ID: 1118314671

View in Genome Browser
Species Human (GRCh38)
Location 14:64718608-64718630
Sequence ATGATCAGGAGCAAGTCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118314671_1118314676 -1 Left 1118314671 14:64718608-64718630 CCCGCTGACTTGCTCCTGATCAT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1118314676 14:64718630-64718652 TACAGTGGCTAGGCAGAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 153
1118314671_1118314679 11 Left 1118314671 14:64718608-64718630 CCCGCTGACTTGCTCCTGATCAT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1118314679 14:64718642-64718664 GCAGAGCCAGGGTAGTTTGGAGG 0: 1
1: 0
2: 1
3: 34
4: 206
1118314671_1118314681 19 Left 1118314671 14:64718608-64718630 CCCGCTGACTTGCTCCTGATCAT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1118314681 14:64718650-64718672 AGGGTAGTTTGGAGGAGTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 199
1118314671_1118314677 0 Left 1118314671 14:64718608-64718630 CCCGCTGACTTGCTCCTGATCAT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1118314677 14:64718631-64718653 ACAGTGGCTAGGCAGAGCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 292
1118314671_1118314678 8 Left 1118314671 14:64718608-64718630 CCCGCTGACTTGCTCCTGATCAT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1118314678 14:64718639-64718661 TAGGCAGAGCCAGGGTAGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118314671 Original CRISPR ATGATCAGGAGCAAGTCAGC GGG (reversed) Intronic
900914592 1:5627153-5627175 ATGACCAGGAGGAAGTTTGCAGG + Intergenic
903927691 1:26842452-26842474 ATCATCAGGAGAAACCCAGCTGG + Intronic
905312150 1:37056727-37056749 GTGCTCAGGAGCACGGCAGCAGG + Intergenic
906059933 1:42941947-42941969 ATGCTGAGGAGCAAGTCACCAGG - Intronic
908686481 1:66725785-66725807 ATGAGCAGCTGGAAGTCAGCTGG - Intronic
911664471 1:100538393-100538415 ATCAACAGGAGAAACTCAGCTGG - Exonic
912109710 1:106326107-106326129 AGGATCAGGAGCCAGACTGCAGG + Intergenic
912450937 1:109767354-109767376 ATGATGGGGAGAAGGTCAGCAGG - Intronic
916648631 1:166814829-166814851 ATTATCAAGAGCAAGTCACCTGG - Intergenic
917468382 1:175304992-175305014 TTGCTCAGGAGCAAGGAAGCTGG + Intergenic
920579398 1:207091018-207091040 GTGACCTTGAGCAAGTCAGCTGG - Intronic
920715664 1:208337911-208337933 CTGAACGGGAGCAAGTCACCTGG - Intergenic
923285525 1:232491256-232491278 AAGATCAGGAACAAGCCAGGCGG + Intronic
924378535 1:243438774-243438796 ATGATCAGCAGAAAGTTATCAGG - Intronic
924444666 1:244118092-244118114 ATGCTGAGGAGAAAGGCAGCAGG + Intergenic
924945415 1:248843122-248843144 AGGGACAGGAGTAAGTCAGCAGG - Intronic
1063226190 10:4017065-4017087 ATGATCAGCAGTAACTCACCTGG - Intergenic
1069536641 10:69258478-69258500 ATGATGATGATGAAGTCAGCAGG + Intronic
1070817074 10:79331368-79331390 ATGGTCAGAAGTGAGTCAGCCGG - Intergenic
1073867553 10:107822330-107822352 ATCATCAGCAGCAAGACAGATGG + Intergenic
1075586316 10:123660832-123660854 CTGATAATGAGCAAGTGAGCTGG + Intergenic
1079366958 11:19817798-19817820 AGGGACAGGAGCAAGTGAGCTGG - Intronic
1080039715 11:27746820-27746842 AAGATCAGAAGGAAGTCAGTGGG + Intergenic
1081641369 11:44756914-44756936 AAGATCAGGAACAAGACAGTAGG - Intronic
1085121906 11:73972854-73972876 GTGGGCATGAGCAAGTCAGCTGG - Intergenic
1087517823 11:99187080-99187102 ATGTTCAGGAGCATCTCACCAGG + Intronic
1088603920 11:111511399-111511421 ATGAACAGGGGCAGGTCATCTGG - Intronic
1093603903 12:21065952-21065974 ATGGTCAGGAGAAAATCACCAGG - Intronic
1094214161 12:27922899-27922921 AGGGTCAGGAACAAGACAGCAGG + Intergenic
1095380608 12:41586490-41586512 ATAACCAGGAGTAAGCCAGCTGG + Intergenic
1098198411 12:68027333-68027355 ATGATCAGGAACAAATCCTCTGG - Intergenic
1103340893 12:120220661-120220683 ATGGTCAGAAGCAAGTAAGTTGG - Intronic
1104672364 12:130689532-130689554 AGGATCAGTAGCAGCTCAGCTGG + Intronic
1107139935 13:36987512-36987534 GAGAACAGGAGCAAGTTAGCGGG - Intronic
1112257977 13:97852259-97852281 AAGAGCAGGACCAAGACAGCGGG + Intergenic
1113204349 13:107898065-107898087 ATGATCTGGAGCATATCAGTTGG + Intergenic
1113377126 13:109774672-109774694 GAGATCTGGAGCAAGTCATCTGG + Intronic
1118314671 14:64718608-64718630 ATGATCAGGAGCAAGTCAGCGGG - Intronic
1119764119 14:77177711-77177733 ATGAGCAGGAGCATGTTAGAAGG - Intronic
1119801937 14:77453318-77453340 ATGACCTGGAGCGAGTCAGCTGG - Exonic
1121025785 14:90615398-90615420 ATGCTCAGAAGCAAGGAAGCCGG + Intronic
1121033685 14:90681569-90681591 ATGATAAAGAGCAAGACAGGAGG + Intronic
1122402779 14:101477081-101477103 AGGAGCAGGAGAAAGGCAGCAGG - Intergenic
1123088923 14:105733167-105733189 ATGATGGGGAGAAGGTCAGCAGG - Intergenic
1126070547 15:44861780-44861802 CTTATCAGGCGCAAGTCACCTGG + Intergenic
1129813106 15:78526751-78526773 ATTATGAGGATCAAGTGAGCTGG + Intronic
1130047147 15:80454178-80454200 ATGAGCTGAAGCAAGTCACCTGG + Intronic
1133111086 16:3548764-3548786 GGGAACAGGAGCAAGTGAGCCGG + Intronic
1133415584 16:5604637-5604659 ATGATCAGTAGCATGTAGGCAGG - Intergenic
1134063453 16:11212445-11212467 CTGATCAGGGGCAAGGGAGCTGG - Intergenic
1135227924 16:20677502-20677524 TTGATGAGGAGCAAGGTAGCCGG - Intronic
1143710187 17:8729019-8729041 AGGCTCAGGAGCACCTCAGCAGG - Intergenic
1144018495 17:11219984-11220006 ATTATCAGGAGCAGCTCTGCGGG + Intergenic
1144048102 17:11471279-11471301 ATGTACAGGAGCAACTCAGATGG + Intronic
1145887460 17:28392553-28392575 ATGCTCAGCAGAAAGGCAGCAGG + Intronic
1147129320 17:38397406-38397428 ATGATCAGGAACAGGCCGGCAGG - Intronic
1147129415 17:38398026-38398048 ATGATCAGGAACAGGCCAGTGGG + Intronic
1147454998 17:40531574-40531596 CTCATTAGGAGCAAGTCACCAGG - Intergenic
1152632731 17:81417815-81417837 AGGAACAGGAGCACGTCACCCGG - Intronic
1152859515 17:82687734-82687756 ATGATCGGCAGCCAGTCAGGAGG - Intronic
1155024877 18:21932077-21932099 CTGATTAAGAGCAAGTCATCAGG - Intergenic
1156052794 18:32957854-32957876 ATGATTTGGAGCAAGTCTTCAGG + Intronic
1158055295 18:53271720-53271742 ATGATTAGGAGCAAGTCAGTAGG + Intronic
1158940810 18:62404807-62404829 AAAATCAAGAACAAGTCAGCTGG - Intergenic
1161581392 19:5082854-5082876 ATGCCCAGGAGCCAGCCAGCAGG - Intronic
1161972643 19:7591071-7591093 ATGGTCCGGAGCATGTGAGCAGG - Intergenic
1163203207 19:15782838-15782860 ATGATGGGGAGAAGGTCAGCAGG + Intergenic
1163204191 19:15790344-15790366 ATGATCACGACAACGTCAGCTGG + Intergenic
1166069205 19:40377552-40377574 ATGAACAGGAGCCATTCTGCCGG + Intronic
1167888439 19:52520995-52521017 ATGGTGAGGAGAATGTCAGCAGG - Intergenic
1168191413 19:54741098-54741120 ATTATCAGAAGCATGGCAGCAGG - Intronic
1168193682 19:54757726-54757748 ATTATCAGAAGCATGGCAGCAGG - Intronic
1168197636 19:54787316-54787338 ATTATCAGAAGCATGGCAGCAGG - Intronic
1168204116 19:54836695-54836717 ATTATCAGAAGCATGGCAGCAGG - Intronic
925251712 2:2444696-2444718 ATGATCAGGAGCAATTGCCCTGG - Intergenic
929277456 2:40041627-40041649 GTGATATGGAGCAAGCCAGCTGG - Intergenic
930165385 2:48198965-48198987 ATGGTCAGGAGCCAGGGAGCAGG - Intergenic
932408216 2:71528399-71528421 ATGGTAAGGAGCAAGGGAGCAGG + Exonic
932481945 2:72047723-72047745 CTGACCAGGAGCCAGTAAGCTGG - Intergenic
933045751 2:77534704-77534726 ATGCTCAGGAGCAACTGATCTGG - Intronic
936586474 2:113762837-113762859 TTGCTCAGGAGCCAGTCAGATGG - Intergenic
937840623 2:126520622-126520644 ATGATCAAGAGAACTTCAGCTGG - Intergenic
939025240 2:137005246-137005268 ATGTTTATGAACAAGTCAGCTGG + Intronic
939476631 2:142695331-142695353 ATGGTGGGGAGAAAGTCAGCAGG + Intergenic
945997691 2:216452115-216452137 ATGGTCTGGAGTAAGTGAGCAGG + Intronic
946039745 2:216773447-216773469 TTGATCTGGAGCATGTCAGGTGG + Intergenic
947945347 2:234097083-234097105 TTGAGCAAGAGCAAGTCTGCTGG + Intergenic
948143568 2:235692238-235692260 AGGAACAGGTGCAAGGCAGCGGG - Intronic
948272713 2:236686719-236686741 ATAATAAAGAGAAAGTCAGCAGG - Intergenic
1171239205 20:23551478-23551500 ATGCTCAGGAGAAAGTGACCTGG - Intergenic
1173537376 20:43825911-43825933 ACGATCCAGAGAAAGTCAGCAGG + Intergenic
1174908708 20:54581955-54581977 AAGATCAGGAGCAAGTCAAAAGG - Intronic
1184423284 22:44394402-44394424 AAGATGAGGAGAAAGGCAGCTGG + Intergenic
949832504 3:8230545-8230567 ATGGTCAGAAGCAGGTTAGCTGG - Intergenic
955925750 3:64003294-64003316 ATAATCAAGAGCATCTCAGCTGG + Exonic
961172722 3:124809594-124809616 ATGATAAGGAGCCAGCCAGGAGG - Intronic
961744739 3:129057345-129057367 ATGATCAGGAGGAAGCCATGTGG + Intergenic
962391649 3:134977601-134977623 TTCACCAGGAGCAAGTCAGGGGG - Intronic
966377303 3:179309553-179309575 AGGATGGGGAGCAAGTCTGCTGG - Intergenic
967964645 3:194951407-194951429 ATAATCCGGAGCAAGGCTGCGGG + Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
970072033 4:12171072-12171094 ATCATCAGAAGCAATTTAGCAGG - Intergenic
970157959 4:13160396-13160418 ATGATCAGAAACCAGTTAGCTGG + Intergenic
971824490 4:31603873-31603895 ATGTTGAGGAGCAAGGAAGCCGG + Intergenic
978003564 4:103588018-103588040 ATCATCAGAAGAAATTCAGCTGG + Exonic
984509183 4:180658001-180658023 ATGAGCAGGAGGAACTCGGCGGG - Intergenic
986743892 5:10727499-10727521 AGCATCAGGAGCAAGGCAGCAGG - Intronic
988714935 5:33816056-33816078 GTGACTAGGAGCAAGTCAGTGGG + Intronic
992726414 5:79612295-79612317 ATGCGCAGGCGCAAGACAGCCGG - Intronic
996612526 5:125399635-125399657 ATAATCAGTAGCAAATAAGCAGG - Intergenic
997260595 5:132463082-132463104 CTGTACAGCAGCAAGTCAGCAGG + Exonic
997670368 5:135666423-135666445 ATGTTCAGGAAGAACTCAGCAGG + Intergenic
1000320169 5:160128357-160128379 CTGTTCAGAAGCAAGTCACCAGG + Intergenic
1001203609 5:169741732-169741754 AGGAACAAGAGCAAGTCAGTGGG - Intronic
1001331882 5:170767908-170767930 AGGGTGAGCAGCAAGTCAGCAGG + Intronic
1012526057 6:100179003-100179025 CAGATGAGAAGCAAGTCAGCTGG - Intergenic
1014795579 6:125720405-125720427 AACATCAGGAGCAAGTTACCTGG + Intergenic
1019149037 6:169992385-169992407 CTGATCAGGCCCAAGTCACCAGG + Intergenic
1020476291 7:8598847-8598869 ATGATCAGAAGCAATTAGGCTGG - Intronic
1022038919 7:26560826-26560848 ATGATTAGGAGCAAAACAGCAGG + Intergenic
1024383051 7:48721990-48722012 AAAAACAGGAACAAGTCAGCAGG + Intergenic
1028079504 7:86556812-86556834 AATATCAAGAGCAAGACAGCTGG + Intergenic
1030643183 7:112028873-112028895 ATAATCAGGACCATGTGAGCAGG - Intronic
1032368605 7:131324399-131324421 AACATCTGGAGTAAGTCAGCAGG - Intronic
1033705835 7:143884300-143884322 ATCATTAGGAACAAGTCAGAAGG + Intronic
1034658833 7:152751515-152751537 ATTATCAGAAGCAGGACAGCAGG - Intergenic
1035224477 7:157425783-157425805 ATGATGAGGCTCAATTCAGCCGG + Intergenic
1035733070 8:1866112-1866134 ATGTCCAGGAGCAGGTCAGTGGG - Intronic
1036753706 8:11458676-11458698 TTCATCAGGAGCAGCTCAGCTGG + Intronic
1036754789 8:11464993-11465015 AAGAACAGGAGCAAGTGCGCAGG + Intronic
1038099216 8:24353554-24353576 ATGGTGAGGAGAAAGTCAACGGG + Intronic
1038117464 8:24573514-24573536 ATGATCAGTTGCTGGTCAGCTGG - Intergenic
1039443435 8:37611518-37611540 CTGCCCAGCAGCAAGTCAGCAGG - Intergenic
1041169450 8:55126402-55126424 ATGGCCAGGAGCAATGCAGCTGG - Intronic
1041777584 8:61540409-61540431 ATGAACAGGAGCAAGAGAGCTGG - Intronic
1046019566 8:108648309-108648331 ATGAGCATGAGCAAGCCTGCAGG + Intronic
1048512528 8:135075731-135075753 ATGATCAAGGGCAGGTCACCTGG + Intergenic
1048546248 8:135390119-135390141 GTGACCTTGAGCAAGTCAGCTGG + Intergenic
1050819503 9:9859808-9859830 GTTATAAGGAGAAAGTCAGCTGG - Intronic
1051119775 9:13739417-13739439 AAGATAAGGAGCACGGCAGCCGG - Intergenic
1053357757 9:37461096-37461118 ATGATCAAAAGCAACTCTGCAGG - Intronic
1053451147 9:38195192-38195214 ATGATCAGATGACAGTCAGCTGG + Intergenic
1055753378 9:79531380-79531402 ATGATCTTGGGCAAGTCAACTGG + Intergenic
1056211302 9:84367679-84367701 ATGATGGGGAGAAGGTCAGCAGG + Intergenic
1056270976 9:84947872-84947894 ATGCCCAGGAGCATGACAGCTGG - Intronic
1057404203 9:94753250-94753272 ATTATCAGGAGTAAGGAAGCTGG + Intronic
1061905959 9:133697824-133697846 AAGATCAGGAACAAGACAGGGGG + Intronic
1185809992 X:3099016-3099038 ATGATCAGGAGAAAGGAAGAGGG - Intronic
1186725139 X:12349363-12349385 GTGATCAAAAGCAAGTCACCTGG + Intronic
1186763916 X:12751094-12751116 ATGGCCAGCTGCAAGTCAGCTGG - Intergenic
1186930229 X:14381155-14381177 AGGATCAGCACCAAGGCAGCAGG - Intergenic
1190055183 X:47177354-47177376 GTGATCAGGAGCAAGGCACAGGG - Intronic
1191608290 X:63084731-63084753 ATGATCAGGAACAAGCCTTCAGG + Intergenic
1193287098 X:79725684-79725706 ATGATCAGGAGCAAGCCTTTAGG + Intergenic
1194494197 X:94590332-94590354 ATGCTGAGCAACAAGTCAGCTGG + Intergenic
1195371005 X:104172514-104172536 ATTATCAGCAGCAAGTAAACCGG - Intronic
1195373620 X:104203799-104203821 TTGATCAGAAGCAAGTCACTGGG - Intergenic
1196692888 X:118579689-118579711 AAGACAAGGAGCAAGTCACCAGG - Intronic
1198487844 X:137106287-137106309 TTGATTAGGAGCAAGTTACCAGG + Intergenic
1200293880 X:154898103-154898125 ATGCACAGGGGGAAGTCAGCAGG - Intronic