ID: 1118306784

View in Genome Browser
Species Human (GRCh38)
Location 14:64661732-64661754
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118306784_1118306790 2 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG No data
1118306784_1118306789 1 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306789 14:64661756-64661778 TCGCTGTGTGTGGAGGAGAAAGG No data
1118306784_1118306787 -9 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306787 14:64661746-64661768 ATAGGTAGGATCGCTGTGTGTGG No data
1118306784_1118306792 4 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306792 14:64661759-64661781 CTGTGTGTGGAGGAGAAAGGGGG No data
1118306784_1118306788 -6 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306788 14:64661749-64661771 GGTAGGATCGCTGTGTGTGGAGG No data
1118306784_1118306791 3 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306791 14:64661758-64661780 GCTGTGTGTGGAGGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118306784 Original CRISPR CCTACCTATTACAGGTAGCA TGG (reversed) Intergenic
No off target data available for this crispr