ID: 1118303534

View in Genome Browser
Species Human (GRCh38)
Location 14:64635886-64635908
Sequence CTATGGAAGTGGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118303534_1118303539 -10 Left 1118303534 14:64635886-64635908 CCATCTCCCCTCCACTTCCATAG No data
Right 1118303539 14:64635899-64635921 ACTTCCATAGTATTTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118303534 Original CRISPR CTATGGAAGTGGAGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr