ID: 1118270011

View in Genome Browser
Species Human (GRCh38)
Location 14:64334388-64334410
Sequence AGGCCTACTCCCAACAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118270011 Original CRISPR AGGCCTACTCCCAACAGCCA GGG (reversed) Intronic
901775657 1:11558956-11558978 AGCCCTACTACCAACTCCCAGGG + Intergenic
902567658 1:17323144-17323166 AGGCTTCCAGCCAACAGCCAGGG - Intronic
902725065 1:18330057-18330079 AGGCCTGCTCTCATCAGCAATGG - Intronic
903221041 1:21869881-21869903 AGGGCTTCTCCCATCAGTCACGG - Intronic
903276461 1:22225028-22225050 AGGCCTCCTGCCGATAGCCATGG + Intergenic
904017706 1:27435605-27435627 ATGACTGCTCCCAACAGCCTGGG + Intronic
905226291 1:36481280-36481302 AGGCCAACACCCAGCACCCAGGG - Intronic
909297703 1:73971553-73971575 AGGCCTATTCTCAACCTCCAGGG - Intergenic
912808542 1:112775522-112775544 AGCCTTTCTCCCAACAGCCCTGG + Intergenic
912913618 1:113789156-113789178 AGCCCTACCCCCAACCTCCAGGG + Intronic
918988581 1:191666410-191666432 AGACCTACTCCCAAACGCCAAGG + Intergenic
919616325 1:199813261-199813283 ATGGCTACACCCAACAGCAAGGG - Intergenic
920060217 1:203222267-203222289 TGACCTTCTCCCAAGAGCCATGG + Exonic
920281458 1:204846708-204846730 AGCCCTGGTCTCAACAGCCACGG + Intronic
921440155 1:215175927-215175949 AGCCCTATTCACAATAGCCAAGG - Intronic
922372164 1:224922451-224922473 AGGCTTGCACCCAGCAGCCAGGG + Intronic
924244761 1:242073359-242073381 AGGCCTTCTCCCAACCTTCAGGG - Intergenic
1064639728 10:17403399-17403421 AGGCTTGCTTCCCACAGCCAAGG - Intronic
1064759783 10:18606217-18606239 AGGCCTACTCACAATCTCCAGGG + Intronic
1065047655 10:21758534-21758556 AGGCCAACTACAAACGGCCACGG + Intronic
1066516261 10:36164020-36164042 AGGCCTCCTGCCAACAGCAGTGG + Intergenic
1067167990 10:43880365-43880387 AGGCCTGCTCCCAACACCACAGG + Intergenic
1070695079 10:78557068-78557090 AGGCCTTCTTCTATCAGCCATGG + Intergenic
1070760377 10:79020534-79020556 GGCCCTACTACCATCAGCCATGG - Intergenic
1079756606 11:24273138-24273160 TGGCCTACTCCCAACTGGAAGGG - Intergenic
1080586894 11:33690777-33690799 TGGCCCACACCCAACAGACAAGG - Intergenic
1081931684 11:46875822-46875844 AGGCCAGCTCCCAACTGCTATGG - Exonic
1082093587 11:48109014-48109036 AGTCCTTCTCCGAGCAGCCATGG - Intronic
1083299463 11:61732751-61732773 TGGCCTCCTCCCAACACCCTGGG - Intronic
1083485671 11:62981669-62981691 AAGCCTTCTCCCCACAGCCTTGG + Intronic
1084394645 11:68901154-68901176 AGGCCTATCGCCAACACCCATGG + Intronic
1084564059 11:69919741-69919763 AGGACTATTCCCAAGAGCCCTGG - Intergenic
1085316876 11:75550656-75550678 AGGCCTCCCTCCACCAGCCAAGG - Intergenic
1085327096 11:75614576-75614598 AGGCTTCCTCCCAAAAGCCATGG + Intronic
1085510694 11:77086663-77086685 AGCCCTCCTCCCCACAGCCAAGG - Intronic
1087290893 11:96319197-96319219 AGATTTTCTCCCAACAGCCATGG + Intronic
1088575361 11:111266363-111266385 ACCCCTACCCCCAACATCCAAGG + Intronic
1091233997 11:134007490-134007512 AGGCCACCTGCCAGCAGCCAGGG - Intergenic
1091343481 11:134837683-134837705 AGGTTTCCTCCCCACAGCCAGGG - Intergenic
1094120912 12:26973298-26973320 ATGCCTACTCCCAGCTCCCAAGG - Exonic
1096271030 12:50166804-50166826 AGGCCTCCTCCCAACCTCCAAGG - Intronic
1100729201 12:97445293-97445315 AGACATTTTCCCAACAGCCATGG + Intergenic
1100745946 12:97645906-97645928 TGGCCTCCAGCCAACAGCCAAGG + Intergenic
1101517641 12:105451644-105451666 GGGTCTACTCCCAGCAGCCATGG + Intergenic
1102710096 12:114918291-114918313 AGGTCTCCAGCCAACAGCCATGG + Intergenic
1102788719 12:115625341-115625363 AGGTCTCCTGCCAACAGCCATGG + Intergenic
1103143264 12:118570889-118570911 GGGCCTATTCCCAACAGAGATGG - Intergenic
1103521975 12:121542224-121542246 AGGCCTCCTGCCAACAGCCACGG + Intronic
1103908181 12:124337999-124338021 AACCCTGCTCCCCACAGCCAGGG + Intronic
1104608638 12:130208868-130208890 AGGCCTCCAGCCAACAGCCATGG + Intergenic
1105297324 13:19099830-19099852 AGTCCTCCTCCCAACAATCAGGG + Intergenic
1110434495 13:75464172-75464194 GAGCCTGTTCCCAACAGCCAGGG - Intronic
1113412481 13:110102335-110102357 AGGCCTCCTGCCAATAGCCGTGG + Intergenic
1117149552 14:52871750-52871772 AGGCCTGCTTCCTACAGCCTGGG - Intronic
1117440059 14:55751244-55751266 AGCACTATTCACAACAGCCAAGG - Intergenic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1121312261 14:92941555-92941577 AGGCCTCCTCCCAGTAGCCACGG - Exonic
1122258900 14:100500653-100500675 AGGCCTACTCTGAACAGAGATGG - Intronic
1122578869 14:102758864-102758886 AGGGTTACTCACAAGAGCCAGGG - Intergenic
1124057899 15:26259683-26259705 AGGCTCACACCCAACAGACATGG - Intergenic
1125151127 15:36533460-36533482 AGGTCTGCTCCCAACACCCACGG - Intergenic
1125521250 15:40348923-40348945 GGGCCTACTGCCACCACCCAAGG + Intergenic
1127464981 15:59235030-59235052 AAGCCTGCTCCCCAGAGCCATGG - Intronic
1129883280 15:79021025-79021047 AGGCCTCCAGCCAACAGCCATGG + Intronic
1131711612 15:95062010-95062032 GGGCCTCCTACCAACACCCAGGG - Intergenic
1133225950 16:4340473-4340495 TGGCCTATTCCCATCAGCCCAGG + Intronic
1134003231 16:10799068-10799090 AGGCCTCCAGCCAACAGCCATGG + Intronic
1134801629 16:17090142-17090164 AGGCCCTCTGCCAACACCCATGG - Intergenic
1135036731 16:19084833-19084855 AGGCCTCCTGCCAATAGCCATGG + Intergenic
1135125644 16:19807167-19807189 AGGCCTCTAGCCAACAGCCATGG + Intronic
1135285377 16:21188549-21188571 TGGCTGACTCCCAACTGCCATGG - Intergenic
1135567461 16:23522904-23522926 AGGCCTCCCACCAATAGCCATGG - Exonic
1135736405 16:24935029-24935051 AGTCCTCCACCCAGCAGCCAGGG - Intronic
1136393423 16:29979344-29979366 ACTCCTACTCCCAACATCCCTGG - Intronic
1136983682 16:35081537-35081559 GGGCCTGTTCCCAACACCCAGGG + Intergenic
1142372757 16:89692110-89692132 CTGCCTGCTCCCAACAGCCCAGG - Intronic
1142902636 17:3021913-3021935 AGCACTACTCACAATAGCCATGG - Intronic
1143811295 17:9473966-9473988 AGGCCAACTCCCAACCCCCAGGG + Intronic
1143955031 17:10661507-10661529 AGGGATAATCCCCACAGCCAGGG + Intergenic
1146234101 17:31141819-31141841 AGTCCTCCTCCCAACAATCATGG - Intronic
1146400166 17:32495359-32495381 AGGCCCACTTCCACCAGCCGGGG - Intronic
1147359634 17:39922763-39922785 AGGCAGAATCCCAACAGCTAAGG + Intronic
1147453259 17:40519224-40519246 ATGTATACTCCCCACAGCCAGGG - Intergenic
1149182890 17:53961451-53961473 ATTCCTAATCCCAACATCCAGGG - Intergenic
1149695915 17:58615979-58616001 AGGACTACTCCCAACAACAAAGG + Intronic
1150843488 17:68631724-68631746 AGGCGTCCTGCCGACAGCCATGG + Intergenic
1151228568 17:72665171-72665193 AGACTTCCTGCCAACAGCCATGG + Intronic
1154951097 18:21210544-21210566 CTTCCTATTCCCAACAGCCAAGG - Intergenic
1156812636 18:41271563-41271585 AGTACTATTCACAACAGCCAAGG + Intergenic
1157179915 18:45487908-45487930 AGGTCAACTCCCAATAGCTAGGG + Intronic
1157644940 18:49258669-49258691 CTGCCTACTCTCCACAGCCATGG - Intronic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1159932964 18:74333299-74333321 AGGCCAACTCCCAAGAGGAAGGG + Intronic
1164228578 19:23267853-23267875 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164243547 19:23410834-23410856 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164451775 19:28372292-28372314 AGCCCCACTCCCAACCTCCAGGG + Intergenic
1164550411 19:29206509-29206531 AAGCCCACTCCCAACTCCCAGGG + Exonic
1165224220 19:34342758-34342780 CTGCCTACTCCCGGCAGCCAAGG + Intronic
1166556473 19:43703398-43703420 AGGCCTTCTGCAAACAGGCAGGG - Intergenic
1166664659 19:44671845-44671867 TGGCCTACTTCAGACAGCCAGGG + Exonic
1167586455 19:50378228-50378250 AGGCCTTGTCCCCACAGACACGG - Exonic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925860915 2:8174432-8174454 ACCCCTACTCACAACAGCAAAGG + Intergenic
928915401 2:36464997-36465019 AGGTCACCTCCCGACAGCCATGG - Intronic
929929497 2:46241384-46241406 AGTCCTTCTGCCAACAGTCATGG - Intergenic
930189124 2:48440444-48440466 TGGCCGACTCCCCACAGCCCCGG - Intergenic
930442724 2:51429313-51429335 AAGCCTCCTGCCAACAGCTATGG + Intergenic
933851750 2:86372934-86372956 GGGCCAATTCCCCACAGCCAGGG - Intergenic
935218923 2:100995452-100995474 CCACCTACTCACAACAGCCAGGG + Exonic
936043134 2:109165046-109165068 AGGCCCACTGCCAACAGAGATGG - Intronic
936146020 2:109981127-109981149 AGGCCTCCTCACCACATCCAGGG + Intergenic
936198669 2:110390351-110390373 AGGCCTCCTCACCACATCCAGGG - Intergenic
936288646 2:111200780-111200802 AGTCCCACTCCCTGCAGCCAGGG - Intergenic
936577051 2:113665966-113665988 AGGGTTCCTCCCAACTGCCATGG + Intergenic
938628725 2:133141189-133141211 TTGCCTTCTCCCAACAGCCCAGG + Intronic
942153668 2:173104906-173104928 AGGCATGCTCCCACCTGCCATGG - Intronic
943466146 2:188231304-188231326 GGGCCTATTCCCAACAAACAAGG + Intergenic
944894265 2:204147924-204147946 AGTACTACTCACAATAGCCAAGG - Intergenic
946878857 2:224157877-224157899 AGGCCTCCTGCCAATAGCCATGG - Intergenic
948290663 2:236821946-236821968 AGGCCTCCTGCCAACAGCCAGGG + Intergenic
948584760 2:239012431-239012453 CAGCCTCCACCCAACAGCCATGG + Intergenic
948586310 2:239021980-239022002 AGGGGTAGTTCCAACAGCCATGG - Intergenic
1169504659 20:6196170-6196192 AGGTGTTCTCCCGACAGCCATGG + Intergenic
1170496148 20:16927410-16927432 AGGACTCCTCCTAACAGCCATGG - Intergenic
1170712015 20:18799730-18799752 AGGCCTCCTGCCAACAGTCATGG - Intergenic
1172314555 20:33943697-33943719 AGGGCTACTCCGTACATCCAGGG - Intergenic
1172784493 20:37458130-37458152 AGGCCTCCTGCCAACAGCCCTGG - Intergenic
1173198931 20:40939463-40939485 AGGCCAGCTCCCATCAGTCAGGG + Intergenic
1175193440 20:57226311-57226333 ACATCTACTCCCAGCAGCCAGGG - Intronic
1175302835 20:57955001-57955023 AGGCCACCTCCCAGGAGCCAGGG + Intergenic
1175502318 20:59459291-59459313 GGGCCTCCTGCCAATAGCCATGG + Intergenic
1175522884 20:59613491-59613513 AAGGCTACTCCCAGCTGCCAGGG + Intronic
1176247320 20:64103605-64103627 AGGCCTCCTGCCCATAGCCATGG + Intergenic
1176305100 21:5119109-5119131 AGGGGAACCCCCAACAGCCATGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177376326 21:20274833-20274855 AGGACTATTCACAATAGCCAAGG + Intergenic
1179801339 21:43812817-43812839 ATGCACCCTCCCAACAGCCAGGG - Intergenic
1179851955 21:44142921-44142943 AGGGGAACCCCCAACAGCCATGG - Intronic
1180835173 22:18926137-18926159 AGGCCTCCACCCCAGAGCCAGGG + Intronic
1181694843 22:24587900-24587922 ACCCCTCCACCCAACAGCCAAGG - Intronic
1184036559 22:41920806-41920828 AGGCCTGCCCCCACCGGCCAGGG + Intergenic
1184769501 22:46589236-46589258 AGGACTCCCCCCAAGAGCCAGGG - Intronic
1203285261 22_KI270734v1_random:151436-151458 AGGCCTCCACCCCAGAGCCAGGG + Intergenic
950105328 3:10384901-10384923 AGGCCTTCTTCCCAAAGCCAGGG + Intronic
950166473 3:10804215-10804237 AGGCCTTTTGCCAACAGTCATGG + Intergenic
952821194 3:37487347-37487369 TGGCCTCCTCCTTACAGCCATGG - Intronic
953389391 3:42525777-42525799 AGCCCTACTCCCACCAACCCTGG - Intronic
953884584 3:46708088-46708110 AGTCCTGTTCCCAACAGCAAAGG + Intronic
953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG + Intronic
956876987 3:73473753-73473775 AGGCCTCTTGCCAAGAGCCATGG + Intronic
959452634 3:106522793-106522815 GGGCCCCCTCCCACCAGCCAAGG + Intergenic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
962837275 3:139200584-139200606 AGGGCTACTCCTAACTGCAAAGG + Intronic
963566654 3:146938998-146939020 AGACCTACTCATAACAGCTAGGG + Intergenic
964565820 3:158051334-158051356 AGGCCTTCTCCCCACCCCCAAGG - Intergenic
965447268 3:168790352-168790374 AGCACTATTCACAACAGCCAAGG - Intergenic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
972705645 4:41539888-41539910 GGGAATACCCCCAACAGCCATGG - Intronic
973346707 4:49063849-49063871 AGGCCTCGTGCCAATAGCCATGG + Intergenic
974535100 4:63164309-63164331 TGGCCTGTTCCCAACAGCAAAGG + Intergenic
977638487 4:99328250-99328272 GGGCCTGTTCCCAACAGACAGGG + Intergenic
978351252 4:107823209-107823231 AGCACTACTCACAATAGCCAAGG - Intergenic
982207026 4:153004566-153004588 CAGCCTCCTCCCAACACCCAGGG + Intergenic
986434018 5:7710197-7710219 ACTCCCACTCCCAACAGGCAGGG + Intronic
987119579 5:14754183-14754205 AGGCCTTCCCTCAACAGGCAAGG + Intronic
993914004 5:93719203-93719225 TGGCCTACAGACAACAGCCATGG - Intronic
993997181 5:94736931-94736953 AGAGCTAATCCCAACAGACATGG + Intronic
995399788 5:111728008-111728030 AGGCATCCTGCAAACAGCCATGG + Intronic
997361627 5:133298948-133298970 AGGGCTACTCCCTGCAGCCTGGG + Intronic
999069767 5:148731487-148731509 AGCCCTTCTCCCAAAAGCAAAGG + Intergenic
999514266 5:152285294-152285316 AGGCCTACTACCATCAGCCCAGG - Intergenic
1001549549 5:172593313-172593335 GGGCCTCCTCTCAGCAGCCAGGG - Intergenic
1002671552 5:180871657-180871679 AGGCCTCCCACCAGCAGCCACGG - Intergenic
1003919883 6:10823180-10823202 AGGCCAACTCCCAAAAGCAGAGG + Intronic
1004820589 6:19364191-19364213 ATGGCAACTCCCATCAGCCAAGG + Intergenic
1005051482 6:21687819-21687841 AGGCCTCCTCCCAAAAGACCAGG + Intergenic
1006629672 6:35422083-35422105 AAGCCAACAGCCAACAGCCATGG - Intronic
1006798189 6:36744019-36744041 GGGCCTCCTCCCCACAGCCTTGG + Intronic
1010937654 6:81881002-81881024 AGGCATACTCCCAACCCTCATGG - Intergenic
1011323749 6:86126193-86126215 AGGTCTACTGCCAACAGTCATGG + Intergenic
1017005766 6:150027258-150027280 ATTCCTTATCCCAACAGCCAGGG - Intergenic
1017026455 6:150185549-150185571 AGCCCTGCACCCAGCAGCCAAGG - Intronic
1017906097 6:158758463-158758485 TGGACTACTCCCCTCAGCCAAGG + Intronic
1018824159 6:167396926-167396948 AACCCTCCTCCAAACAGCCAAGG - Intergenic
1019286732 7:226997-227019 AGGCCTAATCGGAACAGCCGAGG - Intronic
1021789001 7:24181072-24181094 AGGCCTTATGTCAACAGCCAAGG - Intergenic
1022459250 7:30588381-30588403 TGGCCTCCTGCCAACAGCCATGG - Intergenic
1023402412 7:39800167-39800189 AGGGCTACTACCAAAGGCCAGGG - Intergenic
1025283571 7:57645845-57645867 AGGCCTCCACCCCCCAGCCAAGG - Intergenic
1026291019 7:69006210-69006232 AGGCCAACCCACAACACCCAAGG + Intergenic
1029402799 7:100356211-100356233 AGGCCTTGCCCAAACAGCCAGGG + Intronic
1030701661 7:112647308-112647330 AAGCCCACACCCCACAGCCAAGG - Intergenic
1035047358 7:155977067-155977089 AGCACTAGTCACAACAGCCAAGG - Intergenic
1037757465 8:21720454-21720476 AGGGCTCCTCATAACAGCCAAGG - Intronic
1040551048 8:48437828-48437850 AGAACTACTGCCATCAGCCATGG - Intergenic
1040873421 8:52124708-52124730 AGGCCTGTCCCCAGCAGCCAGGG + Intronic
1041845928 8:62329067-62329089 AAGCCTTCTGCCAACAGCCATGG + Intronic
1043480411 8:80646938-80646960 AACACTACTCCCATCAGCCACGG + Intronic
1046147669 8:110182469-110182491 AGCACTACTCACAATAGCCAAGG - Intergenic
1046898650 8:119500258-119500280 AGCCATACTCCCAAAAGCAATGG - Intergenic
1047586646 8:126280693-126280715 AGTCCTACTCCCAACACCCATGG - Intergenic
1048918158 8:139203793-139203815 GGGCCTGCTCCCAACAGCAATGG + Intergenic
1049171559 8:141164534-141164556 AGTCACGCTCCCAACAGCCAAGG - Intronic
1049191171 8:141288584-141288606 AGGCCTACTTCACACAGCCAGGG + Intronic
1049652323 8:143776852-143776874 GTGCCTACTCCCGTCAGCCAGGG + Intergenic
1049659501 8:143813436-143813458 AGGCATTCTCCTAACAGCCAGGG - Intronic
1050005192 9:1122150-1122172 TGGCCTATTCACAATAGCCAAGG - Intergenic
1050397440 9:5214429-5214451 AGGCCAACACCCATCATCCAAGG + Intergenic
1055496858 9:76864005-76864027 AGCGCTATTCCCAACAGCAAAGG + Intronic
1057282722 9:93724520-93724542 AGGCCTCCAGCCAACAGCCATGG + Intergenic
1057549066 9:96038976-96038998 AGGCCTCCTGCCCACAGCCGTGG + Intergenic
1060959814 9:127672322-127672344 AGGCCTCCTGCCAACAGCAAGGG - Intronic
1061610745 9:131744055-131744077 AGGCCTTCTCCCAACATTCCAGG + Intergenic
1062316752 9:135971131-135971153 AGGGCGACTCCCAGCAACCAGGG + Intergenic
1185872595 X:3676450-3676472 AGCACTATTCACAACAGCCAAGG + Intronic
1187044782 X:15636260-15636282 AGCACTACTCACAACAGCCAAGG + Intronic
1188891937 X:35622475-35622497 AGATCTACCCCCAACAGCCAAGG - Intergenic
1190051874 X:47156632-47156654 AGGCCTCCTCCCAGTACCCATGG - Intronic
1191699122 X:64020541-64020563 AGGCCCAATCCCCACTGCCATGG - Intergenic
1192106355 X:68321145-68321167 AGTCCCACTCCCAACCTCCAGGG - Intronic
1192210951 X:69127356-69127378 AGGCCTACACTCTGCAGCCATGG + Intergenic
1197534384 X:127669490-127669512 AAGCCTTCAACCAACAGCCAGGG - Intergenic
1199262264 X:145789271-145789293 AACCCTAGCCCCAACAGCCAAGG + Intergenic
1201889505 Y:18926636-18926658 GGGCTTGCTCCCAACAGACATGG - Intergenic