ID: 1118297194

View in Genome Browser
Species Human (GRCh38)
Location 14:64581391-64581413
Sequence GCCAGTGGACCCATTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 4, 2: 27, 3: 51, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118297188_1118297194 -3 Left 1118297188 14:64581371-64581393 CCCTTATCTGAGGTCTACATGCC 0: 9
1: 27
2: 52
3: 83
4: 146
Right 1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG 0: 2
1: 4
2: 27
3: 51
4: 136
1118297189_1118297194 -4 Left 1118297189 14:64581372-64581394 CCTTATCTGAGGTCTACATGCCA 0: 10
1: 28
2: 48
3: 83
4: 187
Right 1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG 0: 2
1: 4
2: 27
3: 51
4: 136
1118297187_1118297194 -2 Left 1118297187 14:64581370-64581392 CCCCTTATCTGAGGTCTACATGC 0: 8
1: 30
2: 51
3: 75
4: 175
Right 1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG 0: 2
1: 4
2: 27
3: 51
4: 136
1118297185_1118297194 7 Left 1118297185 14:64581361-64581383 CCTCAGTCTCCCCTTATCTGAGG 0: 2
1: 8
2: 38
3: 92
4: 357
Right 1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG 0: 2
1: 4
2: 27
3: 51
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118297194 Original CRISPR GCCAGTGGACCCATTTGGTG GGG Intronic