ID: 1118294575

View in Genome Browser
Species Human (GRCh38)
Location 14:64557408-64557430
Sequence AAGGGGAAAGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6010
Summary {0: 2, 1: 24, 2: 206, 3: 1091, 4: 4687}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118294568_1118294575 1 Left 1118294568 14:64557384-64557406 CCCAATATATAAAATAAGAAGAA 0: 1
1: 1
2: 22
3: 210
4: 2265
Right 1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG 0: 2
1: 24
2: 206
3: 1091
4: 4687
1118294569_1118294575 0 Left 1118294569 14:64557385-64557407 CCAATATATAAAATAAGAAGAAG 0: 1
1: 0
2: 12
3: 100
4: 1123
Right 1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG 0: 2
1: 24
2: 206
3: 1091
4: 4687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118294575 Original CRISPR AAGGGGAAAGAGAAGGAGAA GGG Intronic
Too many off-targets to display for this crispr