ID: 1118292924

View in Genome Browser
Species Human (GRCh38)
Location 14:64541976-64541998
Sequence GAGGATGGCCGCCTGCACCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118292924_1118292928 5 Left 1118292924 14:64541976-64541998 CCGCGGTGCAGGCGGCCATCCTC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1118292928 14:64542004-64542026 CGACAAATCAGAGAATGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118292924 Original CRISPR GAGGATGGCCGCCTGCACCG CGG (reversed) Exonic
900614364 1:3558008-3558030 GGGGAAGGCCAGCTGCACCGCGG - Intronic
900644055 1:3700995-3701017 GAGGAAGGCAGCCTGGACCCTGG + Intronic
900750088 1:4390224-4390246 CAGCATGGCCGGCTGCACCAGGG - Intergenic
901024062 1:6269887-6269909 GAGGAAGGCCGCCCGCACCTTGG - Intronic
901665335 1:10823023-10823045 CAGGATGGCTGCCTGCAGCTGGG - Intergenic
905923751 1:41735737-41735759 GAGGATGTCTGCCTGCTCCCTGG + Intronic
919861104 1:201739998-201740020 GTGAATGGCCGCCTGAGCCGGGG + Intronic
922704110 1:227779938-227779960 GTGGAGGGCAGCCAGCACCGTGG - Intronic
924941795 1:248817274-248817296 GAGGATGGCCACCTGGGCCAGGG + Intronic
1063961004 10:11305357-11305379 CAGGATGGGCGCCGGCACCCAGG - Intronic
1065800382 10:29346357-29346379 GAGGATGGCCACCTCCTCGGTGG + Intergenic
1065971621 10:30810315-30810337 GAGGATGGCCTCCTGCATCCAGG - Intergenic
1069749019 10:70733956-70733978 GTGGAAGGCAGCCTGCACCAGGG - Exonic
1070179233 10:73998341-73998363 GCTGACGGCCGCCTGCACGGCGG - Exonic
1070543893 10:77437738-77437760 GAGGCAGGAGGCCTGCACCGGGG + Intronic
1076834904 10:133016163-133016185 GACACTGCCCGCCTGCACCGGGG + Intergenic
1077206272 11:1346330-1346352 GAGGATGGGCGCATGCCCTGGGG + Intergenic
1083826080 11:65204920-65204942 GTGGAAGCCCGCCTGCACTGCGG - Intronic
1084954942 11:72686053-72686075 GAGTGTGGCTGCCTTCACCGCGG - Exonic
1085299649 11:75450588-75450610 GAGGATGGCCCCCATCACGGCGG - Intronic
1085340923 11:75731064-75731086 GGGGGTGGGCACCTGCACCGAGG + Intronic
1088314956 11:108498235-108498257 GACGACGGCCGCCTGCAGCCCGG + Exonic
1090058217 11:123441411-123441433 GAGGATTGCCGCTTGAGCCGAGG + Intergenic
1091085279 11:132715651-132715673 GAAGATGGCCGTCTGCAACCTGG + Intronic
1091427722 12:406008-406030 TAGGAGGATCGCCTGCACCGGGG - Intronic
1091690063 12:2589779-2589801 GAGGATGGCAGCTTGGACAGGGG + Intronic
1091722046 12:2820713-2820735 GAGGCTGTCCACCTGCACCAGGG - Exonic
1092743133 12:11649454-11649476 GAGGGCGGGCGCCCGCACCGGGG + Intergenic
1096468763 12:51863711-51863733 GAGGAGGGCCGTCTCCTCCGAGG + Intergenic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1102471492 12:113162224-113162246 GAGGACTGCCGCCAGCACTGGGG + Intronic
1104856274 12:131903856-131903878 GAGGAGGGCTGCCAGCACAGTGG + Intronic
1113643054 13:111971964-111971986 GGGGATGGCTGGCTGCAGCGTGG + Intergenic
1113949337 13:114062832-114062854 GAGGAAGGACGCCTGGACCCTGG + Intronic
1118292924 14:64541976-64541998 GAGGATGGCCGCCTGCACCGCGG - Exonic
1120497031 14:85250535-85250557 CATGATGGCCTCCTGCACCTGGG + Intergenic
1122171204 14:99877161-99877183 GAAGATGGCCGCCTGCAACCTGG - Intronic
1122770918 14:104097286-104097308 GACGATGCCAGCCTGCACCCAGG - Intronic
1129252524 15:74316669-74316691 GAGGATGGCCGACTCCACCACGG + Intronic
1132690825 16:1181128-1181150 GAAGACGGCCGCCTGCCCCTGGG - Intronic
1137674571 16:50297949-50297971 AAGGGTGGCCACATGCACCGAGG - Intronic
1141635289 16:85311120-85311142 GGGGAGGGCAGCCTGCTCCGTGG + Intergenic
1141678552 16:85530607-85530629 GAGGATTACAGCCTGCAACGAGG + Intergenic
1143651599 17:8266969-8266991 AAGGATGGCCCCCTCCACAGTGG - Intronic
1144078479 17:11740426-11740448 GAAGGTGGCCGCCTGCAACCTGG - Intronic
1146623842 17:34421067-34421089 GATGATGGTGGCCTGCACCAAGG - Intergenic
1148127185 17:45242917-45242939 GAGGAGGGCCGCCTAACCCGGGG - Intronic
1148646858 17:49224225-49224247 GAGTCTGGCCGCCTGCAGGGGGG - Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152802671 17:82339011-82339033 GAGGCTGGCCGGATCCACCGTGG + Intergenic
1154346072 18:13544562-13544584 GTGGATGGCAGCCTGCATGGTGG + Intronic
1157279145 18:46334371-46334393 GTGGATCGCCGCAGGCACCGGGG + Intronic
1158110352 18:53933706-53933728 GATGATGCCCGCCTACACTGAGG + Intergenic
1160757240 19:764210-764232 GAGGATGGTCCCCTTCACCTGGG + Exonic
1160858162 19:1226646-1226668 GAGGCTGGCCGCCTGCAGGTGGG + Exonic
1161098094 19:2405396-2405418 GAGGATGGCCGGCAGGATCGTGG + Exonic
1161532549 19:4798787-4798809 CAGGATGGCCACCTGCCCCAGGG - Exonic
1162834592 19:13308029-13308051 GAGGAAGGCAGCCTGCACGGTGG + Intronic
1163018707 19:14471732-14471754 CAGGAAGGCTGCCTGCTCCGCGG - Exonic
1163820407 19:19493328-19493350 CAGAAAGGCCGCCTGCACTGTGG + Intronic
1165386506 19:35513396-35513418 GAGGCTGGCCCCCTGCAGAGCGG - Exonic
1166853572 19:45771505-45771527 GAGGTGGGCCGTCTGCTCCGCGG - Intronic
931575976 2:63719282-63719304 GAGGATGGCAGCCAGAACCCTGG + Intronic
933903211 2:86863979-86864001 GAGGATGACTGCCTTCACCAGGG + Intergenic
935777302 2:106484968-106484990 GAGGATGACTGCCTTCACCAGGG - Intergenic
942714833 2:178880475-178880497 GATGATGACAGCCTGAACCGAGG + Intronic
944318308 2:198307043-198307065 CAGGATGGCAGCTTGCACCTAGG + Intronic
946013248 2:216583521-216583543 GAAGGTGGCCGCCTGCACAGTGG + Intergenic
946322189 2:218960587-218960609 GAGGAAGGCGGCCTGCAGCTCGG - Exonic
946354584 2:219176930-219176952 GAGGACGGCGGCCCGCCCCGGGG - Intronic
1171776560 20:29373682-29373704 TAGGGTGGCAGCCTGCAACGGGG - Intergenic
1172648192 20:36484519-36484541 GAGGGTGGCTGTCTGCACTGTGG + Intronic
1173700845 20:45070320-45070342 GATGATGGCAGCCTGGACCAAGG + Intronic
1174172849 20:48627924-48627946 CAAGATGGCCGCCTGCTCCAGGG + Exonic
1175084280 20:56445699-56445721 GAGGAAGGCTGCCTCCACCGGGG + Intronic
1176020303 20:62959225-62959247 GAGGACAGCCGCCTGCCCCAGGG - Intronic
1176265947 20:64209398-64209420 GCGGAGGGCCTCCTGCACCTGGG + Intronic
1179574425 21:42298861-42298883 GAGGGAGGCCGGCTGCACCTAGG - Intergenic
1179875822 21:44266873-44266895 CAGGATGGCAGCCTCCACTGTGG + Intergenic
1180910715 22:19447968-19447990 CAGGATGCCCGCCTGGCCCGGGG - Exonic
1182599993 22:31454726-31454748 CAAGATTGCTGCCTGCACCGTGG + Intronic
1183875250 22:40774962-40774984 GAGGATGGTGGCCTGGACCACGG - Intronic
961646337 3:128394735-128394757 GAGGAGGGCCGCCTGCAGGAGGG + Intronic
962702150 3:138010273-138010295 GGGGCTGGCCGGCTGCATCGCGG + Exonic
965238363 3:166158050-166158072 GAAGATGGCAGTCTGCACCTTGG + Intergenic
967561083 3:190920522-190920544 GACGCAGCCCGCCTGCACCGAGG + Intergenic
967645616 3:191920051-191920073 GAGGATGCCCACCTACACTGAGG - Intergenic
968225026 3:196968144-196968166 GAGGATGGCCTCCTGCCCCAGGG - Intronic
968570835 4:1339721-1339743 GAGGACGCCCGCCTGCCTCGCGG + Exonic
972496394 4:39638767-39638789 GAGGATGGGGGCCGGGACCGAGG + Exonic
973572301 4:52252849-52252871 AAGGATGGCAGCCTGCAGGGTGG + Intergenic
975670930 4:76779923-76779945 GAGGAAGGCCTCATGCACTGCGG + Exonic
983056561 4:163103858-163103880 GTGGAAGCCCGCCTGCACCCAGG - Intergenic
984814699 4:183825521-183825543 GAGGGTGGCTGCCTGCACTTGGG - Intergenic
988559314 5:32266141-32266163 GAGGGTGGGCGCCTCCACAGAGG + Intronic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
999271278 5:150297664-150297686 GCGGATGGCAGCCTGCACGGCGG + Exonic
1001149509 5:169214936-169214958 GAAGATGGCAGCCTGGACCAGGG - Intronic
1002422083 5:179154099-179154121 GTGGAAGGCGGCCTGCACCAGGG + Exonic
1013637201 6:112040258-112040280 GAGGATGGCAGTCTGCACCAAGG - Intergenic
1014826629 6:126054492-126054514 CATGTTGGCCTCCTGCACCGAGG + Intergenic
1018084835 6:160291979-160292001 GACGCAGGCCGCCTGCACCCAGG - Intergenic
1019474994 7:1240230-1240252 GTGGAAGGCCGCCCTCACCGCGG - Intergenic
1023879773 7:44311856-44311878 GTGGCTGGCTCCCTGCACCGTGG + Intronic
1025250258 7:57347100-57347122 GACGGTGGCAGCCTGCACCTCGG + Intergenic
1026394817 7:69940761-69940783 GAGGATGGCAGCCTGGACCAAGG + Intronic
1027503410 7:78984196-78984218 GAGGATGGCGGCTTACACCAAGG - Intronic
1033284416 7:140028083-140028105 GAGGCTGCCCGTCTGCACCTGGG - Intronic
1034283004 7:149866485-149866507 CAGGATGGCCTCCTGCTCTGAGG - Exonic
1036419693 8:8584120-8584142 GAGGATTTCCGACTGCACCAGGG - Intergenic
1037276794 8:17189030-17189052 GAGGATGGTGGCTTGGACCGGGG - Intronic
1041790771 8:61694005-61694027 GAGGGTGGCAGGCAGCACCGAGG - Intronic
1048457733 8:134593088-134593110 CAGGATGCCCGCCTGACCCGGGG - Intronic
1058095088 9:100850964-100850986 GTGGATGGCCTCCTTCACCTTGG + Intergenic
1060346538 9:122821825-122821847 GAGGATGTCTTGCTGCACCGGGG - Intronic
1061257394 9:129460609-129460631 GAGGGAGGCCGCCTGCAGCCCGG + Intergenic
1062746959 9:138219297-138219319 GATGAGGGCCGCCTGCAGCCAGG - Intergenic
1187257854 X:17657688-17657710 GAGGATGGGAGCCTGGACAGGGG + Intronic
1190745729 X:53320915-53320937 GAGGAGAGCCAGCTGCACCGCGG - Exonic
1200127819 X:153825087-153825109 CAGGATGGCTGCCAGCACCATGG + Intronic
1200259304 X:154603714-154603736 TAGGGTGGCCGGCTGCACCTGGG + Intergenic