ID: 1118293735

View in Genome Browser
Species Human (GRCh38)
Location 14:64549876-64549898
Sequence GTCCTAGGCCGCGCGGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118293735_1118293741 10 Left 1118293735 14:64549876-64549898 CCGCAGCCCGCGCGGCCTAGGAC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1118293741 14:64549909-64549931 CCCCGCCCCGCTCCGCGCCCCGG 0: 2
1: 2
2: 19
3: 145
4: 949
1118293735_1118293743 11 Left 1118293735 14:64549876-64549898 CCGCAGCCCGCGCGGCCTAGGAC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1118293743 14:64549910-64549932 CCCGCCCCGCTCCGCGCCCCGGG 0: 2
1: 3
2: 25
3: 152
4: 851
1118293735_1118293749 25 Left 1118293735 14:64549876-64549898 CCGCAGCCCGCGCGGCCTAGGAC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1118293749 14:64549924-64549946 CGCCCCGGGCAGCCGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118293735 Original CRISPR GTCCTAGGCCGCGCGGGCTG CGG (reversed) Intergenic
900318469 1:2070795-2070817 GTCCTCGGCTGCGGGGGCCGGGG + Intronic
900384376 1:2402848-2402870 AACCTAGGCCTCGTGGGCTGTGG + Intronic
901028972 1:6295116-6295138 GTGCTCGGCCGCACGTGCTGTGG + Intronic
901212521 1:7534601-7534623 GTCCTCGGCGGCACGGGCTGTGG + Intronic
903652861 1:24931903-24931925 GTCCGAGGGCGCGCGGGCCTGGG - Intronic
905404958 1:37726439-37726461 GTCCCAGGCTGGGCGGGCTGGGG - Intronic
922169519 1:223143131-223143153 GTCGTAGGCAGCGCGGGGCGGGG - Intronic
1063448313 10:6134232-6134254 GTCCTGGGCTCAGCGGGCTGTGG + Intergenic
1063464900 10:6236781-6236803 GTCCTGGGCCGGCCGGGCTGTGG + Intergenic
1064133042 10:12727037-12727059 GCCCTGGGCTGCGCAGGCTGAGG - Intronic
1066963707 10:42242667-42242689 GTCCTAGGCCCCGCGTCATGGGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1072429235 10:95356351-95356373 GGACTCGGCCGAGCGGGCTGAGG + Intronic
1072950193 10:99840423-99840445 GTCGAAGGCGCCGCGGGCTGGGG - Intronic
1076554518 10:131312508-131312530 GTCAGAGGCCGCGTGTGCTGGGG - Intergenic
1076762996 10:132614957-132614979 GGCGTAGGCCCCGCAGGCTGCGG + Intronic
1076794109 10:132790530-132790552 GTCCTGGGCCACTCGGCCTGGGG - Intergenic
1076818371 10:132925757-132925779 GTGCCAGGCAGTGCGGGCTGAGG + Intronic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1082928903 11:58579232-58579254 GTCCTAGGCGGCGGAGGCGGAGG - Exonic
1085654060 11:78296232-78296254 GTCCTCGGCCCAGGGGGCTGGGG + Intronic
1091604280 12:1936861-1936883 GTGCGTGGCCGCGCAGGCTGGGG - Intergenic
1102124296 12:110468160-110468182 GTCATGGGCCCCGCGGGCAGCGG - Intronic
1104796784 12:131525880-131525902 GTCCTAGGTCAGGTGGGCTGCGG + Intergenic
1108053500 13:46465786-46465808 GTCCTAAGCCGGGGGGGATGAGG - Intergenic
1112319737 13:98395452-98395474 GTGCTTGGCTGCGGGGGCTGAGG - Exonic
1113493916 13:110713563-110713585 GTCCCAGGCCCTGGGGGCTGCGG - Intronic
1113788105 13:113013457-113013479 CTCCTGGGCCGTGCTGGCTGCGG - Intronic
1118293735 14:64549876-64549898 GTCCTAGGCCGCGCGGGCTGCGG - Intergenic
1121561373 14:94878531-94878553 GTCCCAGGCCCCCCGTGCTGGGG + Intergenic
1122418299 14:101560712-101560734 GGCCAGGGCGGCGCGGGCTGGGG + Intergenic
1122964091 14:105112993-105113015 GTCGAAGGCGCCGCGGGCTGGGG - Intergenic
1123441387 15:20294732-20294754 GTCCTAGGCCCCGCGCCATGGGG + Intergenic
1123767981 15:23500786-23500808 GTCCTGGGCCACACCGGCTGTGG + Intergenic
1124369298 15:29094370-29094392 GTCCTGGGCAGTGGGGGCTGGGG + Intronic
1124570306 15:30856781-30856803 GTCCTTGGCCACACCGGCTGTGG - Intergenic
1126106167 15:45148302-45148324 GTCCAAGGCCCAGCTGGCTGAGG + Exonic
1128119076 15:65132977-65132999 GGCAGAGGCCGCGCGGGCAGTGG - Exonic
1129387003 15:75201856-75201878 GTCCCGGGCGGGGCGGGCTGGGG - Intronic
1130381968 15:83379183-83379205 GGCCTGGGCCGCGCAGTCTGTGG - Intergenic
1132684149 16:1155277-1155299 GGCCTAGGCCGCCCGGGCAGCGG - Intronic
1132863992 16:2084780-2084802 GCCCCAGGCCGAGCGGGCTGGGG + Intronic
1136479574 16:30533205-30533227 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136483351 16:30556164-30556186 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136552627 16:30989692-30989714 GTCCTCTGCAGGGCGGGCTGGGG + Exonic
1136719824 16:32310790-32310812 TTCCTAGGCCCCGCGTGGTGGGG - Intergenic
1136838199 16:33517070-33517092 TTCCTAGGCCCCGCGTGGTGGGG - Intergenic
1136843197 16:33555231-33555253 GTCCTAGGCCCCGCGTGGTGGGG - Intergenic
1140410459 16:74737846-74737868 GACCCAGGCAGCGGGGGCTGGGG - Intronic
1141430532 16:83968517-83968539 GTCCGCGGCCGCGGGGGCAGCGG + Intergenic
1142256450 16:89015881-89015903 GTCCTGGGGCACGGGGGCTGTGG + Intergenic
1203006607 16_KI270728v1_random:206979-207001 TTCCTAGGCCCCGCGTGGTGGGG + Intergenic
1203133160 16_KI270728v1_random:1704970-1704992 TTCCTAGGCCCCGCGTGGTGGGG + Intergenic
1203148369 16_KI270728v1_random:1817350-1817372 TTCCTAGGCCCCGCGTGGTGGGG - Intergenic
1203153362 16_KI270728v1_random:1855529-1855551 GTCCTAGGCCCCGCGTGGTGGGG - Intergenic
1145750183 17:27349608-27349630 GCCCCAGGCCGCGAGGGGTGCGG + Intergenic
1148052984 17:44778214-44778236 GTCCTGGGCGGCACGGGCTGGGG + Exonic
1148491081 17:48024302-48024324 GTCCTCGCCCGCGATGGCTGAGG - Intergenic
1148837298 17:50472185-50472207 GTCCCAGGCTGGGAGGGCTGAGG - Intronic
1148894315 17:50831202-50831224 GCCCGAGGCCGCGCGGGCAGGGG + Intergenic
1152049142 17:77958952-77958974 GTCCTAGGCGGCGGCGGCGGCGG - Intergenic
1152432042 17:80253882-80253904 GTGCTAGGCCCCGCAGCCTGGGG + Intergenic
1157761517 18:50268693-50268715 TACCTAGGCCGCGGGGGCGGGGG - Intronic
1160655628 19:267349-267371 GTCCGCGGCCGCGAGTGCTGAGG - Intergenic
1161855219 19:6760729-6760751 GTCCCAGGCCACAGGGGCTGTGG - Exonic
1162575309 19:11495676-11495698 GTCCCAGGCAGGGCTGGCTGAGG - Intronic
1162886621 19:13702478-13702500 GTCGAAGGCGCCGCGGGCTGGGG + Intergenic
1164653409 19:29901999-29902021 GTCGAAGGCGCCGCGGGCTGGGG - Intergenic
1166261360 19:41643904-41643926 GTCGAAGGCGCCGCGGGCTGGGG + Intronic
1168145967 19:54420388-54420410 TTCCCAGGCTGCGGGGGCTGGGG - Intronic
925607499 2:5673560-5673582 CTCCACGGCCGCGCGGGCGGAGG + Intergenic
926766748 2:16328936-16328958 GTCCTAGGCCCCTCGGGCTGTGG + Intergenic
934594253 2:95590318-95590340 GTCCTTGGCCGCACGGACCGTGG - Intergenic
937221918 2:120346724-120346746 GCCCCAGGGCGCGCGGGCTGCGG - Intronic
947435463 2:230068526-230068548 ATCCGAGGCCGCGCGCGCCGCGG - Intronic
948711321 2:239827424-239827446 GTCCAAGGCCGTGCAGCCTGTGG - Intergenic
1168802754 20:653529-653551 GACTTAGGCCGCGGGGGCGGGGG + Intronic
1171257857 20:23704462-23704484 GTCCTATGCCCCGGGGGGTGAGG + Intergenic
1172100744 20:32483144-32483166 GCCCTGGGCCGAGTGGGCTGGGG - Intronic
1173576606 20:44116179-44116201 GGCCTGGGCCGCTTGGGCTGCGG + Exonic
1173792009 20:45834007-45834029 GTCCTAGGCTGAGTGGGTTGGGG + Intronic
1175136377 20:56827412-56827434 GTCCCAGGCCGGGCGGGCGGGGG - Intergenic
1175516230 20:59571961-59571983 GTCCAAGGTCCCCCGGGCTGTGG - Intergenic
1179726005 21:43341567-43341589 GCCCTAGGCTGCCCGGGGTGAGG + Intergenic
1180309549 22:11158452-11158474 GTCCTAGGCCCCGCGTCGTGGGG + Intergenic
1180548026 22:16520262-16520284 GTCCTAGGCCCCGCGTCGTGGGG + Intergenic
1181177851 22:21047877-21047899 GTCCCAGGGCGCCCGGGCTCTGG + Exonic
1183952225 22:41358301-41358323 GTCCCAGGCAGCGCTGCCTGGGG + Exonic
1183961394 22:41413793-41413815 CCCCAAGGCCGCGCGGGGTGTGG - Intergenic
1184420642 22:44381064-44381086 CTCTTAGCCCTCGCGGGCTGCGG + Intergenic
950534155 3:13569682-13569704 GTCCTAGGGTCTGCGGGCTGGGG + Intronic
953769493 3:45768518-45768540 GACCTAGGCCTTGAGGGCTGGGG + Intronic
954080461 3:48210606-48210628 GTCGAAGGCGCCGCGGGCTGGGG + Intergenic
959941434 3:112085974-112085996 TTGCTAGGCCGCGAGGACTGTGG + Intergenic
961545299 3:127629147-127629169 GTCAGGGGCCGCGCGGGCGGCGG - Intergenic
968899046 4:3422275-3422297 GGCCCAGGCCGCACGTGCTGGGG - Intronic
969854796 4:9990549-9990571 GTCCTAGGCAGTGGGGGATGGGG + Intronic
984227481 4:177052521-177052543 GCCCTAGGCCAATCGGGCTGAGG - Intergenic
987499875 5:18696264-18696286 GTCCTAGGCCACGGGGTGTGAGG + Intergenic
1001396204 5:171420758-171420780 GTCCTACCCCTCGCTGGCTGCGG - Intronic
1001617765 5:173056629-173056651 GTGCTAGGGCGCGCGGGCCTTGG + Intronic
1015476462 6:133664008-133664030 GTCGAAGGCGCCGCGGGCTGGGG + Intergenic
1020002830 7:4765420-4765442 GTCACAGGCCGCCCAGGCTGGGG - Exonic
1031918601 7:127585368-127585390 GTCCCAGGCCCGGAGGGCTGGGG + Exonic
1034556972 7:151856322-151856344 GTCCTCGGCTGCGCGGGCCTTGG - Intronic
1035171163 7:157018122-157018144 CTCCGCGGCCGAGCGGGCTGAGG + Intergenic
1035404220 7:158587696-158587718 GTCCATGGCCGCGCGGGAGGCGG + Intronic
1035727682 8:1834871-1834893 GTCCAAGGCTGCGCGGTCTCTGG - Intronic
1040471527 8:47738550-47738572 GGCCTGGGACGCGCGCGCTGCGG - Exonic
1040572948 8:48625626-48625648 GTCCTGGGATGCGCGGGCTGTGG - Intergenic
1048985368 8:139732089-139732111 GCCCTACGCTGCGCGGGCTCCGG + Exonic
1049212271 8:141392223-141392245 GTCCCGGGACGCGCGGGCAGGGG - Intronic
1049644062 8:143728296-143728318 GGCCGAGGCCGGGCCGGCTGGGG - Exonic
1049757322 8:144316469-144316491 CTCCTAGGCCTCGAGTGCTGGGG - Exonic
1052295480 9:26892635-26892657 GTCCGGGGCCGCGAGCGCTGCGG + Exonic
1053312023 9:37026348-37026370 GCACTTGGCCGCCCGGGCTGAGG - Intronic
1055266268 9:74498631-74498653 TCCCTGGGCCGCGCGGGCTCGGG - Intronic
1057547186 9:96027374-96027396 AGCCCAGGCCCCGCGGGCTGCGG + Intergenic
1059210797 9:112513456-112513478 GTCGAAGGCGCCGCGGGCTGGGG + Intronic
1060064709 9:120494782-120494804 GTCGAAGGCGCCGCGGGCTGGGG + Intronic
1060832029 9:126722957-126722979 GGCCTGGGCAGCGCGGGCGGGGG - Intergenic
1062235267 9:135505016-135505038 GTCCTAAGCAGCTCGGGATGGGG - Intergenic
1062556248 9:137114560-137114582 GTCCGGGGCCCTGCGGGCTGTGG + Exonic
1188005489 X:25013524-25013546 GTCCCAGGCCGCGGCGGCCGCGG + Exonic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1192433856 X:71130218-71130240 GGCCAAGGCCGTGGGGGCTGTGG + Intronic
1196951731 X:120931488-120931510 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196952415 X:120936349-120936371 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196953100 X:120941210-120941232 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196953785 X:120946070-120946092 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196954470 X:120950931-120950953 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196955153 X:120955791-120955813 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196955840 X:120960674-120960696 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196956522 X:120965535-120965557 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196957204 X:120970395-120970417 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196957886 X:120975255-120975277 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196958568 X:120980115-120980137 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1196959249 X:120984975-120984997 GCCCTCGCCCGCCCGGGCTGCGG + Exonic
1201188791 Y:11429607-11429629 GTCCTAGGCCCCGCGTCGTGGGG + Intergenic