ID: 1118312477

View in Genome Browser
Species Human (GRCh38)
Location 14:64704214-64704236
Sequence GGTTAACGATTAACGCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 3}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118312477_1118312487 20 Left 1118312477 14:64704214-64704236 CCTGCGGGCGTTAATCGTTAACC 0: 1
1: 0
2: 0
3: 2
4: 3
Right 1118312487 14:64704257-64704279 CCGCAGCCTTACCCCGGCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1118312477_1118312484 14 Left 1118312477 14:64704214-64704236 CCTGCGGGCGTTAATCGTTAACC 0: 1
1: 0
2: 0
3: 2
4: 3
Right 1118312484 14:64704251-64704273 CCGCCGCCGCAGCCTTACCCCGG 0: 1
1: 0
2: 1
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118312477 Original CRISPR GGTTAACGATTAACGCCCGC AGG (reversed) Intronic
1084269327 11:68020758-68020780 GGTCAAGGATTAAAGCCGGCAGG - Intronic
1118312477 14:64704214-64704236 GGTTAACGATTAACGCCCGCAGG - Intronic
1124961579 15:34400639-34400661 GGGTAACGAATAAAGCACGCAGG - Intronic
1124978205 15:34546862-34546884 GGGTAACGAATAAAGCACGCAGG - Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
962113501 3:132475636-132475658 GGTTAAAGATCAAAGCCCGCAGG - Intronic