ID: 1118262506

View in Genome Browser
Species Human (GRCh38)
Location 14:64260581-64260603
Sequence GCAGCTAGTGCTCACCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118262506_1118262516 25 Left 1118262506 14:64260581-64260603 CCAGGAGGGTGAGCACTAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1118262516 14:64260629-64260651 GCTCCCGCACTCGGGGCGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 110
1118262506_1118262515 18 Left 1118262506 14:64260581-64260603 CCAGGAGGGTGAGCACTAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1118262515 14:64260622-64260644 AGCAGCAGCTCCCGCACTCGGGG 0: 1
1: 0
2: 1
3: 10
4: 150
1118262506_1118262514 17 Left 1118262506 14:64260581-64260603 CCAGGAGGGTGAGCACTAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1118262514 14:64260621-64260643 CAGCAGCAGCTCCCGCACTCGGG 0: 1
1: 0
2: 3
3: 23
4: 295
1118262506_1118262511 -10 Left 1118262506 14:64260581-64260603 CCAGGAGGGTGAGCACTAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1118262511 14:64260594-64260616 CACTAGCTGCTCGGGGCTCAGGG 0: 1
1: 0
2: 2
3: 10
4: 99
1118262506_1118262513 16 Left 1118262506 14:64260581-64260603 CCAGGAGGGTGAGCACTAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1118262513 14:64260620-64260642 CCAGCAGCAGCTCCCGCACTCGG 0: 1
1: 0
2: 4
3: 29
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118262506 Original CRISPR GCAGCTAGTGCTCACCCTCC TGG (reversed) Exonic
901018116 1:6243064-6243086 GCAGCTACAGTTCAGCCTCCTGG + Intergenic
906322073 1:44823131-44823153 GCTGACAGTGCTCACGCTCCTGG - Exonic
912962812 1:114211156-114211178 GCTGCTAGTGTTCCCCTTCCAGG + Intergenic
914950402 1:152108992-152109014 GCAGCTGTTGCTCGCGCTCCTGG + Exonic
919825181 1:201498505-201498527 GCAACGAGAGCCCACCCTCCTGG + Intronic
920363616 1:205436333-205436355 GCAGCTACCGCTCACCCTCCTGG + Intronic
920676440 1:208041562-208041584 GCAGCTAGTGGCCACCATACGGG - Intronic
921623129 1:217348611-217348633 GCAGCAAGAGCTGACCCTCAAGG - Intergenic
921731991 1:218588905-218588927 GCAGCCAATGCTCACCAGCCTGG + Intergenic
922606459 1:226892657-226892679 GGAGCAGGTGCGCACCCTCCAGG + Intronic
922947810 1:229531645-229531667 GCAGCTTGGGCTCTCTCTCCAGG + Exonic
923141313 1:231163083-231163105 GCAGGTGCTGCTCACCGTCCGGG - Exonic
923270511 1:232351541-232351563 CCAATTAGTACTCACCCTCCTGG - Intergenic
924138868 1:241001004-241001026 GCAGCTAGTGACCACCTTACTGG + Intronic
1073816517 10:107213842-107213864 GCAGCTGGTGCTTAACCTCGAGG - Intergenic
1074166167 10:110877260-110877282 GTAGCTAGTGGTCACCATACTGG - Intronic
1075446173 10:122514791-122514813 GAAGCCAGCGCTCACCCACCCGG - Exonic
1076669994 10:132115203-132115225 GCGGCTAGGGGTCACCCTGCCGG + Intronic
1076705243 10:132297801-132297823 GCAGCAGGTGCACACCCGCCTGG + Intronic
1077138561 11:1013500-1013522 GCGGCTCGTACTCACCCTGCAGG - Exonic
1083622957 11:64057977-64057999 CCACCTTGTGCTCAGCCTCCTGG + Intronic
1084035172 11:66505189-66505211 GCAGCTGTTGATCACCATCCTGG - Intronic
1084190636 11:67497216-67497238 GCCCCTAGGACTCACCCTCCAGG + Exonic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084962164 11:72722590-72722612 GCAACAAGTGATCAGCCTCCAGG + Intronic
1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG + Intergenic
1090616219 11:128517783-128517805 CCAGCTCGTGGTCAACCTCCCGG - Intronic
1091031389 11:132191322-132191344 GCAGCCAGTGCTCAACCTCAAGG + Intronic
1092803884 12:12200783-12200805 ACAGCACTTGCTCACCCTCCTGG + Intronic
1094069061 12:26392990-26393012 TCTGCTAATCCTCACCCTCCAGG + Intronic
1096100942 12:48970164-48970186 GCAGCTGGTGCTGACACTCGTGG + Exonic
1096773109 12:53949110-53949132 CCATCTAGTGGTCACTCTCCGGG + Intergenic
1102547459 12:113667028-113667050 CCAGCTCCTACTCACCCTCCAGG - Intergenic
1103344605 12:120241034-120241056 GCATCTGGAGCTGACCCTCCTGG + Intronic
1104600356 12:130149302-130149324 GCATCCAGTGCTCAAGCTCCTGG - Intergenic
1104969068 12:132523063-132523085 GTAGCTCCTGCCCACCCTCCAGG + Intronic
1105539015 13:21298355-21298377 CGAGCTGGTGCTCACCCTTCGGG - Intergenic
1105799228 13:23889201-23889223 CCAGCTGGTGCTGACCCTTCGGG + Exonic
1111368219 13:87279020-87279042 GCAGCCAGTGCTCTCCAGCCTGG - Intergenic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1124652476 15:31483908-31483930 GCAGCTGGTGCTCAAGCTCAAGG - Exonic
1124994920 15:34714102-34714124 GCAACCAGTGCTCACCTTGCTGG + Intergenic
1125328415 15:38560211-38560233 GCAACTAGTGCTCTTCATCCTGG + Intronic
1129714249 15:77837791-77837813 GCGTCTAGTGCTCCCACTCCTGG - Intergenic
1129725379 15:77898987-77899009 CCAGCTGGTGCTCACCCGCAAGG + Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130273417 15:82464181-82464203 CCAGCTGGTGCTGACCCACCAGG + Intergenic
1130465768 15:84191552-84191574 CCAGCTGGTGCTGACCCACCAGG + Intergenic
1130498497 15:84481984-84482006 CCAGCTGGTGCTGACCCACCAGG - Intergenic
1130588057 15:85196148-85196170 CCAGCTGGTGCTGACCCACCAGG + Intergenic
1130968547 15:88715145-88715167 GGAGCCAGTGACCACCCTCCTGG + Intergenic
1131867088 15:96722537-96722559 GCAACTAAGGCCCACCCTCCTGG - Intergenic
1132684999 16:1158569-1158591 GCAGGCTGAGCTCACCCTCCGGG + Intronic
1133393581 16:5428659-5428681 CCAGCTCCTCCTCACCCTCCAGG - Intergenic
1134131165 16:11651150-11651172 GCACCCCATGCTCACCCTCCTGG - Intergenic
1138119499 16:54387847-54387869 TCACTTAGTGCTCACCCTGCCGG + Intergenic
1139724648 16:68887298-68887320 GCAGCTAGTGCACAGCCTCTGGG - Intronic
1141846384 16:86611646-86611668 GAGGCTAGGGCTCACCCTCTGGG + Intergenic
1143038836 17:4017334-4017356 TGAGCTTGTGCTCACCCACCAGG - Intronic
1143110961 17:4552527-4552549 ACAGCTAGAGCTCTTCCTCCTGG - Exonic
1151600666 17:75104271-75104293 GGAGCTAGAGGTCCCCCTCCTGG - Intronic
1151665101 17:75541242-75541264 GCAGGCAGTGGTCACTCTCCAGG + Intronic
1154012648 18:10589064-10589086 GAAGCTGGGGCTCACACTCCCGG - Intergenic
1156779722 18:40837010-40837032 GCAGCTACTGATCAACCTTCAGG + Intergenic
1157688248 18:49660373-49660395 GCAGCTGGAGCTCAGCCTCCAGG - Intergenic
1157696250 18:49726092-49726114 TCAGCTATTGCTGGCCCTCCAGG - Intergenic
1163062034 19:14767892-14767914 TCAGCTTCTGCTCACCCTCTTGG + Intronic
1163661005 19:18577447-18577469 ACAGCTGCTGCTCACTCTCCTGG + Exonic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1166746017 19:45142225-45142247 GCACATCCTGCTCACCCTCCCGG - Intronic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
925217904 2:2112990-2113012 GCAGCAAGTGCTCAGCCACTGGG + Intronic
927690475 2:25204542-25204564 GCAGCCTCTGCTCACCCTGCAGG - Intergenic
928371443 2:30742778-30742800 CCAGCAAGTGCTCACCCCACTGG - Intronic
928605951 2:32945771-32945793 GCAGCTAGTGCTCAGGCAGCTGG + Intergenic
929879856 2:45826132-45826154 GCAGATCCTCCTCACCCTCCTGG + Intronic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
933409148 2:81903328-81903350 GAAGCCAGTGATCACACTCCAGG + Intergenic
934976259 2:98804958-98804980 GCACCTAGTGGGCACCCACCAGG - Intronic
934987310 2:98896919-98896941 GCAGGCATTGCTCACCCTTCTGG + Intronic
936091799 2:109506353-109506375 GCTAGTGGTGCTCACCCTCCTGG - Intergenic
938243860 2:129762752-129762774 GGAGCCAGTGCCCACCCTCCAGG - Intergenic
939082251 2:137676146-137676168 GCAGCCAGGCCTCACCCTGCTGG - Intronic
940557726 2:155252708-155252730 TCTGCTAATGCTCTCCCTCCCGG + Intergenic
941995557 2:171598793-171598815 GCAGCTAGTGCCCACCATAATGG + Intergenic
943778844 2:191798937-191798959 CCAGGTAGTTCTCACCATCCTGG - Intergenic
947551240 2:231048263-231048285 TCAGCTAGTGCCTCCCCTCCAGG - Exonic
947729061 2:232418243-232418265 GGAGCGAGTGCTCAGCCTCCTGG - Intergenic
947741017 2:232485043-232485065 GGAGCGAGTGCTCAGCCTCCTGG - Exonic
947832251 2:233149849-233149871 GCAACTGGTGCCCAACCTCCAGG + Intronic
947995323 2:234522648-234522670 GCCTCTAGAGCTCAGCCTCCTGG + Intergenic
949059922 2:241950935-241950957 GCAGCTGGTCCTCACCGTCTCGG + Intergenic
1168994090 20:2119729-2119751 GGAGCTAGTGCTGATCCTCCTGG + Intronic
1172511567 20:35504468-35504490 GCAGCTGCTGCACATCCTCCTGG - Exonic
1173712905 20:45176129-45176151 CCAGCTAGTGCTCACCTCACTGG - Exonic
1173899160 20:46574479-46574501 GCAGGGAGTGCTCACTCTCCGGG - Intronic
1174477380 20:50805603-50805625 GCAGCTGATGTTCAGCCTCCAGG - Intronic
1175863874 20:62164239-62164261 GCCGCCAGTGCTCACCGTCGGGG - Exonic
1176016919 20:62938450-62938472 GCAGTCAGGGCTCAGCCTCCAGG + Intronic
1176248143 20:64107124-64107146 GCAGCTGCTGGCCACCCTCCTGG + Exonic
1176413628 21:6462133-6462155 GCAGCAAGAGCCCATCCTCCTGG + Intergenic
1178847358 21:36184717-36184739 GCAGCAAGTGCTGACCCAGCAGG + Intronic
1179689126 21:43070456-43070478 GCAGCAAGAGCCCATCCTCCTGG + Intronic
1179822205 21:43943495-43943517 GCAGGCAGTCCTCACCCTCCTGG + Intronic
1180090817 21:45533117-45533139 ACAGCCTGTGCTCCCCCTCCTGG - Intronic
1180143793 21:45908811-45908833 GCGGCCTGTGCCCACCCTCCTGG - Intronic
1180757534 22:18173003-18173025 ACAGCCAGTGGGCACCCTCCAGG - Intronic
1181370364 22:22410336-22410358 GCTGCCGGGGCTCACCCTCCTGG - Intergenic
1181372981 22:22432519-22432541 GCAGCCGGGGCTCACCCTCCTGG - Intergenic
1183716044 22:39534262-39534284 TCAGCTCCTCCTCACCCTCCAGG - Intergenic
1183860296 22:40664974-40664996 TCAGCTCATGCTCTCCCTCCTGG + Intergenic
1184045337 22:41969526-41969548 TCAGCTCCTGCTCAGCCTCCAGG - Intergenic
951217623 3:20040215-20040237 GCCGCTAGTCCCCTCCCTCCTGG + Exonic
953759755 3:45677211-45677233 GCAGGTAGTGTTCACCTCCCTGG - Exonic
954428423 3:50456001-50456023 GCAGCTATTGCCCATCGTCCAGG + Intronic
954785622 3:53090228-53090250 GCAGCTGCTGATCACCCTCCCGG - Exonic
955054816 3:55445850-55445872 CCAGCCAGTGTCCACCCTCCAGG + Intergenic
955097420 3:55813354-55813376 GGAGCAAGTGGTTACCCTCCTGG + Intronic
955615326 3:60801079-60801101 GCACCTAGGGCTCAACCTGCTGG + Intronic
956325600 3:68049302-68049324 GCAGCTCTTGCTCAGCCACCAGG + Intronic
962669739 3:137692974-137692996 GCAGCTGCTGCTCAGCTTCCAGG - Intergenic
970251745 4:14123891-14123913 GCTGCTAGTAGCCACCCTCCTGG - Intergenic
973700109 4:53528785-53528807 CCAGCTAGTCCCCACCTTCCAGG - Intronic
975788919 4:77926378-77926400 GCAGCCAGGCCTCACCCTCTAGG + Intronic
975835968 4:78422535-78422557 GGAGCTAGTGCTCTTCCTTCAGG - Intronic
976705675 4:88016528-88016550 GCAACTATTTCTCACCCACCAGG + Intronic
985908172 5:2857948-2857970 AGAGATCGTGCTCACCCTCCTGG + Intergenic
986735351 5:10663731-10663753 GCAGCTCCTGCTCATCCCCCAGG - Intergenic
987366643 5:17154379-17154401 GCAGCTAATTATCAGCCTCCTGG + Intronic
992526808 5:77619593-77619615 ACAGGTAGTCCTCATCCTCCTGG - Intronic
992648214 5:78832114-78832136 GCAGCAAGAGCTCACCGTCCTGG + Intronic
1001713461 5:173795775-173795797 GCAGGAAGTGCTCAGTCTCCTGG - Intergenic
1002533722 5:179864675-179864697 GCACGTGGTGCCCACCCTCCAGG + Intronic
1002818651 6:701846-701868 GCAGCTAGTGCTTCTGCTCCGGG - Intergenic
1003500020 6:6696005-6696027 CCAACTAGACCTCACCCTCCTGG - Intergenic
1003500073 6:6696192-6696214 CCAGCTAGACCTCACCCTCTTGG - Intergenic
1006068940 6:31483125-31483147 TCAGGGAGTGCTCACCTTCCAGG - Intergenic
1006453933 6:34121517-34121539 CCAGCCAGAGCTCCCCCTCCAGG + Intronic
1013396534 6:109746562-109746584 GCATCTTGTCCTCACCCTCTGGG - Intronic
1013836750 6:114343025-114343047 GCTGCCAGTCCACACCCTCCCGG + Exonic
1015004529 6:128263074-128263096 GAAGCGAGTGCTCACCCCACAGG + Intronic
1016970451 6:149757234-149757256 GGAGCTAGTGCCCACCCTGTTGG + Intronic
1018810983 6:167298036-167298058 GCAGCTGGTCTACACCCTCCTGG + Exonic
1021242867 7:18226371-18226393 GGAGCATGTGCTCAACCTCCAGG - Intronic
1022513864 7:30963358-30963380 GCAGCTTCAGCTCACCATCCAGG + Intronic
1032732060 7:134653415-134653437 TCAGCTAGTGTTCATACTCCTGG + Intronic
1034467337 7:151237829-151237851 GCAGCTGGTGCTGCCACTCCTGG + Exonic
1035699292 8:1626244-1626266 GCAGCGGGTGCTCACCCTCTGGG + Intronic
1035699319 8:1626356-1626378 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1035699332 8:1626412-1626434 GCAGCGGGTGCTCACCCTCTGGG + Intronic
1035699359 8:1626524-1626546 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1035699371 8:1626580-1626602 GCAGCAGGTGCTCAGCCTCTGGG + Intronic
1036659339 8:10697927-10697949 GCAGCGAGTTCTCCCGCTCCAGG - Exonic
1038275693 8:26118978-26119000 GCAGCTAGGGCAGACCCTCCAGG + Intergenic
1038625878 8:29192934-29192956 GCAGCCTGTGCTCTCCCTGCAGG - Intronic
1040030195 8:42816930-42816952 TGAGCAAGTGCTAACCCTCCAGG + Intergenic
1046216290 8:111152182-111152204 CCAGCTAGTGCTTAACCTCAAGG - Intergenic
1050268094 9:3912374-3912396 GTAGCCAGTGTTCACCCTCTTGG + Intronic
1050902261 9:10963480-10963502 GCAGAAAGTGTACACCCTCCAGG - Intergenic
1056937808 9:90930851-90930873 CCAGCTAATACTCACCTTCCAGG + Intergenic
1060264043 9:122099912-122099934 TCAACTCGTGCTCAGCCTCCAGG - Intergenic
1060415364 9:123426036-123426058 GCAGTTCCTGCCCACCCTCCAGG - Intronic
1060983830 9:127808623-127808645 ACCGCTGGTGCTCCCCCTCCAGG - Exonic
1062315519 9:135965230-135965252 GCAGGTAGTTCCCACCCTGCTGG + Intergenic
1191029959 X:55959061-55959083 GCAGCTGGTGCTTAACCTCAAGG + Intergenic
1200003533 X:153073680-153073702 GCAGCTCGTGCACGCGCTCCTGG + Exonic
1200004190 X:153076329-153076351 GCAGCTCGTGCACGCGCTCCTGG - Intergenic
1200074530 X:153544554-153544576 CCAGCTGCTGCTCTCCCTCCAGG - Intronic