ID: 1118264524

View in Genome Browser
Species Human (GRCh38)
Location 14:64282062-64282084
Sequence GACGTGATGAACACTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118264524_1118264526 -3 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264526 14:64282082-64282104 GTCTGTAATCCCAGCACTTTGGG 0: 8926
1: 233921
2: 277195
3: 180913
4: 143944
1118264524_1118264529 6 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264529 14:64282091-64282113 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1118264524_1118264525 -4 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264525 14:64282081-64282103 CGTCTGTAATCCCAGCACTTTGG 0: 4613
1: 136929
2: 281071
3: 222057
4: 151982
1118264524_1118264527 0 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264527 14:64282085-64282107 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1118264524_1118264534 24 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264534 14:64282109-64282131 CAAGGCAGGTGGATCATTTGAGG 0: 340
1: 4432
2: 19022
3: 46072
4: 77957
1118264524_1118264532 13 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264532 14:64282098-64282120 CTTTGGGAGGCCAAGGCAGGTGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
1118264524_1118264531 10 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264531 14:64282095-64282117 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1118264524_1118264535 29 Left 1118264524 14:64282062-64282084 CCAGGCACAGTGTTCATCACGTC 0: 1
1: 0
2: 2
3: 3
4: 119
Right 1118264535 14:64282114-64282136 CAGGTGGATCATTTGAGGTCAGG 0: 913
1: 9991
2: 40179
3: 80455
4: 119935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118264524 Original CRISPR GACGTGATGAACACTGTGCC TGG (reversed) Intronic
901285145 1:8072367-8072389 GACGTGAGGCACACTGAGCTTGG - Intergenic
905180130 1:36160476-36160498 GACATGCTGAGCATTGTGCCTGG - Intronic
905247094 1:36622651-36622673 GAGGTGTGAAACACTGTGCCTGG + Intergenic
905303036 1:36998594-36998616 GATGTGCTGAACACAGTGCTTGG - Intronic
906796560 1:48700829-48700851 GAGGTGATGAATACTGTCCATGG + Intronic
909320502 1:74280050-74280072 CAGGTGATGATCACAGTGCCTGG + Intronic
910348079 1:86263830-86263852 GAAGTCATGAACCCGGTGCCAGG - Intergenic
911945361 1:104100633-104100655 GACAAGATGACCACTGTGGCTGG + Intergenic
912588095 1:110785250-110785272 TATGTGCTGGACACTGTGCCAGG + Intergenic
915027767 1:152848697-152848719 AACTTGATGAACACTGTCCAGGG - Intergenic
917148667 1:171921223-171921245 CAGGTGTGGAACACTGTGCCCGG + Intronic
920102020 1:203522580-203522602 GGCGTGAGGAACTCTGTGCATGG + Intergenic
920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG + Intronic
923496480 1:234530108-234530130 GCAGTGCTGAAAACTGTGCCTGG + Intergenic
1069165739 10:65156491-65156513 GCCGTGTTGAACCCTGTGCTGGG - Intergenic
1069286152 10:66717709-66717731 GAGGTGATTAAGACTGTGCTGGG - Intronic
1075097034 10:119478840-119478862 GAAGTGATGATCTCTGAGCCAGG + Intergenic
1075208366 10:120466794-120466816 GAGGTGATGTAAGCTGTGCCAGG + Intronic
1076032226 10:127169342-127169364 GAAGTGATGGACACTGTGCCAGG - Intronic
1076357966 10:129866688-129866710 GAGGTGATGAAGTCAGTGCCCGG - Intronic
1076438610 10:130463574-130463596 GAAGTGCTGAGCACAGTGCCTGG + Intergenic
1077334996 11:1999328-1999350 GACGTGATGATCCCTGAGCGTGG + Intergenic
1084468319 11:69340325-69340347 GGCATGTTGAACACAGTGCCTGG + Intronic
1090329229 11:125917332-125917354 GAAGTGCTGAACATGGTGCCTGG - Intronic
1091010606 11:131997370-131997392 TACGTGCGGAACACTGGGCCAGG + Intronic
1202817979 11_KI270721v1_random:54510-54532 GACGTGATGATCCCTGAGCGTGG + Intergenic
1096587147 12:52630126-52630148 CACGTGATGAGCACTGATCCTGG - Intergenic
1101262206 12:103044704-103044726 CAAGAGATTAACACTGTGCCTGG + Intergenic
1104214545 12:126723353-126723375 CCTGTGATGCACACTGTGCCCGG + Intergenic
1106446678 13:29839507-29839529 GATGTGCAGACCACTGTGCCTGG - Intronic
1107493435 13:40901313-40901335 GAGGTGAGGAACCCTCTGCCTGG + Intergenic
1118264524 14:64282062-64282084 GACGTGATGAACACTGTGCCTGG - Intronic
1122552854 14:102559400-102559422 GAGGTGAAGAACAATTTGCCAGG - Intergenic
1130205224 15:81869415-81869437 GACGTGCTTAACACAGTGACTGG - Intergenic
1132316800 15:100895948-100895970 GGAGTGGTGAACATTGTGCCAGG + Exonic
1132425062 15:101709244-101709266 GACGTGATGAGCACTGCATCTGG - Intronic
1133643202 16:7737892-7737914 GACCTGATGAGAACTGTTCCAGG - Intergenic
1134687566 16:16169526-16169548 GACGTTTTGCACACTGTTCCAGG + Intronic
1136869962 16:33797955-33797977 GCTGTGATAAACACTTTGCCAGG - Intergenic
1138558969 16:57788738-57788760 CACGTGAAGGAGACTGTGCCAGG + Intronic
1139225236 16:65228161-65228183 TATGTGATGAACACTGTCCTTGG + Intergenic
1141379064 16:83559227-83559249 GAAGTGATCAACACATTGCCTGG - Intronic
1142057084 16:88004720-88004742 GACGTGAGGACCACTGAGCTAGG - Intronic
1203102209 16_KI270728v1_random:1318099-1318121 GCTGTGATAAACACTTTGCCAGG + Intergenic
1144378373 17:14668141-14668163 GACTTTATGAACACTGTGACAGG + Intergenic
1144736045 17:17555996-17556018 GAAGTGCTGCGCACTGTGCCGGG + Intronic
1146642678 17:34553055-34553077 GACGTGCTCAGCACAGTGCCTGG - Intergenic
1148163738 17:45467961-45467983 GAAGTGATCAGCACAGTGCCGGG + Intronic
1148194339 17:45702417-45702439 GATGTGATGAAGAATGTGTCTGG - Intergenic
1149382708 17:56109826-56109848 GATGTGTTTAACACAGTGCCAGG + Intergenic
1150394967 17:64814615-64814637 GAAGTGATCAGCACAGTGCCGGG + Intergenic
1152345384 17:79747975-79747997 GAGGTGGTGCACACGGTGCCAGG - Intergenic
1152819189 17:82427480-82427502 GAAGTGATGAACGGTGAGCCAGG + Intronic
1157213701 18:45764554-45764576 GACATGCTGTACTCTGTGCCAGG + Intergenic
1158454340 18:57593222-57593244 GACATGAACCACACTGTGCCTGG + Intergenic
1160777965 19:865177-865199 GGATTGATGAACACTGTGCTTGG + Intergenic
1161966064 19:7549870-7549892 GATGTGATGAACACAGAACCCGG - Intronic
1162264015 19:9555235-9555257 AACGTGATGAAAAGTGTGCTTGG + Intergenic
1164580985 19:29434876-29434898 GCAGGCATGAACACTGTGCCTGG - Intergenic
1165863435 19:38921510-38921532 GACGTGGTGAGCACCGTGCTGGG - Exonic
1165979854 19:39711438-39711460 GAAGTGATCAAGACTGTGACAGG - Intergenic
1167094153 19:47364911-47364933 GAGGTGACGCCCACTGTGCCTGG - Intronic
926090886 2:10048448-10048470 GAGGTGATGAACACTGGAGCAGG - Exonic
928387116 2:30880012-30880034 GAACTGATGAGCACAGTGCCAGG - Intergenic
930653205 2:53983224-53983246 GACGTGAGCCACACTGTGCCTGG - Intronic
937505206 2:122529132-122529154 GAGGAGCTGAGCACTGTGCCCGG + Intergenic
943448794 2:188022089-188022111 GCCTTCATGAACACTGAGCCTGG + Intergenic
1168830032 20:840933-840955 CAGGTGATGTTCACTGTGCCAGG - Intronic
1169063547 20:2679146-2679168 CACGTGAGGAACATTGAGCCTGG - Intergenic
1170510201 20:17068530-17068552 GACATGGTGAAGACTTTGCCAGG + Intergenic
1174703961 20:52636990-52637012 AACCTGATGAAGGCTGTGCCGGG + Intergenic
1179046504 21:37849616-37849638 GAAGTGATGAGCAATGGGCCTGG - Intronic
1184077807 22:42194453-42194475 GACCTGAGGAACATTGTGCAAGG - Intronic
1184248758 22:43248707-43248729 CACCTGATGAGCACTGGGCCTGG + Intronic
1184614580 22:45629519-45629541 GACGTCATGAACACTTTGGGAGG - Intergenic
949230639 3:1745928-1745950 GCTGTGATGAAGACTGTTCCAGG + Intergenic
955527297 3:59834305-59834327 GAGGTGCTTTACACTGTGCCTGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
962333660 3:134505466-134505488 TACGTGATGACCAGTCTGCCTGG - Intronic
964789314 3:160437070-160437092 GACGTTAGCCACACTGTGCCTGG - Exonic
969946873 4:10792327-10792349 GATGTGTTGAGCACTGTTCCAGG + Intergenic
972793302 4:42393325-42393347 GACGTGAGAGCCACTGTGCCCGG + Intergenic
973254463 4:48095083-48095105 TATGTGATGGAGACTGTGCCAGG + Intronic
980736261 4:136893263-136893285 GATGTGGTGAACACAGTGCCTGG + Intergenic
987927980 5:24365769-24365791 AAAGTGATGAACACTGAGACAGG + Intergenic
988622340 5:32835900-32835922 GGCGTGAGCCACACTGTGCCCGG + Intergenic
990250132 5:53905118-53905140 GACATGATGAAAAGTGTGACTGG - Intronic
993482071 5:88436108-88436130 AAAGTGCTTAACACTGTGCCTGG + Intergenic
994666190 5:102708495-102708517 CATGTGTTGACCACTGTGCCTGG - Intergenic
998999110 5:147900435-147900457 GAAGTCATGAACACTTTCCCCGG + Intronic
999637784 5:153640571-153640593 AAGGTGCTTAACACTGTGCCCGG + Intronic
999698496 5:154207068-154207090 AAAGTGCTTAACACTGTGCCTGG - Intronic
999742904 5:154570177-154570199 GAATTGTTTAACACTGTGCCTGG - Intergenic
1002378269 5:178804575-178804597 GACATGAGAAACACTGAGCCTGG + Intergenic
1010932297 6:81817819-81817841 GACTTGGTGAACACAGTGACGGG - Intergenic
1014531666 6:122566260-122566282 GTCATGAGGAACACTGGGCCAGG + Intronic
1017109453 6:150918753-150918775 GAAGTGTTTAACACTGTACCTGG - Intronic
1017572837 6:155765633-155765655 TATGTGGAGAACACTGTGCCAGG - Intergenic
1018634789 6:165851460-165851482 TACGTGCTAGACACTGTGCCAGG + Intronic
1018765337 6:166928503-166928525 CACGTGTTGAACACAATGCCTGG + Intronic
1020185975 7:5960131-5960153 GGCGTGAGCCACACTGTGCCTGG - Intronic
1020243756 7:6414889-6414911 AAGGTGTTGAGCACTGTGCCTGG - Intronic
1020296942 7:6764638-6764660 GGCGTGAGCCACACTGTGCCTGG + Intronic
1020673537 7:11151276-11151298 CAGGTGAGAAACACTGTGCCTGG - Intronic
1022495285 7:30849307-30849329 GACTTGATGAAGACTCTGCTAGG - Intronic
1023272190 7:38476035-38476057 GAAGTGTTGAACAGAGTGCCTGG + Intronic
1026377983 7:69771396-69771418 CCCGTGTTCAACACTGTGCCTGG - Intronic
1032550710 7:132781503-132781525 GTGGTGATCAACGCTGTGCCTGG - Intergenic
1033370234 7:140700507-140700529 GGCGTGAGCCACACTGTGCCCGG - Intronic
1037797402 8:22007931-22007953 GACTTGATGAACACAGTGCCTGG - Intergenic
1037980933 8:23253564-23253586 GGCGTGAGGCACACCGTGCCTGG + Intronic
1038422745 8:27443820-27443842 GAGGAGATGAACGCTGAGCCAGG - Intronic
1044636874 8:94334213-94334235 TATGTGCTGAACACTGTACCAGG - Intergenic
1045161338 8:99549474-99549496 GATGTGATGACTTCTGTGCCAGG + Intronic
1052258808 9:26491192-26491214 CAGGTGATGAATGCTGTGCCAGG + Intergenic
1052350788 9:27456271-27456293 GAAGTGATGAAAACTGGGTCTGG + Intronic
1058814649 9:108672071-108672093 CATGTGGTGGACACTGTGCCAGG + Intergenic
1059543891 9:115157246-115157268 CACGTTAAGAATACTGTGCCTGG - Intronic
1061434235 9:130550907-130550929 GAAGGGATGAACACAGTGGCCGG - Intergenic
1189402054 X:40679225-40679247 GGCGTGATGTAATCTGTGCCTGG - Intronic
1190948285 X:55117330-55117352 AAAGTCATGCACACTGTGCCTGG - Intronic
1197643979 X:128997418-128997440 TACGTGCTGAGCACTGTGTCAGG - Intergenic
1199727313 X:150597218-150597240 GATGTGATGACCATTGTTCCAGG + Intronic
1201864604 Y:18636378-18636400 CAGGTGAGGAACACTGTGCAGGG - Intergenic
1201868718 Y:18684000-18684022 CAGGTGAGGAACACTGTGCAGGG + Intergenic