ID: 1118303232

View in Genome Browser
Species Human (GRCh38)
Location 14:64633528-64633550
Sequence CAGTGGCAGGCATAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118303232_1118303239 7 Left 1118303232 14:64633528-64633550 CCACCATCCTATGCCTGCCACTG No data
Right 1118303239 14:64633558-64633580 CAAGTGAAGCTGGTCCCACCTGG No data
1118303232_1118303238 -3 Left 1118303232 14:64633528-64633550 CCACCATCCTATGCCTGCCACTG No data
Right 1118303238 14:64633548-64633570 CTGGCTTGCTCAAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118303232 Original CRISPR CAGTGGCAGGCATAGGATGG TGG (reversed) Intergenic
No off target data available for this crispr