ID: 1118285466

View in Genome Browser
Species Human (GRCh38)
Location 14:64466595-64466617
Sequence AAGTCATTCTAGAACAATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118285466_1118285467 -6 Left 1118285466 14:64466595-64466617 CCGTCATTGTTCTAGAATGACTT 0: 1
1: 0
2: 3
3: 20
4: 279
Right 1118285467 14:64466612-64466634 TGACTTTATCTTTCTGTTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118285466 Original CRISPR AAGTCATTCTAGAACAATGA CGG (reversed) Intronic
902742595 1:18449174-18449196 AAGTCATTCTTGACAAATAAGGG + Intergenic
904965055 1:34365567-34365589 AAGACATCTTAAAACAATGAAGG - Intergenic
905467119 1:38163515-38163537 AAGACACTCTAGAACAGAGATGG - Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909083897 1:71148924-71148946 AAGTCATTATACAATAATAAAGG - Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909305106 1:74064647-74064669 AAGACATTCCAGATGAATGAAGG - Intronic
912398095 1:109364548-109364570 ATGTCAATCTAAAAAAATGAGGG + Intronic
917603953 1:176606390-176606412 AATACATTCTTGAAGAATGAGGG + Intronic
917656595 1:177132373-177132395 AAGTCATCATAGAGGAATGATGG + Intronic
918436420 1:184518061-184518083 AAGTCTTCCAAGATCAATGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918993187 1:191725098-191725120 AAGTCATTCTCTGACATTGATGG + Intergenic
919069062 1:192730889-192730911 AAATTCTTTTAGAACAATGAGGG - Intergenic
919186848 1:194162008-194162030 AGGTCATTCTGTGACAATGATGG + Intergenic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
920196121 1:204228412-204228434 AATTCATTTGAGAACATTGAAGG - Intronic
921252187 1:213308572-213308594 AAGTCATTTCAGACCAATTATGG + Intergenic
922008775 1:221559624-221559646 AGGTCATTCTAGCCCAATGCTGG - Intergenic
923845791 1:237730423-237730445 CAGTCATTATATAACATTGAAGG + Intronic
1063264257 10:4429482-4429504 AAGTCATTTTAAAAGAATTAAGG - Intergenic
1063648922 10:7913993-7914015 AAGTCATTTTTGAACAATCATGG - Intronic
1063885728 10:10576570-10576592 AAGTCATCCCAGAAAAATTAAGG - Intergenic
1065353418 10:24815912-24815934 AAATCAGTCAAGAACAGTGATGG + Intergenic
1066552551 10:36575505-36575527 AATTCATTCTCCAACAAAGAAGG - Intergenic
1068548795 10:58383954-58383976 AAAACATTCTAGAACAAAAAGGG + Intergenic
1069282810 10:66676844-66676866 ATGACATTGTAGAAAAATGAAGG - Intronic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1071833876 10:89399672-89399694 AATTCATTCCATAACAATGGTGG - Intronic
1072059082 10:91791083-91791105 AGGTCATTTTATAACAATAAAGG + Intergenic
1072457057 10:95585729-95585751 AAGTCACTCTAGAGCAGGGATGG + Intergenic
1072619687 10:97071513-97071535 AAGGCTTTCTAGAACAAGGTTGG - Intronic
1073215340 10:101833145-101833167 AAGACAGACTAGAACCATGATGG - Intronic
1073708348 10:106012144-106012166 AGGTCATTATACAACAATAAAGG - Intergenic
1073983027 10:109176429-109176451 GAGTTATTCTAGAAGAATGAGGG - Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078613474 11:12842516-12842538 AATTCATTCTAGAGAAATGCAGG + Intronic
1079057063 11:17215419-17215441 ACTTCATCCTTGAACAATGAGGG - Intronic
1079367751 11:19824040-19824062 AAGTCATTCTAGATTGCTGAAGG - Intronic
1080267769 11:30419624-30419646 GACTCATTCTAGAACAGGGATGG - Intronic
1081018784 11:37916451-37916473 AAGTGATTCAATCACAATGATGG - Intergenic
1081371912 11:42314466-42314488 AATTCATCCTTGAACAATGCAGG + Intergenic
1081647788 11:44802051-44802073 ATGACATTCTTGAACACTGATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1086476510 11:87180630-87180652 AAGCCAATCTAGGACAAAGATGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087268100 11:96082944-96082966 AAGTCATTTTTGAAGAATGCTGG + Intronic
1087284874 11:96254707-96254729 AAGTCGTTCCAGAGCAAAGATGG + Intronic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088345791 11:108823422-108823444 AAGCCATTATAGAAAAATGTCGG + Intronic
1088756657 11:112890617-112890639 AAGCCATTTTGCAACAATGAGGG - Intergenic
1089431942 11:118432271-118432293 AAGGCACTCTAGAACATTGCTGG + Intergenic
1090112545 11:123929379-123929401 CAGTCATGGTAGAACAATGATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090677538 11:129014457-129014479 AAGTCAGTCTAGAACATTTCTGG - Intronic
1093002444 12:14012946-14012968 AAGTCATCCAAGAACTCTGATGG - Intergenic
1093150502 12:15615618-15615640 AAGTCATTATATAATAATAAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093634185 12:21444930-21444952 AAGTGAGTCTAGAATACTGATGG + Intronic
1094499390 12:31008783-31008805 AAGTCATTCTGCAACACAGAAGG + Intergenic
1095334049 12:41005815-41005837 AAATAATTATAAAACAATGAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099367715 12:81789998-81790020 AAATCATTTTAGATGAATGATGG - Intergenic
1099399817 12:82189534-82189556 AAGTCTTTCTTCAAAAATGAAGG + Intergenic
1099445632 12:82748330-82748352 AAGTCATTTTGGAGCAATGTTGG + Intronic
1099882477 12:88483325-88483347 AGGTCATTATAGAATAATAAGGG + Intergenic
1100804657 12:98269300-98269322 AAGTCACTATATAATAATGAAGG + Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101569994 12:105945065-105945087 AAATCAAACTAGAACAATAAAGG + Intergenic
1102325377 12:111977373-111977395 AAATTATTCTATAAAAATGAAGG + Intronic
1102403361 12:112650490-112650512 AAGAAATTCTTGCACAATGAGGG + Intronic
1104123485 12:125821253-125821275 AAGCCCTTGTAGAGCAATGATGG + Intergenic
1106355137 13:28975090-28975112 AGGAAATTCTAGAACAATTAAGG + Intronic
1107349120 13:39495847-39495869 AAGTCTTTCTACAACACTGCTGG - Intronic
1107791841 13:44010191-44010213 AAGAAATTCAAGAACAATGATGG - Intergenic
1108074908 13:46669958-46669980 ATTCCAGTCTAGAACAATGATGG + Intronic
1108328854 13:49364077-49364099 AAGTCATTATATAATAATAAAGG + Intronic
1108395336 13:49985960-49985982 AATTCTTTCTGGAAGAATGATGG - Intergenic
1109790060 13:67234419-67234441 CAGTCATTCAAAAAGAATGAAGG - Intergenic
1110748458 13:79083998-79084020 GAGTCATTCAAAAACAATAAAGG + Intergenic
1111602977 13:90497059-90497081 AAATTATCCTAGAACAATAAGGG + Intergenic
1114506761 14:23221397-23221419 AAGTCATTCTATAATGATAAAGG + Intronic
1114808971 14:25873421-25873443 TAATCATTCTAGAAGAATTATGG - Intergenic
1116057654 14:39884052-39884074 AAGTCAGAGTAGAAGAATGAGGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116991589 14:51283104-51283126 AATTCATTTTAGAAGAATAATGG - Intergenic
1117354202 14:54907733-54907755 AATTGATTCTATAATAATGATGG - Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1123886876 15:24735230-24735252 AAGGCATTCTAGAATTATAAAGG + Intergenic
1124012066 15:25846687-25846709 ATGTCATTTTAGATCACTGAAGG - Intronic
1127401482 15:58590811-58590833 AAATCATTTTGGAAAAATGAAGG - Exonic
1127480981 15:59376904-59376926 AACTCATTCTAGACACATGATGG + Intronic
1129501421 15:76041588-76041610 AGGTCATTATATAATAATGAAGG + Intronic
1131049980 15:89341342-89341364 AAGTCTTTCTGGAACAAAGCGGG - Intergenic
1131995848 15:98132049-98132071 AAAGCTTTCTAGAACAATGTAGG - Intergenic
1137459454 16:48646925-48646947 AAGACATTCTATAATAATAAAGG - Intergenic
1137872742 16:51966543-51966565 AAGTCATTTTACAAAAATGCTGG - Intergenic
1139007921 16:62595937-62595959 AAGTCATTCTATCAGAATGTGGG + Intergenic
1139267471 16:65653585-65653607 AAGTCACTTTAAAACAATTATGG + Intergenic
1140337871 16:74128086-74128108 AATTTCTTCTAAAACAATGATGG + Intergenic
1140640821 16:76970352-76970374 AAGGAATTATGGAACAATGAAGG - Intergenic
1141073287 16:80978186-80978208 AACGTATTCTAGAACAAGGAAGG + Intronic
1141650527 16:85390529-85390551 AAGACATTTCAGAACAATAAAGG + Intergenic
1143799503 17:9366956-9366978 AAGTTATTCCAGGAGAATGAGGG + Intronic
1143818641 17:9541356-9541378 ACGTCCTTCTAGAGCAATCAGGG + Intronic
1146173971 17:30653073-30653095 AAGACCTTCTAGAACAATCCTGG + Intergenic
1146347425 17:32069095-32069117 AAGACCTTCTAGAACAATCCTGG + Intergenic
1146517330 17:33499377-33499399 AGGTCATTCTAGAGCAGGGAGGG + Intronic
1148256595 17:46138546-46138568 AAGTCATCCAAGAATACTGAAGG + Intronic
1148514936 17:48207915-48207937 AAGTCATTCTAGGACATTCTAGG - Intronic
1149447349 17:56723940-56723962 AAGTTGTTCTAGAACATTTAAGG + Intergenic
1149587190 17:57799275-57799297 AATTCACTCTTGAACAATGTAGG + Intergenic
1152669859 17:81596787-81596809 AAGTTCTTCTTGATCAATGAAGG - Intronic
1156046149 18:32879730-32879752 AAGTCATTCAAGCAGAAGGAGGG + Intergenic
1156098467 18:33564766-33564788 GACTCCTTCTAGAACAATTAAGG + Intergenic
1156223029 18:35073321-35073343 AATATTTTCTAGAACAATGAAGG - Intronic
1156426340 18:37017697-37017719 AAGGCATTCTATAACAATAAAGG - Intronic
1156815826 18:41309947-41309969 TAGTCAGTCTTGAAAAATGATGG - Intergenic
1157093712 18:44667069-44667091 AAGGCATTTGAGAACAATCAAGG - Intergenic
1157735940 18:50049113-50049135 AAGTCTTTCTAAAACAGTGGTGG - Intronic
1158361227 18:56676108-56676130 AAGTCACTATATAATAATGAAGG - Intronic
1158686585 18:59620426-59620448 AACTCATTCTAAGATAATGAGGG - Intronic
1159378023 18:67619472-67619494 AGGTCATTCTAGAAACATGTTGG + Intergenic
1159667696 18:71182804-71182826 AAATCATTTTAGAACAATTTTGG - Intergenic
1162002579 19:7756495-7756517 AAGTTATTCTTCAAAAATGAAGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1162988443 19:14286963-14286985 AAGACCTTCTAGAACAATCCTGG - Intergenic
1164893522 19:31846801-31846823 ATGGCTTTCTATAACAATGATGG + Intergenic
1165558895 19:36661324-36661346 AAGTCATTTTAGAACACTTCAGG - Intronic
1168011111 19:53533722-53533744 AAGTCATTATAGAATTATAAAGG - Intronic
927044868 2:19267018-19267040 CAGTCATTCTAGGGCACTGATGG - Intergenic
927770082 2:25852967-25852989 AACTCTTTCTAGGACAATAAAGG + Intronic
928338430 2:30419269-30419291 AAGTCAGTATAGCACAATTAAGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929258132 2:39836355-39836377 AAGTCATTATATAATAATAAAGG - Intergenic
930118172 2:47737904-47737926 AATCCATTTTAGAACTATGATGG - Intronic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
931596433 2:63950222-63950244 AACTTTTTCTATAACAATGACGG + Intronic
932996270 2:76857539-76857561 AACTGACTCTTGAACAATGAGGG - Intronic
936843027 2:116796622-116796644 AAGTCATTTGAAAACAATTAAGG + Intergenic
939477545 2:142706221-142706243 AAGTCATTTTTAAACAATGTTGG - Intergenic
939817915 2:146919428-146919450 AATTCATTCTAGAACAATAAGGG - Intergenic
939856832 2:147368549-147368571 AAGGCATTAGTGAACAATGAAGG + Intergenic
941135498 2:161712893-161712915 AATTCTTTCTAGAACATTGTAGG - Intronic
943437190 2:187880798-187880820 AACTCACTCTTGAACAATGGAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944174012 2:196809486-196809508 AAGTCAATCTGGAAAAAAGATGG - Exonic
944954414 2:204791379-204791401 AACTCATTTTATAACTATGAGGG - Intronic
945382223 2:209154529-209154551 AAGTCTTTCTAGATGAAAGAAGG - Intergenic
947306533 2:228754429-228754451 AAGTCATTATATAATAATAAAGG + Intergenic
948812591 2:240491065-240491087 AAGTCATTATATAACGATAAAGG - Intronic
1169598757 20:7232016-7232038 AAATCATTCTATAGCCATGAGGG + Intergenic
1169922616 20:10751450-10751472 AAGCCATTCTGAAATAATGATGG - Intergenic
1171361922 20:24592292-24592314 AATTCCTGCTGGAACAATGATGG - Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174917980 20:54673140-54673162 AAGTCATTAGAGAGGAATGATGG - Intergenic
1177474547 21:21602764-21602786 AAGTTATTCTGGAACCATGAAGG + Intergenic
1178000860 21:28160902-28160924 AATGCATTATAGAACAATGAAGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182535229 22:30996467-30996489 AAGCTATGCTAGAACAATCATGG + Intergenic
1184964139 22:47955098-47955120 AAGTCATTTAAGAACATTCAGGG + Intergenic
950006282 3:9693359-9693381 AAGTGACTCTTGAACAATGCAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955665395 3:61344441-61344463 AAATCATTGTTGAATAATGATGG + Intergenic
957458485 3:80485916-80485938 AAGTCATTATATAAGAATCACGG + Intergenic
958738733 3:98042078-98042100 AAATTATTCTATAAAAATGAAGG + Intergenic
960110026 3:113837048-113837070 AAGACATTCTAGAACAATTGAGG - Intronic
960169362 3:114440405-114440427 AAGTCACTCAAAAACAATAAAGG - Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962769656 3:138600638-138600660 CAGTCATGCTAGACCAATGCTGG + Intergenic
964930097 3:162008789-162008811 AGGTCATCCAAGAACACTGATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967017002 3:185491443-185491465 AAGGCAATCAAAAACAATGAGGG + Exonic
967362601 3:188648622-188648644 AAGTGATTCAAGAAGTATGAAGG - Intronic
967426263 3:189330820-189330842 AAGACATGCTAGAACAAGGTTGG + Intergenic
968743827 4:2347188-2347210 AAGTCATTTTATAATAATAAAGG + Intronic
970030734 4:11671457-11671479 AAATCATTCTGGCACAATCAGGG + Intergenic
970162552 4:13203906-13203928 AATCCTTTCTTGAACAATGAAGG + Intergenic
972937858 4:44161260-44161282 AAGGAACTCTAGAACAATGGAGG + Intergenic
973169246 4:47118978-47119000 AAGTGTTACTAGAAAAATGAAGG - Intronic
974294088 4:59971976-59971998 ATGGCATTTCAGAACAATGAAGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
978487382 4:109270907-109270929 TAGGCATTCTAGCACAATGCTGG - Intronic
978770177 4:112447680-112447702 AAACCATTCTACAACAAGGAAGG + Intergenic
979046907 4:115878626-115878648 AGGTCATTCTAGAAGAATTTGGG - Intergenic
980544604 4:134243118-134243140 AAGTCATTTCATAACAATAAAGG + Intergenic
981318363 4:143363887-143363909 AAGTCATTCTCGAGGGATGATGG - Intronic
982152321 4:152473872-152473894 AAGGCACTCTAGAACAAAAAAGG + Intronic
982207112 4:153005021-153005043 AGGTCATTCTGGAACAAGGTGGG + Intergenic
982679356 4:158410368-158410390 AAGTGATTCCACAACAATCATGG - Intronic
983114538 4:163796678-163796700 AAATAATCCCAGAACAATGATGG - Intronic
983858452 4:172674868-172674890 AAGTCATGATAAAACAATGCAGG - Intronic
985878723 5:2620653-2620675 AAGTCCTTATAGAAAAATGCAGG + Intergenic
986046934 5:4047652-4047674 AAGTCATTATATAATAATAAAGG + Intergenic
987002273 5:13671829-13671851 AAGTCATACTAGAATAAAGTGGG - Intergenic
987256259 5:16155186-16155208 AAGACACTATAGAACAATGCAGG + Intronic
988292116 5:29300625-29300647 AAGCCATTCTAGCCCACTGACGG - Intergenic
988589225 5:32534563-32534585 AAGTGATTTTAAAACCATGAAGG - Intronic
988901000 5:35732236-35732258 AAATCATTGTAGAGAAATGAGGG + Intronic
988914399 5:35877779-35877801 AAGTCAGTCTAGACCAAGAAAGG - Exonic
989028923 5:37097022-37097044 AAGTCATTATATAACGATAAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991577864 5:68123304-68123326 AAATCATGCTAAAACAATGCAGG + Intergenic
993079650 5:83280358-83280380 AAGACATTCAAGAAACATGAAGG - Intronic
993440225 5:87947674-87947696 ACTTCAGTCTAGAACGATGAAGG - Intergenic
995076295 5:107988537-107988559 AAATCATTCTATTAAAATGAAGG + Intronic
995102428 5:108329241-108329263 AAGTTATTCTATAATAAAGATGG + Intronic
995698905 5:114911234-114911256 AAGTCATTCTTTATAAATGAAGG + Intergenic
996156758 5:120112053-120112075 AATTCTTTCTAAAATAATGAAGG - Intergenic
998056308 5:139081183-139081205 GAGTCACTCAAGAATAATGAAGG + Intronic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
998768151 5:145511632-145511654 CAGTCATTCTGTAACCATGAAGG - Intronic
999640516 5:153667976-153667998 AAGGCATTTGAGTACAATGATGG - Intronic
1000467696 5:161600406-161600428 AAGCCACTGGAGAACAATGAAGG + Intronic
1002846847 6:954498-954520 TATTCATTCTAGAACACTTATGG - Intergenic
1004313894 6:14570008-14570030 AGGTGTTTCTAGAACAACGAGGG + Intergenic
1004314310 6:14572626-14572648 AGGTGTTTCTAGAACAATGAGGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008202502 6:48608576-48608598 ATGGCATTTTGGAACAATGAAGG - Intergenic
1008344866 6:50414064-50414086 AAGTAATTTTACAAAAATGATGG + Intergenic
1008794164 6:55280167-55280189 AAGTTATTCTAAACCAATTATGG + Intronic
1009287413 6:61838051-61838073 AAGACATTCTGGAAAAAGGAAGG + Intronic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011880189 6:92014752-92014774 AAGTCTTCCTAGAAAACTGATGG - Intergenic
1012292193 6:97470449-97470471 AAGTCATTATAAAACAATGTAGG + Intergenic
1013779957 6:113718354-113718376 AAGAGATTGAAGAACAATGATGG - Intergenic
1014390808 6:120860760-120860782 AAGTCATTATATAATAATAAAGG + Intergenic
1015450555 6:133362347-133362369 AACCCATTCTAGGACAATAACGG - Intronic
1015848760 6:137550373-137550395 AAGTCATCATAGAAGAAGGAAGG - Intergenic
1016721059 6:147298250-147298272 AAGTCATTATGTAACAATGAAGG + Intronic
1018253684 6:161896898-161896920 ACGCCTTTCTACAACAATGACGG - Intronic
1020341059 7:7111669-7111691 AAGACATTATAGAATAATAAAGG + Intergenic
1020620461 7:10512075-10512097 AAGTCATTATATAACAATGAAGG - Intergenic
1020701073 7:11484178-11484200 AAATCATTCTAAAACCATCAGGG - Intronic
1021937231 7:25643250-25643272 AAGACAATGAAGAACAATGAAGG - Intergenic
1022551963 7:31249377-31249399 AATTCATTATAGAATAAAGAGGG - Intergenic
1024050147 7:45615251-45615273 AACACATTCTTGAACAATTATGG + Intronic
1027485365 7:78754945-78754967 AAGGCATGCTAAAGCAATGAGGG - Intronic
1028392488 7:90333274-90333296 AAATAATTCTAAAAGAATGATGG - Intergenic
1028582175 7:92419978-92420000 CAGTCATTCAGGAACAATGGTGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030429246 7:109421014-109421036 AAGTGATTCTAAAACTGTGAAGG - Intergenic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032650148 7:133869109-133869131 AAGCCATTCTAGAGCACTCAGGG + Intronic
1039799265 8:40940147-40940169 AAGACGTGCTAGAACTATGAAGG + Intergenic
1040868316 8:52073145-52073167 AAGTTATTCTATAGAAATGAAGG - Intergenic
1041726168 8:61019608-61019630 AAGACATTCTAGAATGATAATGG - Intergenic
1042637246 8:70891992-70892014 AGGTCATTGTATAATAATGAAGG - Intergenic
1042770615 8:72376860-72376882 AAGTCATTGTATAATAATAAAGG + Intergenic
1044069483 8:87739794-87739816 AAGTGTGTCTAGAATAATGAGGG + Intergenic
1044877370 8:96682677-96682699 AAGTCATTATATAATGATGAAGG - Intronic
1045327712 8:101128928-101128950 CAATGATTCTAGAACAATGCGGG - Intergenic
1045769846 8:105723294-105723316 AACTTTTTCTATAACAATGACGG + Intronic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1046134367 8:110007494-110007516 AAGTCATTATATAATGATGAAGG - Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1050443589 9:5693425-5693447 GAGTCAGTCTATAACAATGGTGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052269476 9:26612983-26613005 AAGTCATTCTAGAGCAAGATGGG + Intergenic
1052418926 9:28216165-28216187 AAATCATTCTAAAATAATGTTGG - Intronic
1052648713 9:31272479-31272501 CAGTAAATCTAGAACATTGAGGG + Intergenic
1053028392 9:34751457-34751479 AGGTCATTATATAATAATGAAGG + Intergenic
1053460382 9:38264672-38264694 AAGTTATTCTTCAAAAATGAAGG + Intergenic
1055043760 9:71903736-71903758 CACTCATTCTAAAACATTGATGG - Intronic
1055497756 9:76872390-76872412 AAGTCATGGAAGAACAATGTGGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058112748 9:101049242-101049264 AAGATATTCTAGAAAAATAAGGG + Intronic
1058120295 9:101131206-101131228 AACTCATTCTGGAATAATCATGG + Intronic
1058188927 9:101889904-101889926 AAGTGATTCTAGGGCAATTAAGG - Intergenic
1058875041 9:109236882-109236904 AAATCATCCTAGACCAATGTAGG + Intronic
1060324900 9:122604689-122604711 AGGCCATTTTAGAACAAAGAAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185516755 X:705237-705259 GAGTGATTCTAGAACAAACAGGG + Intergenic
1186241617 X:7573992-7574014 AGGTCAATCTATTACAATGAAGG - Intergenic
1187014539 X:15313087-15313109 AAGTCTTTCTATAAGAATGTAGG - Intronic
1187101107 X:16193424-16193446 AAGCCATTTTAAAACACTGAGGG + Intergenic
1188059862 X:25588102-25588124 AGGTCATTATATAATAATGAAGG - Intergenic
1188602421 X:31984939-31984961 AGGTCATACTGAAACAATGATGG + Intronic
1189037901 X:37511249-37511271 AAATCATTCTAGAATATTAATGG - Intronic
1190034811 X:47012040-47012062 GGGACATTCTAGAACACTGATGG - Intronic
1190192559 X:48289861-48289883 AATTCATTCTAGAACAGGCATGG + Intergenic
1190808020 X:53857766-53857788 AGGTCATTATATAACAATAAAGG - Intergenic
1191903136 X:66059181-66059203 ATGTGATTTTAGAACAATGGAGG - Intergenic
1192695560 X:73411882-73411904 AAGTATTTCTACAAAAATGATGG + Intergenic
1194800475 X:98266610-98266632 AAGTCATCATATAACAATGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1197677895 X:129350106-129350128 AAGTCACTATATAATAATGAAGG + Intergenic
1198855893 X:141015776-141015798 AAGTCACTATATAATAATGAAGG - Intergenic
1198876236 X:141230362-141230384 AAGTCACTATATAATAATGAAGG + Intergenic
1198906800 X:141571591-141571613 AAGTCACTATATAATAATGAAGG + Intergenic
1198917093 X:141685274-141685296 AAGTCACTATATAATAATGAAGG + Intronic
1199006319 X:142701449-142701471 AAGCCATCATAGAACGATGATGG - Intergenic
1199315856 X:146377015-146377037 AAGTAATTTTAGAAAAAAGATGG + Intergenic
1200786899 Y:7268714-7268736 AAATCTTCCTAGAACAAAGAAGG - Intergenic