ID: 1118276120

View in Genome Browser
Species Human (GRCh38)
Location 14:64387744-64387766
Sequence CCTCCAGAGCAGAACGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118276112_1118276120 -10 Left 1118276112 14:64387731-64387753 CCCAGACCCAGGCCCTCCAGAGC No data
Right 1118276120 14:64387744-64387766 CCTCCAGAGCAGAACGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118276120 Original CRISPR CCTCCAGAGCAGAACGCGGA GGG Intergenic
No off target data available for this crispr