ID: 1118306790

View in Genome Browser
Species Human (GRCh38)
Location 14:64661757-64661779
Sequence CGCTGTGTGTGGAGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118306784_1118306790 2 Left 1118306784 14:64661732-64661754 CCATGCTACCTGTAATAGGTAGG No data
Right 1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG No data
1118306786_1118306790 -6 Left 1118306786 14:64661740-64661762 CCTGTAATAGGTAGGATCGCTGT No data
Right 1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG No data
1118306783_1118306790 3 Left 1118306783 14:64661731-64661753 CCCATGCTACCTGTAATAGGTAG No data
Right 1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118306790 Original CRISPR CGCTGTGTGTGGAGGAGAAA GGG Intergenic
No off target data available for this crispr