenic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127903450 15:63358560-63358582 ATGAGTGCTGGGAAGGCGGATGG - Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128665404 15:69533881-69533903 CTGGGTTCAGGGAATGAGGTTGG + Intergenic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132997682 16:2831703-2831725 CTGCATCCCGGGAAGGAGGATGG + Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136179092 16:28538745-28538767 CTGATTTCGGGAGAGGAGGAAGG + Intronic
1136608396 16:31351919-31351941 CTGGGTTCAGGGACGGAGCAGGG + Intergenic
1136654493 16:31701829-31701851 CTGATCTCTGGGAAGGAGGATGG + Intergenic
1137532438 16:49287906-49287928 TTGAGTCCAGGGGAGGAGGATGG - Intergenic
1137690488 16:50423450-50423472 CTGATTCCAGGGAAGCAGGAGGG - Intergenic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1140611682 16:76607566-76607588 CTCAGTATGGGAAAGGAGGAGGG + Intronic
1141225411 16:82110437-82110459 GTGAGTTCTGGGAAGGGGGGTGG - Intergenic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1143100853 17:4503928-4503950 CTGAGCTGGGTGCAGGAGGAGGG + Intronic
1143341965 17:6218660-6218682 CTGAGACCGGGGAAGCAGGCAGG - Intergenic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143924990 17:10361738-10361760 CTGAGTTTGGGGAAGAACGCAGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145254944 17:21317276-21317298 CTGAGGTGGGGGAATGGGGATGG + Intergenic
1145321658 17:21770689-21770711 CTGAGGTGGGGGAATGGGGATGG - Intergenic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1147169092 17:38607652-38607674 CTGAGTTGGGGGCAGGTGAAGGG - Intergenic
1147309580 17:39587215-39587237 TGGAGTTCTGGAAAGGAGGAAGG + Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148154575 17:45415556-45415578 CTAAGATCGGGGAAGGAGGAGGG - Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1149573785 17:57696861-57696883 AAGAGTTTGGGGAAGAAGGATGG - Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1151894341 17:76969880-76969902 CGGAGTCCAGGGAAGGGGGAGGG - Intergenic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1153321605 18:3779120-3779142 CTGAGATCGGGACAGAAGGAGGG - Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153597320 18:6740939-6740961 CTGGGTTCGGGGAAGCAGGAAGG + Intronic
1154002516 18:10494521-10494543 GTCAGTGTGGGGAAGGAGGATGG - Intergenic
1154151668 18:11910945-11910967 CTGACTCCGGAGATGGAGGAAGG + Intergenic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156841808 18:41617860-41617882 TGGAGGTGGGGGAAGGAGGAGGG - Intergenic
1157059749 18:44274413-44274435 CTGAGTTCGGGTTGGGAGCAGGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1160803515 19:980937-980959 GGGAGGTCGAGGAAGGAGGATGG + Intergenic
1160830848 19:1104342-1104364 CTGGGGTCGGGGAAGGGGAAGGG + Intronic
1161830985 19:6604074-6604096 CTGAGTTCCAGGAAACAGGAAGG + Intronic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162751444 19:12832506-12832528 CTGAGATTAGGGAAGGAGAAAGG - Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163745348 19:19043437-19043459 TTGAGATGGGGGCAGGAGGAGGG - Intronic
1165329114 19:35131608-35131630 CTGAGGTGGGGGCAGGAGCATGG - Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166354280 19:42217729-42217751 GCGAGTTGGGGGAAGGAGGAGGG - Intronic
1167492737 19:49801676-49801698 GTCAGTTCGGGTCAGGAGGAGGG - Intronic
1167560111 19:50221928-50221950 TTGACTTGGGGGAAGGAGCAGGG - Intronic
1167562934 19:50237296-50237318 CTGAGTTGGGGTAGGGAGGTTGG - Intronic
1167750164 19:51374631-51374653 CTGAGTTTGGGGATGGAGTTGGG - Intergenic
1167967220 19:53157791-53157813 CAGAGTCCGGGAGAGGAGGAGGG - Intronic
1168272130 19:55255740-55255762 AAGAGCTCCGGGAAGGAGGAGGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
926167640 2:10531351-10531373 CTAAGGTCGGGGCAGGAGGTGGG + Intergenic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926784856 2:16508927-16508949 CTGAGAGCCGGGAAGAAGGAAGG - Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
930965359 2:57317253-57317275 CTGGCTTCAGGGAATGAGGAAGG - Intergenic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
934856408 2:97732884-97732906 CTGAGGCCGCGGAAGGAGCAGGG + Exonic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935052411 2:99535038-99535060 CAGAGGTCGGGGAAGGAGAATGG - Intergenic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
936040960 2:109149103-109149125 CTGGGCTCTGGGAAGGAGCAGGG + Intronic
936245972 2:110827585-110827607 CTGAGTTCTTGGCTGGAGGAAGG + Intronic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
938416277 2:131105752-131105774 CTGCAGTCGGGAAAGGAGGAGGG - Intronic
939348574 2:141001461-141001483 GTGAGGTGGGGGACGGAGGAGGG - Intronic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
941233825 2:162944480-162944502 CTTAGTTTGGGGAAAGAAGAGGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942079527 2:172386788-172386810 CTGATTTCTGTGAAGGAGAAAGG + Intergenic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
944452568 2:199857772-199857794 AAGATTTGGGGGAAGGAGGAAGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945136350 2:206632243-206632265 CTCACTTCGGTGAAGGAGCAGGG + Intergenic
947273574 2:228367065-228367087 GTGGGGTCGGGGAAGGGGGAGGG - Intergenic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948598100 2:239093281-239093303 CTGCTTTCGGGGAAGGTGGCTGG + Intronic
948611230 2:239168312-239168334 ATAAGCTCGGGGAAGGAGCAGGG - Intronic
948717450 2:239874455-239874477 CTGAGTGCCGTGAAGCAGGAAGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168938301 20:1686827-1686849 CTCAGTTCGGGGCAGGAGGAGGG + Intergenic
1169202040 20:3715902-3715924 CTGCATTCGGGAAAGCAGGATGG + Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1172803964 20:37598181-37598203 GGGAGGTGGGGGAAGGAGGAGGG - Intergenic
1173235879 20:41244923-41244945 CTTACTTCAGGGAGGGAGGAAGG + Intronic
1173785710 20:45791695-45791717 ATGACTGCGGGGTAGGAGGAAGG - Intronic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174693118 20:52529386-52529408 CTGATGTCTGGAAAGGAGGAAGG - Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175033190 20:55975144-55975166 CTGACTTCTGGGAATGAGAAGGG - Intergenic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1175418583 20:58817300-58817322 GTGAGGTCGGGGAAGGAGCGGGG + Intergenic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175830888 20:61965183-61965205 CTGAGGTCCGGGAAGGCGGGGGG + Intronic
1177181930 21:17753708-17753730 CTCAGTTTGGGGGAGGAAGAGGG - Intergenic
1178919556 21:36729625-36729647 GTGAGGTCGGGGAAAGAGGGAGG - Intronic
1179308861 21:40179350-40179372 CTGAGTTCAGGGAGGGGTGATGG + Intronic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181629439 22:24142870-24142892 CTGACTTGGGGGAAGGAGTGAGG - Intronic
1181780714 22:25190931-25190953 CTGAGTTCCTGTAAAGAGGATGG + Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1183301773 22:37062306-37062328 CTGAGTTGGGGGGAGCAGCAAGG - Intronic
1183332241 22:37227905-37227927 CTTAGTCCGTGGAAGGAGGGCGG + Intronic
1184769360 22:46588679-46588701 ATCAGGCCGGGGAAGGAGGACGG - Intronic
1185100576 22:48838829-48838851 CTGAGCTGGGAGAAGGAGGTGGG + Intronic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
950018068 3:9768206-9768228 GGGAGTCGGGGGAAGGAGGAGGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
951477786 3:23126775-23126797 AGGAGTTGGGGAAAGGAGGAAGG - Intergenic
953404387 3:42653449-42653471 GTGAGCTTGGGGTAGGAGGAGGG + Intergenic
954155961 3:48685172-48685194 CGGGGTTGGGGGAAGAAGGAAGG + Intronic
954415660 3:50392078-50392100 CTGAGTTCTGGGAGGGAACATGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955044750 3:55349222-55349244 CTGAGTATGGGGAAGAAGCATGG - Intergenic
955689797 3:61579743-61579765 CTGAGTTCTGAAAAGGAGAAAGG + Intronic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958780020 3:98530040-98530062 CTGAGGTCAGGGAAGGATAAAGG - Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
961475052 3:127141005-127141027 CTGAGTTTGGGGAGAGATGATGG + Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
962051625 3:131821811-131821833 CAGAGGTCTGGGAAGCAGGAAGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
964454008 3:156840892-156840914 CTTAGTTCAGGGCAAGAGGAAGG - Intronic
965554123 3:170002116-170002138 CAGAATCCGGGGAAGGAGCAAGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967424738 3:189313979-189314001 CTAAGTTCGGAGCAGTAGGAAGG + Intronic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968217314 3:196904404-196904426 ATGAGATCAGGGAAGGAGGCAGG + Intronic
968292806 3:197552041-197552063 CTGAGTTCAGGGGAGAAGGTTGG - Intronic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969599892 4:8170104-8170126 CTGGGTTCAGGGTAGGAGGGTGG + Intergenic
971219922 4:24695717-24695739 CTGAGCTGGGAGAAGAAGGAGGG + Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
973966222 4:56164642-56164664 CAGAGGTTGGGGACGGAGGATGG + Intergenic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
976241315 4:82960265-82960287 GTGAGTTTGAGGCAGGAGGATGG - Intronic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
978167948 4:105631455-105631477 GTGAGTTTGGGGAAAGAAGACGG - Intronic
978567990 4:110104974-110104996 GTCAGTTCGGGGAATGAGGGTGG + Intronic
980335950 4:131473696-131473718 GGGAGTTGGGGGCAGGAGGAGGG - Intergenic
981483630 4:145262156-145262178 CTGACTTCAGGTAAGGAAGAAGG - Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982195670 4:152910287-152910309 CAGAGTTGGGGGAAGTGGGAGGG + Exonic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985927097 5:3027143-3027165 CTGAATCCGGGGCAGGATGAAGG - Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986315901 5:6586173-6586195 CTGAGTGCCAGGGAGGAGGAGGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
990825378 5:59893171-59893193 CTGAGTCCCTGGAACGAGGAGGG + Exonic
991937344 5:71815261-71815283 GTGAGGTGGGGGATGGAGGAAGG + Intergenic
992012614 5:72544355-72544377 TGGGGTTCGGGGAAGGGGGAGGG - Intergenic
993145386 5:84086904-84086926 CTGAGTTCCTGGAAGGATGGAGG + Intronic
993184686 5:84602034-84602056 CTGAAGTCTGGAAAGGAGGACGG - Intergenic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
995831481 5:116360195-116360217 CTGAGATGGGGGCAGGAGCAGGG + Intronic
996201455 5:120679837-120679859 CTGAGTTGGGGGACAGAGAATGG + Intronic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
997474965 5:134137547-134137569 CTGATTTAGGGGATTGAGGAGGG + Intronic
997760812 5:136445961-136445983 GTGTGTTCGGGAGAGGAGGAAGG - Intergenic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999590491 5:153139784-153139806 GTGAGATGGGGAAAGGAGGAGGG - Intergenic
1000020973 5:157319188-157319210 GTGAGTTAGGGTAAGGAGAAGGG + Intronic
1000854400 5:166380505-166380527 TGGGGTTGGGGGAAGGAGGAGGG - Intergenic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001461636 5:171920364-171920386 ATATGTTCGGTGAAGGAGGATGG + Intronic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001922154 5:175609217-175609239 CTGAGTTCTAGGAGGGAAGATGG + Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002606060 5:180383444-180383466 CTGAGTACGGTGGAGCAGGAAGG - Intergenic
1003496095 6:6664491-6664513 ATGACTTCAGGGAAGGAAGAGGG - Intergenic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1005882529 6:30072017-30072039 CTGACTTCGAGGGAGGAGTAAGG + Intronic
1006424032 6:33952719-33952741 CTGTGTTCGAGGCAGCAGGAAGG + Intergenic
1008101555 6:47397228-47397250 TTGAGTTTGGGAAAGAAGGAAGG + Intergenic
1008967496 6:57327864-57327886 CTGAGGTCGGGGGATGGGGAGGG + Intronic
1010932503 6:81819595-81819617 CCGAGTTGGGGGAAGAAGGCTGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013175527 6:107673469-107673491 CTGAGTTCGGCTGAGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013948962 6:115756262-115756284 TTCAATTTGGGGAAGGAGGAAGG + Intergenic
1015949440 6:138536773-138536795 TGGAGTTGGGGGAAAGAGGAGGG - Intronic
1015976571 6:138796606-138796628 CTGGGTTGGGGGAATGAGGGAGG + Intronic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016900388 6:149095262-149095284 CTGAGTTCTGGGTAGTACGAGGG - Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017237262 6:152129782-152129804 CTGAATTCCTGGAAGGAGGGTGG - Intronic
1018884315 6:167920232-167920254 ACGAGGTTGGGGAAGGAGGAGGG + Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019356731 7:584017-584039 CTCAGTTCCGGGAAGGATAACGG - Intronic
1019386517 7:759731-759753 CTGCGTTCGTGGCAGGAGGGTGG + Intronic
1019815380 7:3196119-3196141 CTGAGTGCTGGAAGGGAGGATGG - Intergenic
1021272595 7:18609771-18609793 CGGAGTTGGGGGAGGGGGGAGGG - Intronic
1021322159 7:19225800-19225822 TTGAGTTAGAGGTAGGAGGAAGG - Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022358474 7:29638052-29638074 CTGAGATCTGGGAACAAGGAGGG + Intergenic
1022530007 7:31061157-31061179 CTGAGGTCGCGGAAGGTGCAGGG + Intronic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1024013173 7:45287956-45287978 CTGGCCTCTGGGAAGGAGGAGGG - Intergenic
1024485230 7:49910138-49910160 CAGAGTTCAGGGAGGGAGAAGGG + Intronic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026765516 7:73157158-73157180 CTGAGTTGGGGGCTGGAAGAAGG - Intergenic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027041989 7:74966851-74966873 CTGAGTTGGGGGCTGGAAGAAGG - Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027081652 7:75235503-75235525 CTGAGTTGGGGGCTGGAAGAAGG + Intergenic
1027180577 7:75936570-75936592 CTCATTTCGGTAAAGGAGGAGGG + Intronic
1027374557 7:77537248-77537270 AGGAGGGCGGGGAAGGAGGATGG + Intergenic
1029104094 7:98160657-98160679 CTGATTTGGGGGAAGGAGTGTGG + Intronic
1029186848 7:98745441-98745463 CTGGTTTCGGGGAGGGAGGGAGG - Intergenic
1029390238 7:100270084-100270106 CTGAGTTGGGGGCTGGAAGAAGG + Intronic
1030070529 7:105693976-105693998 CTGGGGTGGGGAAAGGAGGAGGG + Intronic
1031464407 7:122090930-122090952 AGGGGTTGGGGGAAGGAGGATGG - Intronic
1031912736 7:127534617-127534639 ATGAGGTCGGGGAAAGAGAAAGG + Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032638427 7:133736825-133736847 CTGGGTTTGGGGAAAGAGTAGGG - Intronic
1033032760 7:137843931-137843953 CTGAGTTAGGGTATGGAGCATGG - Intronic
1034264306 7:149773661-149773683 AGGAGTTGGGGGAACGAGGAGGG + Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1035034489 7:155886043-155886065 TTCAGTTCTGGGAAGGAGGTTGG + Intergenic
1035170512 7:157014957-157014979 CTGAGCTCCAGGAAGGAGGTCGG - Intergenic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036937883 8:13021979-13022001 CTGAGTTCTGGGAATGATCATGG + Exonic
1038476558 8:27872544-27872566 GTGAATCCGGGGATGGAGGAGGG + Intronic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1039166809 8:34690549-34690571 TTGAGTTCAGAGAAGCAGGATGG - Intergenic
1039210179 8:35204726-35204748 ATGAGCTCAGGGAAGGAGGTGGG - Intergenic
1039613496 8:38937211-38937233 ATGACCTCAGGGAAGGAGGAAGG + Intronic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1039849557 8:41352088-41352110 TAGGGTTGGGGGAAGGAGGAGGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1042024804 8:64411703-64411725 CTGAGTTTGGGGAAGAAACAGGG - Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1043443379 8:80296727-80296749 CAGGGTTGGGGGAAAGAGGAGGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043655193 8:82655802-82655824 TGGAGTTGGGGGAAGGGGGAGGG - Intergenic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1048264164 8:132970972-132970994 TTGGGTTCAGGGAAGGAGAATGG + Intronic
1048306349 8:133287323-133287345 CTGAGTTCACGGAAGCAGGATGG + Intronic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048661520 8:136608162-136608184 CTGAGTTTTAGGAATGAGGAAGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048841750 8:138572754-138572776 CTGAGTCCAGGTGAGGAGGAAGG - Intergenic
1049184310 8:141241399-141241421 CTGCCTTCGGGGAAGGGAGATGG + Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049562225 8:143317541-143317563 CAGAGTCCTGGGGAGGAGGAGGG - Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1051181128 9:14412985-14413007 GTGATTTGAGGGAAGGAGGAGGG - Intergenic
1051679360 9:19591600-19591622 CTGTATTCTTGGAAGGAGGAAGG - Intronic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1053055451 9:34990885-34990907 ATGAGTTGGAGGAAGCAGGAAGG - Intronic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053718629 9:40922433-40922455 GTGAGTTGGGGGAAGCAGGGAGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055256798 9:74381328-74381350 TTGATCTGGGGGAAGGAGGAAGG + Intergenic
1055552585 9:77445115-77445137 CTGATGGCGGGGAAGGAGAAGGG + Intronic
1055758754 9:79583565-79583587 GAGAGGTTGGGGAAGGAGGAGGG + Intronic
1055890434 9:81117965-81117987 CTGAGTTAAGGGAAGGACAATGG - Intergenic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056657599 9:88522120-88522142 CTGAGTGCCGGGAAGGAGCAGGG + Intergenic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1057519849 9:95751976-95751998 CTGAGCTCCGGGAGGGAGGGAGG + Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1060106274 9:120875584-120875606 CTGAGACCAGGGCAGGAGGATGG - Intronic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1062128607 9:134880483-134880505 CTGAGAACGGGGAACAAGGAAGG - Intergenic
1062170276 9:135131081-135131103 CTCAGTTCTGGGAAGCAGGAAGG - Intergenic
1062232825 9:135491633-135491655 CTGATGTCGGGGAACGGGGATGG + Intergenic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062565917 9:137163958-137163980 CGGCCTTCGGGGATGGAGGAGGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1186541523 X:10405885-10405907 CTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1193853710 X:86572093-86572115 CGGGGTGCGGGGAAGGGGGAGGG + Intronic
1194078881 X:89433008-89433030 CTGAGATGGTGGAAGGGGGAGGG - Intergenic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196053092 X:111326151-111326173 ATGAGTTGGGGGAAGGGGAATGG + Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1197692960 X:129522881-129522903 CCGAGTTCCGGGAAGGTGGAGGG + Intronic
1198208784 X:134496548-134496570 CTGAGTTCAGGTAGGGAGAAGGG + Intronic
1199886561 X:152026918-152026940 CTGAACTCGTGGGAGGAGGACGG - Intergenic
1199979044 X:152911061-152911083 CTGAGGTTGGGGGAGGAGCAGGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1202031200 Y:20576003-20576025 CTGTGTTCGGGAAAGGAGCTGGG + Intronic