ID: 1118284151

View in Genome Browser
Species Human (GRCh38)
Location 14:64455816-64455838
Sequence CAGTGTGAGCTGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118284151_1118284155 3 Left 1118284151 14:64455816-64455838 CCTGCTGCCCTCAGCTCACACTG 0: 1
1: 0
2: 0
3: 58
4: 496
Right 1118284155 14:64455842-64455864 GCAACATCATCACATCACAGTGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118284151 Original CRISPR CAGTGTGAGCTGAGGGCAGC AGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900422223 1:2560582-2560604 CAGAGGGGGCTGAGGGCACCAGG - Intronic
900710250 1:4108943-4108965 TAGTGTGAGCTGAGGCCCTCGGG - Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901936561 1:12630821-12630843 CAAGGGGGGCTGAGGGCAGCAGG + Intergenic
903337653 1:22635616-22635638 CAGTGGGAGCTGGGGACAGTGGG - Intergenic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903620940 1:24697877-24697899 CGGTGAGAGGTGAAGGCAGCTGG - Intergenic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
904371749 1:30052065-30052087 CACATTGAGGTGAGGGCAGCAGG + Intergenic
905106281 1:35565439-35565461 CAGCGGGAGCGCAGGGCAGCGGG - Exonic
905274455 1:36807894-36807916 CAGTGAGAGCTGCAGGCATCTGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906029233 1:42704401-42704423 CAGTGTGAGCACAGGAGAGCAGG + Intergenic
906064057 1:42967422-42967444 CAGTGTGAGCTGGCTGGAGCTGG + Intergenic
907510519 1:54954608-54954630 GAGTGTGAGGTGGGGGCTGCAGG + Intergenic
908355546 1:63322887-63322909 GAGTGTGAGCTGAGCCCAGCGGG + Intergenic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
912401540 1:109397709-109397731 CGGGGTGAGCTGGGGGCTGCGGG - Exonic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915633830 1:157172787-157172809 CAGTGTGTGCTGGAGCCAGCTGG + Intergenic
915658181 1:157379387-157379409 CAGTGTGTGCTGGAGCCAGCTGG + Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915776468 1:158493210-158493232 TAGTATGAGCTGAGTGCAACGGG - Intergenic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
917732660 1:177891709-177891731 CACTGTGATCTCAGGGGAGCAGG - Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920092683 1:203465485-203465507 CAGGATGATCTGAGGGCACCAGG - Intergenic
920365584 1:205446700-205446722 CACTGTGGGCCCAGGGCAGCTGG + Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921448408 1:215273545-215273567 CAGCATGAGATGAGGGCAGTAGG - Intergenic
921938675 1:220817696-220817718 CAGTGAGAGGTGAAGCCAGCTGG - Exonic
922292357 1:224218992-224219014 CAGTCTGAGCTGAAAGCAGATGG + Intergenic
922469434 1:225866829-225866851 CACTGTGGGCTGAGGGGTGCTGG - Intronic
1064132816 10:12725082-12725104 CCGTGTGGACTGGGGGCAGCTGG + Intronic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1064219429 10:13427970-13427992 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1064694360 10:17950701-17950723 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065777321 10:29132918-29132940 CAGTGTGAGCTGATGGGAAGAGG - Intergenic
1066243119 10:33556852-33556874 CAGGGTGAGCGGAGGAGAGCTGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067362876 10:45598120-45598142 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1067539326 10:47140315-47140337 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1067559435 10:47294640-47294662 CGGTGAGAGGTGAGGCCAGCTGG - Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068749319 10:60573511-60573533 CAGTGTGTGGCCAGGGCAGCTGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070123947 10:73605176-73605198 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070159697 10:73858709-73858731 CATTCTGAGCCGAGGGCAGATGG + Intronic
1070752656 10:78973394-78973416 CCGTGTGAGCCGAGGGCTGTGGG - Intergenic
1070793333 10:79202729-79202751 CAGTGGGAGCTGGGCCCAGCAGG - Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1071339077 10:84626047-84626069 CAGATTGAGCTGCGGGGAGCAGG + Intergenic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073074887 10:100817619-100817641 CAGTGGGAGCTGAGATCAACTGG + Intronic
1073299232 10:102460913-102460935 CAGGTTGAGCTGTGGGCACCAGG - Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074558618 10:114515189-114515211 AATTGTGAGCTCAGGGTAGCTGG - Intronic
1074860314 10:117505016-117505038 AATTTTGAGCTGAGGGCTGCTGG - Intergenic
1075086916 10:119419812-119419834 CATTGTGAGCTGGGGTCATCTGG - Intronic
1075214198 10:120517620-120517642 AAGTGTGAGATGGGGGCAACTGG - Intronic
1075532128 10:123238529-123238551 CAGTCTGAGCTGATATCAGCTGG - Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076462025 10:130654338-130654360 AGGTGTGAGCTGAGGGCTGGGGG + Intergenic
1076591185 10:131584660-131584682 GGGGGTGAGCTGGGGGCAGCTGG - Intergenic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076896539 10:133315850-133315872 CTGTGAGAGCTGAAGCCAGCTGG + Intronic
1077530654 11:3093307-3093329 CAGTGAGAGGTCACGGCAGCCGG + Intronic
1078059725 11:8035457-8035479 CAGTAAGAGCTGAAGGGAGCAGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079062112 11:17258172-17258194 CAGTTTGAGCTGAGGTATGCAGG + Intronic
1079428139 11:20363542-20363564 CTGGGTGAGCTGAGCCCAGCAGG + Intergenic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1081273481 11:41117224-41117246 CAATTTGAGCTGAGCTCAGCTGG - Intronic
1081541388 11:44037035-44037057 TGGGGAGAGCTGAGGGCAGCTGG + Intergenic
1081749392 11:45498988-45499010 TTGTGGAAGCTGAGGGCAGCTGG - Intergenic
1081755441 11:45541002-45541024 GAATGTGGGCTGAGGCCAGCTGG - Intergenic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1083592564 11:63904174-63904196 TAGGGTGGGCTGAGGGCAGCAGG - Intronic
1083851621 11:65371007-65371029 GGCTGGGAGCTGAGGGCAGCAGG + Intergenic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084045355 11:66564852-66564874 CAGGGTGAGGTGAGGTCAGGTGG - Intronic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1085420689 11:76356290-76356312 CAGTGACAGCTGAAGACAGCAGG + Intronic
1085555866 11:77421139-77421161 CAGGGTGAGATGAGGGGAGGAGG - Intronic
1086606504 11:88702404-88702426 CTGTGAGAGCTGAGCGAAGCAGG - Intronic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1089305465 11:117523722-117523744 CATTGTGAGCATAGGGCAGTAGG - Intronic
1089352912 11:117831539-117831561 CAGGGTGAGTTGTGGCCAGCAGG - Intronic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1090208320 11:124897836-124897858 CACTGTGAGCTCAGAGCAGCAGG - Exonic
1090327775 11:125904178-125904200 CTGTGTGAGCGGCGGGCCGCGGG + Intronic
1090422204 11:126583189-126583211 CACAGTGAGCTGAGGATAGCAGG - Intronic
1090702697 11:129310706-129310728 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091585597 12:1814521-1814543 AAGTGAGAGCTGAAGCCAGCTGG - Intronic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096266779 12:50129873-50129895 GAGGGTGAGCTGAGGGCTGGAGG - Exonic
1096575695 12:52551517-52551539 GAGGCTGAGCCGAGGGCAGCAGG + Intronic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1096809245 12:54159212-54159234 CAGTGAGGGCTGAGGGCTGGGGG - Intergenic
1097054334 12:56240792-56240814 GACAGTGCGCTGAGGGCAGCAGG + Exonic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1098141724 12:67456819-67456841 CAGTGTGAGCTGCCAACAGCTGG - Intergenic
1099308026 12:80982635-80982657 CAATGGAAGCTGAGTGCAGCAGG + Intronic
1100210494 12:92393748-92393770 CAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1100529276 12:95449156-95449178 CATTGAGAGGTGAGGCCAGCTGG - Intergenic
1102627028 12:114243396-114243418 CAGTGGGAGCTGGGAGCATCTGG + Intergenic
1103130107 12:118460697-118460719 CAGTGTTTGGTGAGGGCTGCTGG - Intergenic
1104374129 12:128249147-128249169 CGGTGTGAGCTGGGGTTAGCTGG + Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104987372 12:132604443-132604465 CAAGGTGAGCTGCGGGCACCCGG - Exonic
1105443498 13:20434201-20434223 CATTGAGAGGTGAGGCCAGCTGG + Intronic
1105520951 13:21130455-21130477 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1105952612 13:25244470-25244492 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1107230540 13:38104477-38104499 CAGTGTGGGCTGCTGTCAGCAGG - Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108738869 13:53314107-53314129 GAGTGTGAGCTGAGGCCAGGAGG + Intergenic
1108817814 13:54313268-54313290 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109138824 13:58687805-58687827 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1110032337 13:70631531-70631553 CAGAGGGAGCTGAGTGCAGTGGG - Intergenic
1110079274 13:71290357-71290379 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1110257326 13:73446038-73446060 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1111197523 13:84894592-84894614 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114793051 14:25681018-25681040 CACTGAGAGGTGAAGGCAGCTGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117980075 14:61334143-61334165 CAGTGTGTGGTGGAGGCAGCAGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118298241 14:64590343-64590365 CAGTCAGTTCTGAGGGCAGCAGG + Intergenic
1118920177 14:70143025-70143047 CAGGGTAAGCTGGGGGTAGCTGG - Intronic
1119078829 14:71672790-71672812 CAGTGTGTGGTGACAGCAGCTGG + Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122857160 14:104565471-104565493 GCGTGTGAGCTGCGGGAAGCAGG + Intronic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1123010850 14:105348890-105348912 AAGTGGGTGCTGAGTGCAGCAGG - Intronic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1123063376 14:105604551-105604573 CAGACTGAGCTGAGGCGAGCTGG - Intergenic
1123087436 14:105723337-105723359 CAGACTGAGCTGAGGCGAGCTGG - Intergenic
1123798206 15:23794862-23794884 CTGTATGTGCTCAGGGCAGCTGG - Intergenic
1124042035 15:26114483-26114505 CAGTCTGAGGTGAAGCCAGCTGG - Intergenic
1124194477 15:27609179-27609201 TAGTGAGAGGTGAAGGCAGCTGG - Intergenic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124655686 15:31504681-31504703 CAGAATTAGCTGACGGCAGCAGG + Intronic
1125555586 15:40582153-40582175 CAGTGAGAGGTGAAGTCAGCAGG - Intergenic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1126740004 15:51768119-51768141 GCGTGTGAGCTGAGGGCTGGGGG - Intronic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128674715 15:69600145-69600167 GGGGATGAGCTGAGGGCAGCAGG + Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128757931 15:70195972-70195994 CAGTGGGAGCTGCGTCCAGCTGG - Intergenic
1128769707 15:70272791-70272813 CAGTGTGATGCGAGGGCCGCAGG - Intergenic
1129118830 15:73382594-73382616 CAGTGAGTGCTGATAGCAGCAGG - Intergenic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130154132 15:81334892-81334914 CCGAGTGCGCTGAGGACAGCTGG + Exonic
1131136167 15:89937696-89937718 CATTGAGAGGTGAGGCCAGCTGG + Intergenic
1131335102 15:91541360-91541382 CAGCTTGAGTTGAGGGCAGTGGG + Intergenic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132504083 16:298058-298080 CAGCGTGTGCTGAGGACACCTGG - Exonic
1132611622 16:819617-819639 CAGCCTGAGCTGGGGGCTGCTGG + Intergenic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133240528 16:4411790-4411812 CAGTGAGAGGCGAGGCCAGCTGG + Intronic
1133317329 16:4892799-4892821 CAGGGTGAGCTGATGCCAGGGGG - Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133817708 16:9210744-9210766 CACAGGGAGCTGATGGCAGCTGG + Intergenic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1135202642 16:20451878-20451900 CAGGGAGAGACGAGGGCAGCTGG + Intronic
1135216461 16:20575988-20576010 CAGGGAGAGACGAGGGCAGCTGG - Intronic
1137615090 16:49841655-49841677 AAGTGTGGGCTGAGGGCTGTGGG - Intronic
1137888387 16:52131316-52131338 CATTGTGAGCTAAAGGCAGTGGG - Intergenic
1139529902 16:67537862-67537884 CGGTGGGGGCTGGGGGCAGCAGG + Intronic
1139595964 16:67958474-67958496 CAGGCTGATCTCAGGGCAGCAGG - Intronic
1139965513 16:70742850-70742872 AAGTGAGAGGTGAAGGCAGCTGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140253621 16:73316445-73316467 CATTGTGAGTTGAGAGCAACGGG - Intergenic
1140523962 16:75606562-75606584 CAGTGTCAGCTGTTGGCAGGAGG - Intronic
1141171919 16:81696888-81696910 CTGTGAGAGCTGAGTGCAACTGG - Intronic
1141176150 16:81720580-81720602 CCGTGAGCACTGAGGGCAGCTGG - Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142196174 16:88740269-88740291 CAGAGTGAGCTGGGGGCACCAGG - Intronic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142401291 16:89860093-89860115 CAGTGTGAGGTGTGGACTGCAGG + Intronic
1142401515 16:89861057-89861079 CAGTGTGGGGTTAGGGCAGACGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1143775869 17:9198426-9198448 AAGTGTGAGCTGCGTGCAGCTGG + Intronic
1144391891 17:14801251-14801273 CAGTTTGAGCTGGGCTCAGCAGG - Intergenic
1144774673 17:17779308-17779330 CAGGGAGCGCTGGGGGCAGCGGG + Intronic
1144855462 17:18264956-18264978 CACTGTCACCTGAGTGCAGCTGG + Exonic
1144962267 17:19051589-19051611 CACTGGGAGCTGGGGGCAGAGGG - Intergenic
1144972894 17:19122931-19122953 CACTGGGAGCTGGGGGCAGAGGG + Intergenic
1145000155 17:19299323-19299345 CAGTGCCAGCTGAGGTGAGCGGG - Intronic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145774846 17:27520727-27520749 CAGTGAGAGTTGGAGGCAGCGGG - Intronic
1146053726 17:29570891-29570913 CAGGGGGAGCTGATGCCAGCTGG - Intronic
1146305192 17:31725037-31725059 CAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147586276 17:41655504-41655526 CTGAGTGAGCACAGGGCAGCGGG - Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148065941 17:44869823-44869845 TAGTGTGAGCTGAGTGCTGTAGG - Intronic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1148794298 17:50189787-50189809 CGGTGGCAGGTGAGGGCAGCTGG - Intronic
1149223193 17:54439197-54439219 CATTGAGAGGTGAGGCCAGCTGG + Intergenic
1150135986 17:62695370-62695392 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1150219169 17:63486466-63486488 AAGTGGGAGCTGAGGGCTGGAGG - Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151463093 17:74267017-74267039 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1151714681 17:75825297-75825319 CAGGGAGAGCTGGGGGCAGCTGG - Exonic
1151950592 17:77351561-77351583 CTGTGTGAGCTGCGGTCAGCAGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1153668483 18:7387643-7387665 CTGTGAGAGGTGAGGCCAGCTGG + Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154501821 18:15001162-15001184 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156460536 18:37319131-37319153 CCGTGTGAACTGGGGGCTGCAGG + Intronic
1158674157 18:59503127-59503149 CACTGTGACATGAGGACAGCTGG + Intronic
1158908559 18:62037567-62037589 CTGTGAGCACTGAGGGCAGCGGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159095753 18:63899632-63899654 CAGTGGGATCTTAGGGGAGCCGG - Intronic
1160144510 18:76352502-76352524 CAGAGTGAGCTGGGGTGAGCTGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160357198 18:78238705-78238727 CAGTGGGAGCCGCGGGCAGGCGG + Intergenic
1160362564 18:78296281-78296303 CAGTGTGAGCTGGGGGCACGGGG + Intergenic
1160390494 18:78527699-78527721 GAGTGGGAGCTGTGGGGAGCAGG - Intergenic
1160793141 19:932284-932306 CAGTCTGAGCTGGCGGCGGCCGG + Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1162013414 19:7830984-7831006 CAGGCTGAGCTGAGGGCTGTGGG - Intronic
1162328911 19:10015005-10015027 CAGTGTGATTTGTGGGTAGCAGG - Intronic
1162926743 19:13934022-13934044 GAGTCTGGGATGAGGGCAGCGGG + Intronic
1163174069 19:15551984-15552006 CCGTATGAGCTGAGGGCCTCAGG - Exonic
1163562331 19:18027078-18027100 CAGTGTGATCTGGGGCCAGGAGG - Intergenic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1164477360 19:28585888-28585910 CGGTGGGAGCAGAGGGCACCTGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164620793 19:29695029-29695051 CAGGGAGAGCTGCGGGCTGCCGG - Intergenic
1164993341 19:32700503-32700525 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1165242779 19:34481462-34481484 CAGGCTGAGCTGGAGGCAGCTGG - Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165820768 19:38674309-38674331 CAGTGTGAGTTGAAGTCAGAGGG + Intronic
1165884556 19:39068662-39068684 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1166051698 19:40264529-40264551 CAGTGTGAGCTAGGGCGAGCTGG - Intronic
1166090554 19:40506007-40506029 CTGTGAGAGCTGACAGCAGCTGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167039347 19:47013423-47013445 CAGTGTGTCCTGAGGGCACTGGG + Intergenic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1168348685 19:55663423-55663445 GAGTGTGAGCTCCTGGCAGCAGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
926455085 2:13057112-13057134 CCGTGTGAGGTGAGGCTAGCTGG + Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927081379 2:19634152-19634174 CAGTGAAAGATGATGGCAGCTGG - Intergenic
928230835 2:29497507-29497529 GAGAGTGAGCTGAGGTCAGTGGG - Intronic
929437387 2:41939023-41939045 CACAGTGAGCTGGGGGCAGGAGG - Intronic
931378173 2:61726955-61726977 ATGTGTGAGCTGAAGTCAGCTGG - Intergenic
931583415 2:63801789-63801811 CATTGAGAGGTGAGGCCAGCTGG - Intronic
931709136 2:64972677-64972699 CCTTGTAAGCTGATGGCAGCAGG + Intergenic
931749913 2:65321240-65321262 CAGTGTCAGCTGGGGCCAGATGG - Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934217399 2:90045843-90045865 TAGTGAGAGGTGAGGCCAGCTGG - Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934786664 2:97014364-97014386 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
936882433 2:117270114-117270136 CAGTGTGAGCTGTAGACAACTGG + Intergenic
937911140 2:127076103-127076125 GAGAGAGGGCTGAGGGCAGCTGG - Intronic
938163359 2:129005934-129005956 CGGTGTGAGGTGAAGCCAGCTGG + Intergenic
938400592 2:130987691-130987713 CAGTGAGAGGTGATGCCAGCTGG - Intronic
938501002 2:131831331-131831353 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
938512641 2:131966708-131966730 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
939137290 2:138312619-138312641 GGGTGTGAGCTGAGAGGAGCAGG + Intergenic
940203209 2:151174182-151174204 CAGTGAGAGCTGAGGCCTGACGG - Intergenic
940875880 2:158896574-158896596 CAGTCTGGGCTGGGAGCAGCAGG - Intergenic
941288691 2:163647557-163647579 CTGTGTGATCTGAGGCCAGGTGG - Intronic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
942489263 2:176473714-176473736 CACTGTGAGCAGAGGTCACCAGG + Intergenic
942545269 2:177056832-177056854 CAGCCTGGGCTGTGGGCAGCTGG - Intergenic
942921561 2:181380337-181380359 CTGTGAGATCTGAGGGCAGTAGG + Intergenic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
944857275 2:203780030-203780052 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
946145752 2:217729680-217729702 CATTGTGACTTGAAGGCAGCAGG - Intronic
946189975 2:218003010-218003032 GAGGGTGAGCTGGAGGCAGCAGG - Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946403119 2:219479193-219479215 GAGTCTGAGGTGAGGGCAGTGGG + Exonic
946626004 2:221613028-221613050 CAGTGAGAGAGGAGGCCAGCAGG + Intergenic
947915776 2:233830843-233830865 CAGTGTGGGCTGAAGACAGAGGG - Intronic
948696496 2:239735616-239735638 CAGTTCGAGCTGCAGGCAGCCGG + Intergenic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169488443 20:6052569-6052591 CAGTGTGCGCGGTAGGCAGCCGG + Exonic
1169611343 20:7383435-7383457 CAGTGAGAGCTGTGGACAGTAGG - Intergenic
1169870968 20:10247896-10247918 CAGTTTGGGCTGAGTTCAGCTGG + Intronic
1171188570 20:23141775-23141797 GAGTGTGATCTGAGGGGAGGTGG + Intergenic
1172121542 20:32601857-32601879 CAGTATGAGCTGAGGCCAGTGGG + Intronic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175312926 20:58024364-58024386 CAGAGGGGGCTGAGGGCAGCAGG + Intergenic
1175658245 20:60790601-60790623 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1176120472 20:63452309-63452331 GCCTCTGAGCTGAGGGCAGCAGG + Intronic
1176242371 20:64081043-64081065 CAGAGTGAGTTGTGGGGAGCAGG + Intronic
1176666303 21:9690506-9690528 CAGTGTCAGCAGAGATCAGCGGG - Intergenic
1177391560 21:20480496-20480518 CAGTGTGAGCTGAGAGTGACTGG - Intergenic
1178878231 21:36428889-36428911 GAGTGTGTGCTGAGGACAGACGG + Intergenic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1179903499 21:44407005-44407027 CAGAGTGGGCCGAGGGCACCTGG + Intronic
1180918477 22:19505981-19506003 CCTTGTGAGCCAAGGGCAGCGGG + Intronic
1181416878 22:22766438-22766460 CAGTGTTCGCTGTTGGCAGCAGG + Intronic
1181846418 22:25712900-25712922 CCGTGAGAGCTGAGTCCAGCAGG + Intronic
1182118924 22:27774484-27774506 CAGTGGGAGCTGAAAGCAGGAGG - Intronic
1182358985 22:29735611-29735633 AAGTGAGGGCTAAGGGCAGCAGG + Intronic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183191676 22:36325603-36325625 CGGTGGCAGGTGAGGGCAGCCGG + Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185207896 22:49550654-49550676 GAGTGTGAGGTGAGGACAGAGGG - Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949875626 3:8624394-8624416 CAGTCTGAGCTGAGCCCAGGGGG + Intronic
950270032 3:11606492-11606514 CATTGAGAGGTGAGGCCAGCTGG + Intronic
950303130 3:11899089-11899111 CACTGTAAGCTGAGTGCAGCAGG + Intergenic
950534068 3:13569365-13569387 CAGTCTGGCCTGAGAGCAGCTGG - Intronic
950571303 3:13801655-13801677 CAGTGCCAGCGGTGGGCAGCGGG + Intergenic
950935235 3:16832705-16832727 CAATGTGTGCTGAAGGCAGTAGG + Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953233536 3:41085682-41085704 CTGTGACATCTGAGGGCAGCAGG + Intergenic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
953497808 3:43403471-43403493 CAGCAAGAGCTCAGGGCAGCAGG + Intronic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953925901 3:46982312-46982334 CAGTGAGAGCTGACATCAGCTGG + Intronic
953929328 3:46998125-46998147 AGGTGGCAGCTGAGGGCAGCGGG + Exonic
954474988 3:50736046-50736068 CATTGTGGGGTGGGGGCAGCGGG - Intronic
958072494 3:88632281-88632303 CAGGGTGACCTGAGGACACCAGG - Intergenic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
959306837 3:104678034-104678056 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
960352078 3:116606274-116606296 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
961569935 3:127790500-127790522 CACTGTGACCTCATGGCAGCAGG + Intronic
961795206 3:129404027-129404049 GTGTGGGAGCTGAGGCCAGCAGG + Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962812576 3:138972167-138972189 CAGAGGCAGCTTAGGGCAGCTGG - Intergenic
962886666 3:139633974-139633996 CAGAAAGACCTGAGGGCAGCTGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964398318 3:156272070-156272092 CTGTGTGAGCTGTGTGGAGCTGG + Intronic
964850713 3:161093452-161093474 TAGTGAGAGCACAGGGCAGCTGG + Intronic
966290415 3:178349562-178349584 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
967191874 3:186991692-186991714 CAGTATGGGATGAGGCCAGCCGG - Intronic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
968450707 4:674769-674791 GAGTGTGAGCCGAGTGCAGGTGG + Intronic
968484608 4:853071-853093 CTGTGGGAGGTGAGGCCAGCGGG - Intronic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968734555 4:2288593-2288615 CAGTGTGAGCTGAAGGCCCTTGG + Intronic
969047706 4:4349127-4349149 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
969115389 4:4867644-4867666 GGCTGTGAGCTGAGGGCCGCGGG - Intergenic
969492755 4:7509436-7509458 CAGAATGGGCTGGGGGCAGCAGG + Intronic
969580672 4:8062909-8062931 CAGTGTGAAGTGGGGGCACCTGG - Intronic
969685555 4:8672148-8672170 AAGTCGGAGCTGAGGGCAGCAGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
970694015 4:18654580-18654602 CAGTTGGGTCTGAGGGCAGCAGG + Intergenic
971356649 4:25901169-25901191 CAGTGTGAGCTGTTGCCTGCTGG + Intronic
972169752 4:36331607-36331629 GAGTGTGAGGTTAGGGCAGCTGG + Intronic
973638260 4:52879587-52879609 AAGTGTGGGCTGAAGGCTGCTGG - Intronic
976140805 4:81989533-81989555 CATTTTGAGCTGAGGGCAAATGG - Intronic
980760197 4:137222826-137222848 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
981143941 4:141303461-141303483 AAGTGTGTCCTGAGTGCAGCTGG + Intergenic
981420046 4:144538980-144539002 CAATGTGAGTTGAGAGGAGCTGG - Intergenic
981726188 4:147849927-147849949 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
982223064 4:153141206-153141228 GACTGTGGGCTGGGGGCAGCTGG - Intergenic
982259146 4:153479136-153479158 CAGTGTGAATTCTGGGCAGCAGG + Intronic
983957797 4:173717631-173717653 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985408718 4:189661830-189661852 CAGTGTCAGCAGAGATCAGCTGG + Intergenic
985533629 5:448698-448720 CAAGGTGCGCTGTGGGCAGCTGG - Intronic
986189585 5:5482681-5482703 TAGTGTGGGCTGAGGGCAAAGGG + Intronic
987467160 5:18285680-18285702 TAGTGAGAGGTGAGGCCAGCTGG + Intergenic
987558348 5:19484576-19484598 AAGTGTGACCTGGGGGCAGGTGG - Intronic
988605172 5:32673179-32673201 TAGTGAGAGGTGAGGCCAGCTGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989757681 5:44975312-44975334 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
990049582 5:51481030-51481052 CAGTGTAAGCTGAGAGCAGGTGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990520812 5:56578541-56578563 CTGTGCTAGCTGAGGGCATCTGG + Intronic
990956393 5:61344402-61344424 AAGTGAGACTTGAGGGCAGCAGG + Intronic
992484170 5:77179986-77180008 GATTGTGAGTTGAGGGCTGCAGG + Intergenic
992485310 5:77189137-77189159 CAATGAGAGCTGTGAGCAGCAGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
995526620 5:113055312-113055334 CAGTGTGAGATGAGGAGGGCAGG - Intronic
996102738 5:119461017-119461039 AAGTGAGAGATGAGGGCAGAGGG + Intronic
996221442 5:120937156-120937178 CAGTGAGAGGTGAAGACAGCTGG + Intergenic
996680001 5:126221220-126221242 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
996810076 5:127506788-127506810 GAGTGAGGGCTGAAGGCAGCGGG + Intergenic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
998171188 5:139872881-139872903 CCCTGGGAGCTGAGGGGAGCAGG - Intronic
998849487 5:146339725-146339747 GGGTGTGAGGTGAGCGCAGCTGG - Exonic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
999397352 5:151238492-151238514 CAGGGTGAGCTGGAGGCAGCAGG - Intronic
1000360133 5:160439331-160439353 CTGTGCGAGCTGATCGCAGCAGG - Intergenic
1001445787 5:171781757-171781779 AAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1002403353 5:179007347-179007369 AAGTGTGTGCTGAGGGCAACAGG - Intergenic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002615563 5:180452993-180453015 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1002851056 6:996698-996720 AGGTGTGAGCTGAGAGCAGGTGG + Intergenic
1003269085 6:4591540-4591562 TAGAGTGAGTTGAGGGCTGCGGG - Intergenic
1004603956 6:17176501-17176523 TAGGGTGAGCTCAGAGCAGCTGG + Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006105047 6:31711376-31711398 GGGTGTGACCTCAGGGCAGCAGG - Intronic
1006417301 6:33912312-33912334 TAGTTTGAGCCAAGGGCAGCAGG + Intergenic
1006991961 6:38222598-38222620 CATTGTGAGGGGAGGGCACCAGG + Intronic
1007029650 6:38616526-38616548 GAGTGGGAGGTGAGGCCAGCTGG + Intronic
1007180152 6:39923731-39923753 CAGTAGGAGCTGAAGGGAGCTGG + Intronic
1010045716 6:71440896-71440918 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1011744469 6:90396328-90396350 CAGTGAGCGCTGAGGGCATATGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1014143033 6:117965739-117965761 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1014839190 6:126197833-126197855 TTGGGAGAGCTGAGGGCAGCTGG - Intergenic
1015444739 6:133290045-133290067 AAGTGTTAGCTGTGGGCATCTGG - Intronic
1015830838 6:137366891-137366913 CAATGTGGGCTGAAGGCATCAGG - Intergenic
1016305365 6:142678504-142678526 CAGTGTTAGGTGAGGGCACCTGG + Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018734844 6:166679949-166679971 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1019414826 7:922361-922383 AAATGTGAGCTGGGGGCAGGGGG + Intronic
1020071176 7:5227944-5227966 CCGTGTGAGCCGAGGTCAGTGGG + Intronic
1020801613 7:12739371-12739393 CATTGTGAGCTGAAGCCAACTGG - Intergenic
1021945801 7:25726163-25726185 CATTGTCAGCTGATGGCAGCAGG + Intergenic
1022531713 7:31070938-31070960 CACTGTGAGCTGAGTGCTGGGGG - Intronic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1023761005 7:43465302-43465324 CAATTTGAGCTGAGCTCAGCTGG + Intronic
1024265541 7:47603507-47603529 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025603890 7:63024954-63024976 GAGTGTGAGCTGAAGACACCAGG + Intergenic
1026018690 7:66692428-66692450 TGGTGTGAGGTGGGGGCAGCTGG + Intronic
1026172758 7:67968789-67968811 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1026307004 7:69151027-69151049 TAGTGAGAGCTGAGGCCAGGGGG - Intergenic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1029598240 7:101548959-101548981 GTGTGGGAGCTGTGGGCAGCCGG + Intronic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1030809243 7:113955339-113955361 CAGTGTCAGCTTGGGGCAGGGGG + Intronic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1031546762 7:123060589-123060611 CAGTGGGAGGTGCTGGCAGCAGG - Intergenic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1031975242 7:128089574-128089596 CAGGGTGACATGGGGGCAGCCGG - Exonic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1032899955 7:136295849-136295871 CAGTTTGGGCTGAGTTCAGCTGG + Intergenic
1033207694 7:139436916-139436938 CCGAGTGAAGTGAGGGCAGCAGG - Intergenic
1033437944 7:141351266-141351288 CAGTGTGATCTGGGCTCAGCTGG + Intronic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1034904122 7:154929069-154929091 CCCTGTGAGCTGAGGGCACTTGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035626694 8:1076291-1076313 CCGTGTGAGCTGCGGACAGCCGG - Intergenic
1036781295 8:11649715-11649737 GAGTGTGAGCTGATGACACCAGG - Intergenic
1037756161 8:21711416-21711438 CCAAGTGAGCTCAGGGCAGCAGG + Intronic
1038374227 8:27022265-27022287 CAGGCAGAGCTGTGGGCAGCCGG + Intergenic
1038439914 8:27564557-27564579 GTGTGTGAGCTGAGGACAGCTGG + Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1042919223 8:73906022-73906044 CAGTGAGAGGTAAGGCCAGCTGG + Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1044274578 8:90285150-90285172 CATTCTGTGCTGAGAGCAGCAGG + Intergenic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1045911743 8:107417882-107417904 CAGTGTGAAATGAGGGCCTCGGG + Intronic
1047303622 8:123635795-123635817 CAGTGAGTGCTGCAGGCAGCTGG - Intergenic
1048306464 8:133288241-133288263 CAGGGTGAGCTCAGGACAGCTGG - Intronic
1048391712 8:133973172-133973194 AAGTGTGTGCTGGGGGCAGGAGG + Intergenic
1048742802 8:137580671-137580693 AGGTGTGTACTGAGGGCAGCAGG - Intergenic
1048987575 8:139743018-139743040 CAGAGTGGGCTGAGAGGAGCAGG + Intronic
1049022268 8:139965608-139965630 CAGTGTCAGCTGGGGGCTCCTGG - Intronic
1049158781 8:141084311-141084333 CAGGGTGAGCTTGTGGCAGCAGG - Intergenic
1049497671 8:142944027-142944049 CAGAGTCAGCTGGGGGCTGCTGG - Intergenic
1049610672 8:143553399-143553421 CAGAGTGAGCGGCGGGCGGCGGG - Exonic
1049622015 8:143602701-143602723 CCATCTGAGCTGAGGACAGCTGG - Exonic
1049654372 8:143791329-143791351 GGCAGTGAGCTGAGGGCAGCTGG + Intronic
1049682681 8:143926629-143926651 CAGGCTGAGCTGGGGGCAGGGGG + Intronic
1049822707 8:144645828-144645850 CAGGGGGAGCTGGGGGCAGCAGG + Intergenic
1050483840 9:6114056-6114078 CAGTGGGAGCTGGGGACAACCGG + Intergenic
1050923978 9:11240585-11240607 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1052956862 9:34259236-34259258 CAATTTGGGCTGAGGCCAGCAGG + Intronic
1053284480 9:36841486-36841508 GAGTGTGAGCTCAGGGCAGGGGG - Intronic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1053456309 9:38235522-38235544 CCGTGTGAGCTGTGGCTAGCAGG + Intergenic
1056078112 9:83062410-83062432 GAGTGTGAGCTGGGGGCGGGAGG - Intronic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057496934 9:95568761-95568783 AAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1057547616 9:96030007-96030029 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057604506 9:96489418-96489440 CAGTGTGACCTGATGGGGGCGGG - Intronic
1059349622 9:113655278-113655300 CTGTCTGCGCTGAAGGCAGCAGG - Intergenic
1059559306 9:115316938-115316960 CAGTGAGAGCTAAGGGTGGCTGG - Intronic
1060171057 9:121461524-121461546 CAGGATGAGCTGAGGGCTGGGGG - Intergenic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060246443 9:121950540-121950562 GAGTCTGACCTGAGGCCAGCAGG + Intronic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1060821294 9:126662860-126662882 CCATTTGAGCTGAGGGCACCAGG - Intronic
1062264577 9:135681168-135681190 CAGTGTGCTCTGTGGGCAGGGGG + Intergenic
1062498669 9:136843188-136843210 CAGAGTGAGCTGGGGAAAGCGGG - Intronic
1062554103 9:137106327-137106349 CCGCGGGAGCTGGGGGCAGCGGG - Intronic
1062554123 9:137106376-137106398 CCGTGGGAGCTGGGGGCAGCAGG - Intronic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1203496681 Un_GL000224v1:158212-158234 CAGTGTGATATGAGCACAGCAGG + Intergenic
1203509304 Un_KI270741v1:100134-100156 CAGTGTGATATGAGCACAGCAGG + Intergenic
1203659798 Un_KI270753v1:31255-31277 CAGTGTCAGCAGAGATCAGCGGG + Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1190998796 X:55637550-55637572 AAGGGGGTGCTGAGGGCAGCTGG + Intergenic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1193543460 X:82799049-82799071 CATTGGCAGCTGAGGGCAGATGG - Intergenic
1194077720 X:89417272-89417294 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1194316102 X:92379435-92379457 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1195615562 X:106909402-106909424 CAGTGAGAGCCTAGGCCAGCGGG + Intronic
1196312872 X:114188998-114189020 TAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1196663646 X:118294407-118294429 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1196853043 X:119956903-119956925 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1200055586 X:153458316-153458338 CAAGGTGATCTGGGGGCAGCGGG + Intronic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1200383565 X:155865572-155865594 CAGTGAGAGGTGAAGTCAGCTGG + Intergenic
1200624149 Y:5491009-5491031 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1200749343 Y:6930513-6930535 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1201361319 Y:13153069-13153091 CAGTGAGAGGTGAAGGTAGCTGG - Intergenic
1201472572 Y:14350557-14350579 GAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1202075055 Y:21029032-21029054 CAGTGAGATGTGAAGGCAGCTGG - Intergenic