ID: 1118265178

View in Genome Browser
Species Human (GRCh38)
Location 14:64288058-64288080
Sequence CCTGTTCACCACCCAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118265178 Original CRISPR CCTGTTCACCACCCAGGATA TGG (reversed) Intronic
900306508 1:2011798-2011820 CCTGGCCACCACACAGGAAAGGG + Intergenic
902912238 1:19608335-19608357 TATGTTGACCACCCAGGATGTGG + Intronic
908030555 1:59994770-59994792 CATGTTCTCCATCCAGGATGAGG - Intronic
908072906 1:60483237-60483259 TATGTTCAGCACCCAGTATAGGG + Intergenic
912775980 1:112506800-112506822 CCTGTTGGCCACAAAGGATATGG + Intronic
920008759 1:202852679-202852701 CCGGTTCAGCACCCAGGCTGTGG - Intergenic
920518872 1:206608235-206608257 CCTGTTCCCCACCAAAGAAATGG + Exonic
920560823 1:206937227-206937249 CCTGCTCAACCCCCAGGACAAGG - Exonic
923657730 1:235932829-235932851 CCTGATCAGCCCCCAGGATCAGG - Intergenic
1065218053 10:23469722-23469744 CCTCTTCCCCAGCCAGGATCAGG + Intergenic
1069760144 10:70804503-70804525 CTTGTTCACTACCAAGAATAGGG + Intergenic
1072603093 10:96950288-96950310 GCTGTTCACCACACAGGAAAAGG - Intronic
1073477135 10:103761748-103761770 CCTGCACACCTCCCAGGTTAGGG - Intronic
1078809450 11:14743550-14743572 ACTGTTCACTACCCTGGAAAGGG - Intronic
1088074542 11:105830750-105830772 CCTATTCTCCACCCAGGCAAAGG + Intronic
1089194828 11:116688133-116688155 CCTCTTCTCCACCCACCATAGGG + Intergenic
1089493001 11:118895330-118895352 CCTGCAGACCACCCAGGATCCGG - Exonic
1089861220 11:121591425-121591447 CCTGATTTCCACCCAGGCTATGG + Intronic
1092108295 12:5940000-5940022 CCAGTTCAGCACCCAGGACAAGG + Intronic
1092195606 12:6548094-6548116 CCTGTTCAAAACCCGGGAGAAGG - Exonic
1093941203 12:25056808-25056830 CCTGTTCAGCAGCCAAGCTAAGG - Intronic
1094472585 12:30817308-30817330 CCAGGTCACCACCCAGGAACAGG - Intergenic
1096111301 12:49030847-49030869 CCTGGTCCCATCCCAGGATAGGG - Intronic
1097956313 12:65489156-65489178 TCTGTTCAGGACCCAGGAAATGG + Intergenic
1098966512 12:76795356-76795378 CTTGGACCCCACCCAGGATAGGG - Intronic
1100617751 12:96244228-96244250 CCTGTCCACCAACCAGCAAAAGG - Intronic
1101444461 12:104727574-104727596 CCAGTCCACCACCCAGCACATGG + Intronic
1104877968 12:132049715-132049737 GCTGTTCACTTCACAGGATAAGG + Intronic
1106391188 13:29337132-29337154 ACTGTTCACCCCCCTGGAAAGGG - Intronic
1108030105 13:46220591-46220613 ACTGTTCACTACCCTGGAAAGGG - Intronic
1108090675 13:46846522-46846544 CCAGTTCATCACCCAAGATAGGG + Intronic
1108725251 13:53173793-53173815 CCTTTTGACCACCCAAGACAGGG + Intergenic
1109731524 13:66419814-66419836 ACTGTTCACTACCCTGGAAAGGG + Intronic
1110477134 13:75929313-75929335 CCTCTTCACCACCCACAATGTGG + Intergenic
1112764690 13:102728356-102728378 TCTGTTCAGTACCCAGGACAAGG + Intergenic
1113038847 13:106082532-106082554 CATGATCACTACCCATGATAGGG - Intergenic
1113109694 13:106809582-106809604 CTTCCTCACCACCCAGGTTATGG + Intergenic
1116709841 14:48354077-48354099 CCTCTTCACCACTCAGCCTAAGG + Intergenic
1118265178 14:64288058-64288080 CCTGTTCACCACCCAGGATATGG - Intronic
1118448287 14:65871697-65871719 CCTTTTCACTACCCAGGATATGG - Intergenic
1119394466 14:74316128-74316150 CATGTCCATCACCCAGCATATGG + Intronic
1120455792 14:84728926-84728948 TCTGTTGACCACCCAGTCTATGG + Intergenic
1120612310 14:86657559-86657581 CCTGTTCAGCATCCAGGAATAGG - Intergenic
1122423767 14:101593633-101593655 CCTGTGCTTAACCCAGGATATGG - Intergenic
1122575158 14:102737423-102737445 CCTGGCAACCACCCAGGATTTGG - Intergenic
1202903251 14_GL000194v1_random:55053-55075 CCTGGTGACCACCAAGGATGGGG - Intergenic
1125488627 15:40129699-40129721 GCTGTACACCTCCTAGGATATGG + Intergenic
1130834848 15:87640190-87640212 CCTGTTCACCTCACAGGACCTGG + Intergenic
1133565768 16:6991954-6991976 CCTGTTAACAACACAGGATCTGG - Intronic
1135824032 16:25710501-25710523 CCTGCTCCACAGCCAGGATATGG - Intronic
1139521505 16:67485241-67485263 CCTGGTCAGCACCCATGCTATGG + Intergenic
1140842526 16:78853636-78853658 CCTCTTCTCCACCCAGGGAAAGG - Intronic
1147525238 17:41216318-41216340 ACTGTTCACTACCCTGGAAAGGG + Intronic
1148359669 17:47001216-47001238 AATGTCCACCTCCCAGGATAGGG + Intronic
1149776356 17:59360622-59360644 TCTGTTGACCACCCAGGAAGGGG + Intronic
1151163778 17:72187288-72187310 CCTGTCCCCCACCCAGCTTAAGG + Intergenic
1153888937 18:9494556-9494578 CCTGATCAGAACCCAGGATAGGG + Intronic
1155343282 18:24834544-24834566 CCTGATAACCACCCAAGACAGGG - Intergenic
1156507113 18:37604355-37604377 CCTTTTCACCACTCAGGAAGTGG + Intergenic
1159091162 18:63851028-63851050 CCTGTTCAGCACACAGATTAAGG - Intergenic
1161001781 19:1914378-1914400 CCTGTTCCCCTGCCAGGATCTGG + Intronic
1162767758 19:12930333-12930355 GCTGTCCACCTGCCAGGATAAGG + Exonic
1165317111 19:35063159-35063181 CCTGTTTTCCACCCAGGAAAAGG + Intronic
1166803420 19:45471381-45471403 CTAGTTCTCAACCCAGGATAAGG - Intronic
1167618036 19:50546965-50546987 CTCGGTCACCACCCAGGACAGGG + Intronic
1168224306 19:54983234-54983256 CCTGTTCTACACCCTGGAGAAGG + Exonic
927016780 2:18971680-18971702 CCTGTGAACTACCCAGGCTAGGG - Intergenic
929581129 2:43082385-43082407 CCTGTTCACCAGGAAGGAAATGG - Intergenic
934503416 2:94875345-94875367 CCTGGTGACCACCAAGGATGGGG + Intronic
934762366 2:96863788-96863810 CCTCTGCACCCCCCAGGAGACGG - Exonic
938981551 2:136532014-136532036 GCTGTACACCACCCAGGAAGAGG + Intergenic
943431883 2:187813109-187813131 CCTGTTCCCCAGTAAGGATATGG + Intergenic
947136246 2:226979412-226979434 CCAGGTCACCACCCAGGAACAGG + Intronic
948883063 2:240870132-240870154 CCTGAACAGCACACAGGATAGGG + Intronic
1168898027 20:1337223-1337245 CCTGGTCACCACCAAGGCTGGGG + Intronic
1173644848 20:44626866-44626888 CCTGTTCTCCACCCAGCAGTTGG + Intronic
1173974225 20:47175031-47175053 TCTGTTCCCCATCCAGGTTAAGG + Intronic
1175516790 20:59575304-59575326 CCTCTTCCCCACCAAGGCTAGGG + Intergenic
1176288972 21:5034235-5034257 CCTGTTTGCCGCCCAGGAGAAGG + Intronic
1176445929 21:6820469-6820491 CCTGTTTACCTCACAGGATGGGG - Intergenic
1176622616 21:9069821-9069843 CCTGGTGACCACCAAGGATGGGG - Intergenic
1176824097 21:13685502-13685524 CCTGTTTACCTCACAGGATGGGG - Intergenic
1179868262 21:44229369-44229391 CCTGTTTGCCGCCCAGGAGAAGG - Intronic
1180854836 22:19039227-19039249 CCTGCTCACCACCCAGCTTCAGG - Intronic
1182994569 22:34800697-34800719 CCTGTAGACCACCCAGGACCAGG + Intergenic
1183188225 22:36304697-36304719 CCTGCTCACCACACTGGATGTGG + Intronic
1184720554 22:46310002-46310024 CCAGCTCACCACCCAGGACCAGG - Intronic
950315691 3:12000117-12000139 CCTGCTCACTACCCAGGGTCAGG - Intergenic
957117694 3:76047522-76047544 CTTGCTTACCACCCAGGATCTGG + Intronic
960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
968968345 4:3780868-3780890 CCTGGTCATCCCCCAGGATGTGG + Intergenic
971287517 4:25304829-25304851 CCTATTCATCTCCCAGGAGAGGG - Intergenic
971497139 4:27278813-27278835 CCAGTTCAGCACCCTGGACAGGG - Intergenic
984825284 4:183918891-183918913 CCTCTGCACCAGCCAGGATCTGG + Intronic
985829050 5:2214316-2214338 TGTGTTCACCACCCATGAGAAGG - Intergenic
986352280 5:6891642-6891664 CCAGGTTACCACCCAGGATCAGG - Intergenic
986387075 5:7244986-7245008 CCAGTTCATCACACAGGATTTGG + Intergenic
986584496 5:9300348-9300370 CCTGTTCAGCACCCAGGACATGG - Intronic
988512436 5:31876836-31876858 CCTGGTCACCACCCAGAACTGGG - Intronic
989619071 5:43367221-43367243 ACTGTTCACTACCCTGGAAAGGG - Intergenic
994259227 5:97637256-97637278 CCTGGTTGCCACACAGGATAAGG - Intergenic
999586285 5:153093144-153093166 ACTGTTCAGCAACCAGGAAATGG - Intergenic
999856960 5:155605583-155605605 CCTGTGCACCCCCCAGGCCAAGG + Intergenic
1001962038 5:175885387-175885409 CCTCTGCAACACCCAGCATAGGG + Intergenic
1002314354 5:178333654-178333676 GATGATCACCACCCAGGATGAGG - Intronic
1005744050 6:28819780-28819802 TATGTTCACCACCCAGGTGATGG + Intergenic
1011396961 6:86920222-86920244 TGTGTACACCACCCAGGATTGGG - Intergenic
1011825874 6:91304757-91304779 CCTTTTGACCACCAAGAATATGG + Intergenic
1013452258 6:110295407-110295429 CCTTGTCACCACCCAGGCCAAGG - Intronic
1015623425 6:135156325-135156347 ACTGTTCACTCCCCAGGAAAGGG - Intergenic
1018994873 6:168702998-168703020 CCTGTCCCCCACCCAGGGTGAGG - Intergenic
1022810313 7:33861808-33861830 CCTGTGCACCCCCCATGACATGG - Intergenic
1024688681 7:51776100-51776122 CCAGATCACCAACCAGGAGATGG + Intergenic
1027214858 7:76177165-76177187 CCTGCTCAGCACCCAGGGTCAGG + Intergenic
1028849748 7:95524880-95524902 CCAGGTTACCACCCAGGAAAAGG - Intronic
1032447739 7:131999147-131999169 TCTGTGCACCACCGAGGCTATGG - Intergenic
1036053770 8:5228180-5228202 CCTTATCATCACCCAGGAAATGG - Intergenic
1038415638 8:27393198-27393220 CCTGCCCACCTCCCAGGATTGGG + Intronic
1041453492 8:58032800-58032822 CCTGCCCACCACCCAAGATAAGG - Intronic
1043403631 8:79908574-79908596 CCTGTTCAGGCCCCAGGAAAGGG + Intergenic
1044977775 8:97682857-97682879 CCTGTTCCCCACCCGTCATATGG - Intronic
1047369605 8:124245540-124245562 CCCGTTCACTACCCTGGAAAGGG - Intergenic
1047533843 8:125701269-125701291 CCTATTCACCTCCCACCATAAGG - Intergenic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1058750488 9:108034285-108034307 CCTCTTCCCCACCCACAATATGG + Intergenic
1060789109 9:126473866-126473888 CCTGTTCACCACCTTGTGTATGG + Intronic
1061183751 9:129040184-129040206 CCTGTCCACCTCCCAGGTTCTGG + Intronic
1062099251 9:134719674-134719696 GCCGATCACCACCCAGGATATGG - Intronic
1203523264 Un_GL000213v1:64056-64078 CCTGTTTACCTCACAGGATGGGG + Intergenic
1203745807 Un_GL000218v1:40249-40271 CCTGGTGACCACCAAGGATGGGG - Intergenic
1203564305 Un_KI270744v1:79233-79255 CCTGGTGACCACCAAGGATGGGG + Intergenic
1187842872 X:23506799-23506821 CCAGGTCACCACCCAGGAACAGG - Intergenic
1189318623 X:40073807-40073829 CCCGGGCACCACCCAGGATGAGG + Exonic
1190784155 X:53627789-53627811 CCTTATCACCAACCTGGATATGG - Exonic
1190936392 X:55002312-55002334 CCTGTTTGCCACCCAGAATGGGG + Exonic
1192200368 X:69062721-69062743 CCTGTTCACCACACAGGCTGGGG - Intergenic
1193067389 X:77274721-77274743 CCTGGTAAACCCCCAGGATATGG + Intergenic
1193949309 X:87778562-87778584 TCTGTTCACTACCCTGGAAAGGG + Intergenic
1196402959 X:115334975-115334997 CCTATTTACCACCCAAGAGAAGG - Intergenic
1199583799 X:149390222-149390244 CTTGTTTACAACCCAGAATATGG - Intergenic
1201159135 Y:11155261-11155283 CCTGGTGACCACCAAGGATGGGG - Intergenic