ID: 1118305919

View in Genome Browser
Species Human (GRCh38)
Location 14:64655322-64655344
Sequence CTGCCTCTCCAAATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118305919_1118305924 -1 Left 1118305919 14:64655322-64655344 CCCTGCTCCATTTGGAGAGGCAG No data
Right 1118305924 14:64655344-64655366 GCTTGGCCAAGGTGTAGAATTGG No data
1118305919_1118305926 14 Left 1118305919 14:64655322-64655344 CCCTGCTCCATTTGGAGAGGCAG No data
Right 1118305926 14:64655359-64655381 AGAATTGGAATCATCTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118305919 Original CRISPR CTGCCTCTCCAAATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr