ID: 1118265788

View in Genome Browser
Species Human (GRCh38)
Location 14:64294128-64294150
Sequence GTGCGCTCGCTTTCCTCAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118265788_1118265789 -8 Complete closest: 566
total_pairs: 2
max_distance: 1000
Left 1118265788 14:64294128-64294150 CCTGTTGAGGAAAGCGAGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1118265789 14:64294143-64294165 GAGCGCACCTCCTGCAGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 190
1118265788_1118265792 -1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1118265788 14:64294128-64294150 CCTGTTGAGGAAAGCGAGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1118265792 14:64294150-64294172 CCTCCTGCAGCTCAGGCTCCGGG 0: 1
1: 1
2: 1
3: 90
4: 641
1118265788_1118265790 -2 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1118265788 14:64294128-64294150 CCTGTTGAGGAAAGCGAGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1118265790 14:64294149-64294171 ACCTCCTGCAGCTCAGGCTCCGG 0: 1
1: 0
2: 0
3: 63
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118265788 Original CRISPR GTGCGCTCGCTTTCCTCAAC AGG (reversed) Exonic
903953630 1:27010876-27010898 GTGCCCTTGGTTTCCTAAACAGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064428809 10:15254093-15254115 TTGCTCTCTCTGTCCTCAACTGG - Intronic
1094733446 12:33204910-33204932 ATGCTCTCTCTTTCCTCACCTGG + Intergenic
1103038058 12:117672381-117672403 GTGATCTCGGTTTCCTCATCTGG + Intronic
1106968572 13:35105527-35105549 ATGAGCTCGCTTTCTTCACCTGG - Intronic
1113917630 13:113883947-113883969 GTGCGCTCCCCTCCCTCCACAGG + Intergenic
1117953577 14:61105899-61105921 GTGGGCTGCCTGTCCTCAACAGG + Intergenic
1118265788 14:64294128-64294150 GTGCGCTCGCTTTCCTCAACAGG - Exonic
1118991361 14:70799897-70799919 GTGCTCTCTCTTGCCTAAACTGG - Intronic
1131770720 15:95734620-95734642 GTGCACTTGCTTTCCTCAGCGGG + Intergenic
1141635182 16:85310711-85310733 GTGCGCTCCCCTTCCACATCAGG - Intergenic
1151460554 17:74251847-74251869 GTTCTCTCTCTTTCCTGAACAGG + Intronic
1154310577 18:13263437-13263459 GTGCCCTCACTGTCCTCACCAGG - Intronic
1155688007 18:28579375-28579397 GTGCCTTCGCTTTCCTCATAAGG + Intergenic
1156262738 18:35459925-35459947 GTGCCCTCGCTTTCCTTCCCTGG - Intronic
1159136486 18:64342977-64342999 GTGCCCCAGCCTTCCTCAACTGG - Intergenic
1162794150 19:13078111-13078133 GTGTGCTCCCTTCCCTAAACGGG + Intronic
1165017203 19:32889862-32889884 GTGTGCTGGCCTTCCTCACCGGG - Intronic
932233556 2:70102692-70102714 GTGCGCTCACTTCTCTCACCCGG + Intergenic
933430158 2:82166504-82166526 GTGAGCTCGCCTTGCTCAAATGG - Intergenic
946971523 2:225097824-225097846 TGGCGCTCTCTTTCCTCACCAGG + Intergenic
950396114 3:12735369-12735391 GTAGCCTCGGTTTCCTCAACTGG - Intronic
985769233 5:1798772-1798794 GTGCGCTCACTTCTCTCACCCGG - Exonic
997202560 5:132020646-132020668 GTGCCCTTGGTTTCCTCAGCAGG + Intergenic
1012262620 6:97105487-97105509 GTGCCCTGGCTTACCTCAATGGG + Intronic
1015825915 6:137311819-137311841 GTGGGCTTGCTTTCCTGATCGGG + Intergenic
1021918044 7:25455286-25455308 TTGTGCTAGCTTTCCTCAACTGG - Intergenic
1038622859 8:29161183-29161205 GTGTGTGCACTTTCCTCAACCGG + Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1056615373 9:88160818-88160840 GAGGGCTATCTTTCCTCAACAGG - Intergenic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1196425086 X:115561629-115561651 GTGCGCTCCCTTTCCACTTCGGG - Intronic
1199787233 X:151116397-151116419 GTGTGCTTGCTTTCCCCACCAGG + Intergenic