ID: 1118307700

View in Genome Browser
Species Human (GRCh38)
Location 14:64669099-64669121
Sequence GCAATGCCTGCATGTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118307697_1118307700 3 Left 1118307697 14:64669073-64669095 CCAGTATGTTTGTTTGCTGCTGC No data
Right 1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118307700 Original CRISPR GCAATGCCTGCATGTTTTTG TGG Intergenic
No off target data available for this crispr