ID: 1118287094

View in Genome Browser
Species Human (GRCh38)
Location 14:64485205-64485227
Sequence GCATCAGCGTCCAATCAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118287094_1118287098 11 Left 1118287094 14:64485205-64485227 CCCTCCTGATTGGACGCTGATGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1118287098 14:64485239-64485261 TCAGGAAACGTCCTCAGAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 136
1118287094_1118287100 15 Left 1118287094 14:64485205-64485227 CCCTCCTGATTGGACGCTGATGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1118287100 14:64485243-64485265 GAAACGTCCTCAGAAGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 173
1118287094_1118287099 14 Left 1118287094 14:64485205-64485227 CCCTCCTGATTGGACGCTGATGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1118287099 14:64485242-64485264 GGAAACGTCCTCAGAAGTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1118287094_1118287097 -7 Left 1118287094 14:64485205-64485227 CCCTCCTGATTGGACGCTGATGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1118287097 14:64485221-64485243 CTGATGCTGTTGAATGTGTCAGG 0: 1
1: 0
2: 0
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118287094 Original CRISPR GCATCAGCGTCCAATCAGGA GGG (reversed) Exonic
901687702 1:10952836-10952858 CAAGCAGCGTCCAATCTGGAAGG - Intronic
905449411 1:38046997-38047019 GCCCCAGCGGCCAATCAGCACGG - Intergenic
905624469 1:39478620-39478642 GCATAAGTGTCCAAGCAGCATGG - Intronic
906044358 1:42816928-42816950 GTCTCAGCGTCCCATTAGGACGG - Intronic
906733849 1:48105613-48105635 GGCACAGCATCCAATCAGGAAGG + Intergenic
915866136 1:159501069-159501091 GGATCAGCTTAGAATCAGGATGG - Intergenic
916756392 1:167774329-167774351 ACATCAGAGTCCCTTCAGGATGG - Intronic
922088234 1:222371075-222371097 GCATCAGCAGCCAGTCAGGATGG - Intergenic
1064637769 10:17386740-17386762 GCATCAGCCCCAAATGAGGACGG + Intronic
1077196263 11:1282011-1282033 GCATCAGCTTCCAGTGAAGAAGG + Intronic
1083048788 11:59758542-59758564 GCAACAGCGTCCACACAGAAGGG + Intronic
1092961846 12:13603384-13603406 GCATCAGGGTCTAAACAGGGTGG + Intronic
1098880200 12:75909455-75909477 CCAGCAGTGTCCAATGAGGAAGG + Intergenic
1100442435 12:94629254-94629276 GCAGGAGGGTCCAAGCAGGAAGG + Intronic
1100774819 12:97962552-97962574 GGATCAGGGTGCAATCAGGAAGG - Intergenic
1101782213 12:107846154-107846176 GAGTCAGTGTCCAATCAGGGGGG - Intergenic
1104657938 12:130587886-130587908 GCACCAGCATCCAGGCAGGAGGG - Intronic
1104815139 12:131641298-131641320 GGAGCACCGTCCAATCAGGCTGG + Intergenic
1104986802 12:132601771-132601793 TCAGCAGCTTCTAATCAGGATGG + Intergenic
1116238853 14:42314774-42314796 GCATTAGCGTCTCATAAGGAGGG - Intergenic
1118287094 14:64485205-64485227 GCATCAGCGTCCAATCAGGAGGG - Exonic
1118520272 14:66575710-66575732 GCATCAGAGTCTAATCAAGTGGG + Intronic
1120593483 14:86404903-86404925 GGAATAGCTTCCAATCAGGATGG - Intergenic
1122060689 14:99134819-99134841 GCAGCAGCGTCCAAGGAGAATGG - Intergenic
1127895132 15:63291818-63291840 GCACCAGAGTCCAAGAAGGAAGG - Intronic
1135775791 16:25257018-25257040 GCATCAGAGCCCATTCTGGAAGG - Exonic
1141528412 16:84628625-84628647 GCTTCAGCCTCCAGTGAGGAAGG + Intergenic
1149792592 17:59492342-59492364 TCATCAGAGGCCAATCAGGAGGG + Intergenic
1150608059 17:66711266-66711288 GCATTAGCATGCAATCAGTATGG + Intronic
1151336173 17:73440977-73440999 GCATCAGCCTCTAATGAGGCTGG - Intronic
1168651630 19:58095941-58095963 GCATCAGGGTCCCAGTAGGAAGG - Intronic
926188222 2:10708191-10708213 GCATCAGGGACCAAGGAGGATGG + Intergenic
928371467 2:30742930-30742952 GCATCGGCATCCATACAGGAAGG - Intronic
935895629 2:107734338-107734360 GCATCAGTGAACAATCTGGAGGG - Intergenic
942508808 2:176673752-176673774 CCAACAGGGGCCAATCAGGAAGG + Intergenic
942937415 2:181574996-181575018 GCATCAGCCTCCAATCACCCAGG + Intronic
949022561 2:241749727-241749749 CCACCAGCATCAAATCAGGAGGG - Intronic
1171006544 20:21471455-21471477 GCATCAGCATCCAACCAGACAGG - Intergenic
1172052633 20:32130517-32130539 GCAAAAGCTTCCAATGAGGAAGG + Intronic
1173025147 20:39300558-39300580 GCACCAGCCTCCAAGGAGGAGGG - Intergenic
1174724276 20:52844942-52844964 CCATCATCATCCATTCAGGAAGG + Intergenic
1175839621 20:62018822-62018844 GCATCCTCGTCCAACCAAGATGG + Intronic
1177250735 21:18587336-18587358 GCATCAGTGACCGATCAGAATGG + Intergenic
1180910738 22:19448166-19448188 GCTTGAGCGTCCACTCAGGATGG + Exonic
1182267624 22:29130554-29130576 GAATCAGATTCCACTCAGGATGG - Intronic
955614491 3:60792114-60792136 GAAGCAGCCTCCAATGAGGATGG + Intronic
956640273 3:71409007-71409029 GTATAATAGTCCAATCAGGAAGG + Intronic
957730187 3:84125138-84125160 GCAGCAGCGGCCCATCTGGAGGG + Intergenic
965871801 3:173274320-173274342 GCATCAGCACCAAATGAGGATGG - Intergenic
968282594 3:197488577-197488599 GCATCAGCATGCCATCAGGTGGG - Intergenic
969967503 4:11012462-11012484 GGATCAGCCCCCAATAAGGAAGG - Intergenic
974489634 4:62548269-62548291 GCATCAGCCCCAAATGAGGACGG + Intergenic
983817990 4:172156104-172156126 GCGTCAGCGTCAAGTGAGGACGG + Intronic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985733260 5:1563401-1563423 GCATCAGCCTCCTGACAGGAGGG - Intergenic
988768782 5:34410092-34410114 AAATCAGCATCCAATAAGGAAGG + Intergenic
989095510 5:37777794-37777816 GCATCAGCACCAAATGAGGATGG - Intergenic
1000549566 5:162643565-162643587 GCAGCAGCACCCAATCAGAATGG - Intergenic
1002379939 5:178819613-178819635 GCATCAGCTTCCAGAGAGGATGG - Intergenic
1006897039 6:37477826-37477848 GCTTCAGCATCCTATCAGGAGGG + Intronic
1007401258 6:41603881-41603903 GCCTCACCGTCCCATCAGAAGGG - Intergenic
1009950946 6:70394872-70394894 GCATCAGCACCAAATGAGGATGG - Intergenic
1011170459 6:84499164-84499186 ACATCATCCTCCAAACAGGAAGG + Intergenic
1016291949 6:142536744-142536766 GCGTCAGCATCAAATGAGGATGG - Intergenic
1019487026 7:1294114-1294136 GCATCACCTTCCACTCAGGAGGG - Intergenic
1023513641 7:40979022-40979044 GCACCAACTCCCAATCAGGAAGG - Intergenic
1036776385 8:11615737-11615759 CCAGAAGCGTCCTATCAGGAAGG + Intergenic
1037549227 8:19953890-19953912 GCAGCAGTTTCCACTCAGGATGG - Intronic
1038269249 8:26061932-26061954 GCATAAGTGTCCACTCATGAAGG - Intergenic
1040671340 8:49694720-49694742 GCATCATGATCAAATCAGGATGG + Intergenic
1041914331 8:63124985-63125007 ACATCAGTATCCAATGAGGACGG + Intergenic
1056776882 9:89519392-89519414 GCATCAGTGTCCATCCAGGTGGG + Intergenic
1058562285 9:106242854-106242876 CCATCAGGGTACAACCAGGAAGG + Intergenic
1188722971 X:33545064-33545086 GCAACAGAGTCCAATAAGAAAGG + Intergenic
1195026106 X:100879251-100879273 ACATAAGGGTCCAATCAGCATGG - Intergenic