ID: 1118310966

View in Genome Browser
Species Human (GRCh38)
Location 14:64692755-64692777
Sequence CTTTCTAGGCTGGAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118310957_1118310966 13 Left 1118310957 14:64692719-64692741 CCATCTAGTCACTGGCTGTCCTG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 205
1118310955_1118310966 18 Left 1118310955 14:64692714-64692736 CCCATCCATCTAGTCACTGGCTG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 205
1118310956_1118310966 17 Left 1118310956 14:64692715-64692737 CCATCCATCTAGTCACTGGCTGT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 205
1118310959_1118310966 -6 Left 1118310959 14:64692738-64692760 CCTGATAGAGCAGGTCCCTTTCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118310966 Original CRISPR CTTTCTAGGCTGGAGGCTGT GGG Intergenic
900391846 1:2437033-2437055 CTGTCTGGGCTGGGGACTGTGGG - Intronic
900548122 1:3239912-3239934 CACTCTAGCCTGGAGGCTGGGGG + Intronic
901635991 1:10670396-10670418 ATGCCTAGGCGGGAGGCTGTGGG - Intronic
902368436 1:15991623-15991645 CCTTCCAGGCTGGGGGCTGGTGG - Intergenic
903261100 1:22132284-22132306 CCTTCTTGGCTGCATGCTGTGGG - Intronic
904082317 1:27879951-27879973 CTTTCAGGGCTGGATCCTGTAGG - Exonic
905684343 1:39898244-39898266 CTTTGCAGACTGGGGGCTGTTGG - Intronic
905911207 1:41656178-41656200 TTTTCTAGCCTGGACTCTGTTGG - Intronic
908170735 1:61502057-61502079 CATTCTAGCCTGGTGGCTGGGGG - Intergenic
909715367 1:78701508-78701530 CTTTATAGGGTGGTGGCAGTAGG + Intergenic
914862915 1:151400974-151400996 CTTTGTAGTCTGGGGGCTGTAGG + Intronic
920615020 1:207483374-207483396 TGTTCTAGGCTGGAGGCGGGAGG + Intronic
923092242 1:230749469-230749491 CTGCCCAGGCTGCAGGCTGTGGG + Intronic
923323568 1:232860214-232860236 CTTTCTGGGCTTCAGGGTGTCGG - Intergenic
924707610 1:246512090-246512112 CCTTCAAGGCTGGGGGCTGGTGG + Intergenic
1062801814 10:386567-386589 CTCTCAAGTCTGGATGCTGTTGG - Intronic
1064807362 10:19150583-19150605 CTGTCTAGGCAGTAAGCTGTGGG + Intronic
1065128707 10:22599321-22599343 CTTTCTAGGCTGGGGGATAGGGG - Intronic
1065895619 10:30160884-30160906 CATTCTAGGCTGGAGCCTCCTGG + Intergenic
1065973107 10:30820625-30820647 CTTTCGAGGCTGGAGGTTGAAGG - Intronic
1067203934 10:44197882-44197904 CTTTCTAGGCAGGAAGTGGTAGG + Intergenic
1067330172 10:45308323-45308345 GTATCTAGGCTCAAGGCTGTGGG + Intronic
1070268482 10:74927792-74927814 CTTCCTAGGCTGGAGGAGATAGG - Intronic
1070492602 10:76991800-76991822 CTTTCTGGGCTGGAGCCTGTTGG - Intronic
1071477369 10:86036305-86036327 TTTTCTTGGCTGGTTGCTGTGGG + Intronic
1071503845 10:86221489-86221511 CTTTGTGGGCTGTGGGCTGTGGG + Intronic
1076119612 10:127925117-127925139 CTTCCATGGCTGGAGGATGTTGG + Intronic
1076214083 10:128679040-128679062 TTATCTAGTCTGGAGGCTGCTGG - Intergenic
1076284054 10:129276155-129276177 ATTTCTAGGCTTGAGTGTGTGGG - Intergenic
1076483604 10:130801422-130801444 ATTTCTGTGCTGGTGGCTGTGGG + Intergenic
1077118535 11:896354-896376 GTGTCTAGGGTGGAGGCTGGGGG - Intronic
1078370456 11:10740525-10740547 CTTTCTCAGTTGGAGGCTGGAGG + Intergenic
1081849434 11:46265022-46265044 CTTCCTGGGCTGGGGGCAGTGGG + Intergenic
1083386765 11:62316777-62316799 ATTCCCAGGCTGGAGGCTGCAGG - Intergenic
1088712752 11:112523513-112523535 CTTTCTGGGCTGGGAGCTGCGGG + Intergenic
1089121624 11:116139715-116139737 CTTTCTGGCCTGGAGCCAGTAGG + Intergenic
1090396185 11:126420185-126420207 CTTTTAAAGATGGAGGCTGTGGG + Intronic
1092062807 12:5564821-5564843 CTTTCTGGGCTGGGGTCTGGGGG + Intronic
1092560453 12:9607781-9607803 CTTTCTGGGCCTGAGTCTGTGGG + Exonic
1092961380 12:13599448-13599470 CATTCTAGGCTTGATGCTTTTGG + Intronic
1095152390 12:38810865-38810887 CTTTCCTGGCTGGAAGATGTAGG - Intronic
1099015278 12:77336802-77336824 CTTTCTGTGCTGGAGCCTCTAGG - Intergenic
1101597852 12:106183148-106183170 CTGACTAGACTTGAGGCTGTAGG - Intergenic
1102492134 12:113295862-113295884 CCTTCCAGCCTGGATGCTGTGGG + Intronic
1104659700 12:130601955-130601977 CTTTCTTGGCCAGAGGCTGCAGG - Intronic
1104700303 12:130898084-130898106 CTTTCTTGGTTTGAGGCTTTTGG - Intergenic
1109701453 13:66030069-66030091 CTTTCTAGATTTGAGGGTGTTGG + Intergenic
1110124036 13:71919340-71919362 CTTTCTAGTCTGTATACTGTTGG + Intergenic
1111023809 13:82491626-82491648 CTTTCTTGTCTAGGGGCTGTGGG - Intergenic
1111961585 13:94816394-94816416 TTTTCTAGGCTGGAGAGTGGTGG - Intergenic
1113927793 13:113951064-113951086 CTCTCTAGGCTGAGGCCTGTGGG + Intergenic
1114202469 14:20535435-20535457 CATTCTTATCTGGAGGCTGTGGG + Intergenic
1114271344 14:21102171-21102193 CTTCCTAGGCTGAGGGTTGTAGG - Intronic
1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG + Intergenic
1119347242 14:73936073-73936095 CTTTCTTGGCTAGATCCTGTGGG + Exonic
1120207277 14:81600161-81600183 CTTGATAGGGTGGAGGCTGGTGG + Intergenic
1121073331 14:91045021-91045043 AGTTCTTGTCTGGAGGCTGTGGG - Intronic
1122278313 14:100606622-100606644 CTTTCCAGTCTGGAGCCAGTGGG - Intergenic
1123691211 15:22839647-22839669 CTTTCTAGGCTGGAGCTACTCGG + Exonic
1131209162 15:90478703-90478725 CACTCTAAGCTGGAGGGTGTAGG + Intronic
1132309058 15:100843120-100843142 GTTTCCAGGCTGTAGGCTGCAGG + Intergenic
1132598015 16:762023-762045 CTCTCTAGGGTGGGGCCTGTGGG - Intronic
1132720437 16:1313035-1313057 CGTTCTCGGCGGGAGCCTGTCGG - Intronic
1133978902 16:10619293-10619315 CCTTCTGGGCTGGAGGAGGTGGG - Intergenic
1134055798 16:11169056-11169078 CTGTCCAGGCTGAAGGCAGTGGG - Intronic
1134280032 16:12809076-12809098 CTTGCTAGGCTGGGCGCGGTGGG + Intergenic
1135629290 16:24023316-24023338 CTTCCTAGCCTTGATGCTGTGGG - Intronic
1135793902 16:25423414-25423436 CTTTCCAGGCTGGAGTCTGATGG - Intergenic
1137461508 16:48668363-48668385 CCTGCTAGGCTGCAGCCTGTCGG - Intergenic
1137588859 16:49681291-49681313 CTGTGTAGTCTGGATGCTGTTGG - Intronic
1137812371 16:51365031-51365053 ATTTCTAGGCAGGGGGCTTTAGG + Intergenic
1139946769 16:70647262-70647284 CTTTCCAGGCTTGTGGGTGTTGG + Intronic
1140913920 16:79478110-79478132 CTCAGTAGTCTGGAGGCTGTGGG - Intergenic
1141945281 16:87305267-87305289 CTTTCTAGTATGGAGACTGGCGG + Intronic
1143563538 17:7708704-7708726 CTTCCCAGGCTCCAGGCTGTGGG - Exonic
1143988192 17:10933617-10933639 CTTTCTCTGCTGGGAGCTGTAGG + Intergenic
1147575477 17:41596455-41596477 CTGGCCAGGGTGGAGGCTGTGGG + Intergenic
1148436193 17:47687807-47687829 CTCTCTAAGCTGGAAGCTTTTGG + Intergenic
1148450133 17:47772072-47772094 CTTTCTAGGCAGCAGGATGGAGG + Intergenic
1151880901 17:76893811-76893833 CTTTCTAGACTGGGGGCGGGGGG + Intronic
1151967618 17:77439651-77439673 CTTTCTGTCCTGGAGGCTGGTGG + Intronic
1152118274 17:78402109-78402131 CTTTCTCCCCTGGAGGGTGTTGG + Intronic
1157632388 18:49111781-49111803 CTTGCTAGGCTGGTGGCAGAAGG + Intronic
1159827135 18:73227259-73227281 CTTGCGTGGCTGGAGTCTGTAGG - Intronic
1160098737 18:75901059-75901081 CCTTCCAGGCTGGCTGCTGTGGG - Intergenic
1161249221 19:3271316-3271338 CCTGCTAGGCTGGAGGCAGGAGG - Intronic
1161330403 19:3684089-3684111 CTTCCCAGCCAGGAGGCTGTGGG - Intronic
1161397101 19:4050506-4050528 CTTTGTAGGCTAGAGGCTCCAGG - Intronic
1163848713 19:19651689-19651711 CTTTCTCGGAGGGAGGCTGCAGG + Exonic
1163893001 19:20033390-20033412 CTGTGTGGGCTGCAGGCTGTAGG - Intronic
1164189275 19:22900277-22900299 ATTTCTAGTCTGCAGCCTGTGGG - Intergenic
1164279778 19:23759270-23759292 CCATCTGGGCTGGGGGCTGTCGG - Intergenic
1164743499 19:30594369-30594391 CTTTCTAGGCTGGGGACCCTGGG + Intronic
1166671637 19:44713518-44713540 CTTTCTGGGCTGGATAGTGTTGG - Intergenic
1167064837 19:47177396-47177418 CTTTCCAGGCTGGAGTGTGGTGG + Intronic
1167241782 19:48348100-48348122 CAGCCTAGGCTGGAGGATGTGGG - Intronic
1167528905 19:50002646-50002668 CTTTCCAGGCTGTTGGCTGCAGG - Intronic
1202668801 1_KI270709v1_random:29165-29187 GTTTCTAGGCAGAAGTCTGTTGG - Intergenic
925860628 2:8172249-8172271 TTTTCTAGGCTGAGGCCTGTCGG - Intergenic
927023456 2:19041551-19041573 TTCTCTTGGCTGGAGGCTATTGG + Intergenic
930620094 2:53634755-53634777 GCTTCTAGGCTGAAGGCTGTGGG - Intronic
931583245 2:63800450-63800472 CTTACTATGCTTGATGCTGTGGG - Intronic
933616175 2:84484492-84484514 CTTTCTCTACTGGAGGTTGTGGG + Intergenic
934113950 2:88766256-88766278 CCTTCCAGGCTGAGGGCTGTGGG + Intergenic
934636079 2:95991430-95991452 CTTTCCAGGCTGAGGGCTGCGGG - Intronic
934735081 2:96685968-96685990 CTGTCCAGGCTGGTGGCTTTGGG - Intergenic
934797567 2:97113996-97114018 CTTTCCAGGCTGAGGGCTGCGGG + Intronic
937218378 2:120327186-120327208 CTGTCTACACTGGCGGCTGTTGG - Intergenic
938322325 2:130373382-130373404 CATTCAAGGCTTGAGGCTGGAGG + Exonic
938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG + Intergenic
941421395 2:165286678-165286700 CTTTTTAGCCTGGATGCAGTTGG - Intronic
942204378 2:173604818-173604840 CTTTCTGAACTGGAGGCTCTTGG + Intergenic
942795460 2:179813860-179813882 TTTTCTAGGCTAGAGTCTGAAGG - Intronic
943803318 2:192089616-192089638 CAGTCTAGGATGGTGGCTGTGGG - Intronic
944520648 2:200563170-200563192 CATTCAAAACTGGAGGCTGTGGG + Intronic
944872200 2:203924518-203924540 TTTTCTAGGCTGGAGTGTGGTGG + Intergenic
945839778 2:214873685-214873707 CTTTCTAGTCTGTAGGCAGGTGG - Intergenic
947100357 2:226614241-226614263 CTTTCAAGGCTGAAGTCTGGTGG + Intergenic
947739646 2:232479266-232479288 CTGCCCAGGCTGGAGGCTGCCGG - Intergenic
948095417 2:235329747-235329769 GATTCTAGGATGGAGGGTGTGGG - Intergenic
948671256 2:239570286-239570308 CTCTCTAGGCTGCAGTCTGGAGG + Intergenic
1169049066 20:2560860-2560882 CAGAATAGGCTGGAGGCTGTAGG + Intronic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171516424 20:25741748-25741770 CTTTCTTGGCTGGAGGTCTTGGG + Intergenic
1172350726 20:34237967-34237989 CTTTGGAGGCCAGAGGCTGTGGG - Intronic
1173162912 20:40665564-40665586 CCTTCAATTCTGGAGGCTGTAGG + Intergenic
1173953627 20:47013198-47013220 CTGTTTAGGCTGGAGGCTCCAGG - Intronic
1174362841 20:50039361-50039383 CTTTCTGGGAGGGAGGCTGTGGG - Intergenic
1174390566 20:50216221-50216243 CTCCCCAGCCTGGAGGCTGTGGG + Intergenic
1175793321 20:61756285-61756307 ATTTGTATGCTGGGGGCTGTGGG + Intronic
1176220647 20:63967918-63967940 CTTTCTGCGTTGGAGGCCGTCGG - Exonic
1179164469 21:38924939-38924961 ATTTCTTGGCTTGGGGCTGTAGG - Intergenic
1181074365 22:20365465-20365487 CTTTTTTGGCTGGATGCAGTGGG - Intronic
1182516259 22:30860746-30860768 CCTGGTAGGGTGGAGGCTGTGGG + Intronic
950841324 3:15970704-15970726 ATCTCTAGGCTGGAGGCAGAGGG - Intergenic
951115509 3:18856730-18856752 CTTTCTTGGGTGGAGGATGGGGG - Intergenic
952324547 3:32309209-32309231 CTTTCTAGACTTGGTGCTGTGGG + Intronic
953261318 3:41341724-41341746 CTTTCTGGTTTGGAGCCTGTAGG - Intronic
953332069 3:42061981-42062003 CTGTCTCGGGTGGAGGCTCTGGG + Intronic
954390730 3:50266873-50266895 CTTTCTAGGTTGGAGGTGGGAGG - Intergenic
956418406 3:69058880-69058902 CTTTCTAGGCTGGTGAATGAGGG - Intronic
956780749 3:72601278-72601300 CTCTCTAAGCTGGAGGCAGGAGG - Intergenic
957228084 3:77474629-77474651 CTTTCTAGGGTAGAGGATTTAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962292138 3:134145964-134145986 CTCACTGGGCTGGGGGCTGTCGG - Intronic
963555166 3:146778092-146778114 TTTTCTAGTCTAGAGGCTCTTGG + Intergenic
964383883 3:156126631-156126653 CTTACTAGCCTGGAGGCTCTGGG + Intronic
966020090 3:175198691-175198713 CTTTCTAGGCTGAAACCTTTGGG + Intronic
967463433 3:189774721-189774743 CTTTCTAGGTTGGTAGCAGTGGG - Intronic
967846127 3:194044671-194044693 CTTGCTAAGCTGGATGCTGTGGG + Intergenic
969063733 4:4460641-4460663 CCTAGGAGGCTGGAGGCTGTGGG - Intronic
971484996 4:27149927-27149949 CTCTCTTGGCTTGAGGCTGATGG + Intergenic
973147622 4:46847362-46847384 TTTTGTTGGCTGGAGGCTGAAGG - Intronic
973843362 4:54885688-54885710 CTTACTTGGCTGTAGGCTGGTGG - Intergenic
977554763 4:98477445-98477467 CTTCTTATGGTGGAGGCTGTGGG - Intronic
977716468 4:100189664-100189686 CTTTCTAGTCTGGTGCCAGTAGG - Intronic
980489433 4:133506025-133506047 CTCTCTGGGCTTGAGGCTCTAGG + Intergenic
985823566 5:2177460-2177482 CCTACAGGGCTGGAGGCTGTGGG - Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
986374212 5:7113734-7113756 CTTTCTAGCCTGGGGACAGTGGG + Intergenic
989133694 5:38132121-38132143 CTTTTTAATCTGGAGGCTCTTGG + Intergenic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
994798896 5:104344481-104344503 TTTTCTATTCTGGAGGCTATTGG + Intergenic
995074813 5:107970181-107970203 CTTTCTGGGCTGGAGACTCTAGG + Intronic
996417728 5:123228168-123228190 CTTCCCAGGCTCTAGGCTGTAGG - Intergenic
996685452 5:126275113-126275135 CTTTCTACGCATCAGGCTGTTGG - Intergenic
1002481062 5:179501210-179501232 ATTCCCAGGCTGGAGGGTGTGGG - Intergenic
1002573948 5:180161186-180161208 TTTTCTAGTCTGGGGGCTGTGGG - Intronic
1002701942 5:181130637-181130659 CTTCCAGGGCTGGAGTCTGTGGG - Intergenic
1002703854 5:181147509-181147531 CTTCCAGGGCTGGAGTCTGTGGG + Intergenic
1003185316 6:3825411-3825433 CATGCTTGGCTGGCGGCTGTGGG - Intergenic
1005614102 6:27556295-27556317 CATTTTTGGCTGGAGGATGTTGG - Intergenic
1007173544 6:39881224-39881246 ATTTCTAGACTGGAGAGTGTGGG + Intronic
1007274632 6:40664237-40664259 CTCCCTAGGTTGAAGGCTGTGGG - Intergenic
1007700015 6:43761010-43761032 CTTTCCAGGCTGAAGGCTGCAGG - Intergenic
1008536013 6:52506713-52506735 CTTTGAGGGCTGAAGGCTGTGGG - Intronic
1008537529 6:52518172-52518194 CTGGCTAGGGTGGAGGTTGTGGG + Intronic
1011218560 6:85031068-85031090 CTTTCTTGATTGCAGGCTGTAGG + Intergenic
1011937706 6:92801630-92801652 CCTTGCAGGCTGGAGGGTGTGGG - Intergenic
1011995474 6:93581644-93581666 CTTTCCTTCCTGGAGGCTGTTGG + Intergenic
1015412752 6:132913323-132913345 CTTTCAGGGCTGCAGGATGTGGG + Intergenic
1016778903 6:147936729-147936751 CTTTCTACCCTGGAGGCCATTGG - Intergenic
1023378984 7:39586977-39586999 CTTTCCAGGCTTTAGGCTGGTGG - Intronic
1028768207 7:94584450-94584472 CTTTCTAGGACAGAGGATGTAGG - Intergenic
1029178932 7:98685455-98685477 CTTCCTCGGCTGGCGGCTGCAGG + Intergenic
1030374922 7:108744388-108744410 CTTTCTAGGGTGGAGCCCCTAGG - Intergenic
1031315128 7:120247169-120247191 CATTCTTGCCTGGAGGCTCTGGG - Intergenic
1033443067 7:141397449-141397471 CATTCTAAGTTGGAGGCTGGTGG - Intronic
1033889124 7:145986584-145986606 CTTTTTTGCCTGGAGGCTCTAGG - Intergenic
1033895241 7:146061174-146061196 CTTTCTTGTCTGGAGGAAGTGGG - Intergenic
1034900389 7:154904832-154904854 CTGTCCAGGATGGAGGGTGTGGG - Intergenic
1035568386 8:656843-656865 TTTTCTAGGCTGGAGCATGCTGG - Intronic
1035704388 8:1664091-1664113 CTTTCTAGAGCTGAGGCTGTGGG + Intronic
1036706640 8:11051702-11051724 CTGTGTAGGGTGGAGGCAGTGGG - Intronic
1036751722 8:11447711-11447733 CTTTCTACTCTGGAGAGTGTGGG + Intronic
1038014015 8:23498043-23498065 CTTTCCAGTCTGGAGGCAGCAGG + Intergenic
1038118039 8:24579893-24579915 CTTTCTTTTCTGGAGGCTCTAGG - Intergenic
1043443551 8:80298044-80298066 CTTTCTTGGGTGTAGGCTCTAGG - Intergenic
1046649953 8:116826844-116826866 CTTACCTGGCTGGAGTCTGTGGG - Intronic
1047156527 8:122325550-122325572 CATTTTAGGGTTGAGGCTGTTGG - Intergenic
1048865991 8:138762283-138762305 CTTGCTCAGCTGGAGGCTGCAGG - Intronic
1050821208 9:9882450-9882472 CATTCTAGGCTTGAGGATGAAGG + Intronic
1052733756 9:32319084-32319106 GTTTGTAGTGTGGAGGCTGTGGG - Intergenic
1053141448 9:35685179-35685201 CATCCTAGGCTTGGGGCTGTAGG - Intronic
1057321450 9:94016834-94016856 AGTTCTAGTCTGGAGGCTCTGGG + Intergenic
1057806455 9:98223168-98223190 CTGTCTGGGGTGGAGGTTGTGGG + Intronic
1059322133 9:113478029-113478051 CTGTCTTGGCTGGAGGCCATTGG + Intronic
1061072004 9:128316626-128316648 CTGTCGCGGCTGGAGGATGTGGG + Intronic
1061724654 9:132575472-132575494 CCTTCCAGGCTGGACGCTGTGGG - Intergenic
1061872142 9:133526835-133526857 CTGTCTAGGCTGCAGGCAGAGGG - Intronic
1186206755 X:7208833-7208855 CTTTCTTTTCTGGAGGCTCTAGG + Intergenic
1187445355 X:19356096-19356118 CATTCTATGCTGGACACTGTGGG - Intronic
1190515116 X:51215781-51215803 CTTTCAAGGAGGGAGGGTGTTGG - Intergenic
1192195347 X:69024190-69024212 TTTTCTAGTCTGGAGCCTGGGGG - Intergenic
1193985555 X:88237159-88237181 CTTTCTGGGGTGGAGACTCTGGG - Intergenic
1197141560 X:123122509-123122531 CTTTGTAGGGTGGTGGCAGTGGG - Intergenic
1198378361 X:136061447-136061469 AATGCTAGGCAGGAGGCTGTGGG - Intergenic
1201401693 Y:13610500-13610522 TTTACCAGGCTGCAGGCTGTGGG - Intergenic
1202584676 Y:26410005-26410027 CCTTCCAGGCTGAGGGCTGTGGG + Intergenic