ID: 1118299850

View in Genome Browser
Species Human (GRCh38)
Location 14:64605675-64605697
Sequence ATGCCATTCTGGATGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118299845_1118299850 1 Left 1118299845 14:64605651-64605673 CCCATGACTATACAGACATGCTC No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299844_1118299850 2 Left 1118299844 14:64605650-64605672 CCCCATGACTATACAGACATGCT No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299842_1118299850 4 Left 1118299842 14:64605648-64605670 CCCCCCATGACTATACAGACATG No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299846_1118299850 0 Left 1118299846 14:64605652-64605674 CCATGACTATACAGACATGCTCC No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299843_1118299850 3 Left 1118299843 14:64605649-64605671 CCCCCATGACTATACAGACATGC No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299839_1118299850 28 Left 1118299839 14:64605624-64605646 CCTGCTGCACTAACCCTAAGAAT No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299841_1118299850 14 Left 1118299841 14:64605638-64605660 CCTAAGAATGCCCCCCATGACTA No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data
1118299840_1118299850 15 Left 1118299840 14:64605637-64605659 CCCTAAGAATGCCCCCCATGACT No data
Right 1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118299850 Original CRISPR ATGCCATTCTGGATGAATGA GGG Intergenic
No off target data available for this crispr