ID: 1118315196

View in Genome Browser
Species Human (GRCh38)
Location 14:64721787-64721809
Sequence GCACCCTAGGGGCTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118315196_1118315206 0 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315206 14:64721810-64721832 AGGGAGCAGTGGGAACACACAGG 0: 1
1: 0
2: 4
3: 41
4: 420
1118315196_1118315208 11 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315208 14:64721821-64721843 GGAACACACAGGCAAGAGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 358
1118315196_1118315210 19 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315210 14:64721829-64721851 CAGGCAAGAGCTGGGCCTCTGGG 0: 1
1: 0
2: 6
3: 39
4: 411
1118315196_1118315211 20 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315211 14:64721830-64721852 AGGCAAGAGCTGGGCCTCTGGGG 0: 1
1: 1
2: 6
3: 58
4: 410
1118315196_1118315213 30 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315213 14:64721840-64721862 TGGGCCTCTGGGGACAGTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 245
1118315196_1118315205 -10 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315205 14:64721800-64721822 CCTAGGGTGCAGGGAGCAGTGGG 0: 1
1: 0
2: 1
3: 40
4: 404
1118315196_1118315209 18 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315209 14:64721828-64721850 ACAGGCAAGAGCTGGGCCTCTGG 0: 1
1: 0
2: 10
3: 56
4: 434
1118315196_1118315207 10 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315207 14:64721820-64721842 GGGAACACACAGGCAAGAGCTGG 0: 1
1: 1
2: 2
3: 37
4: 438
1118315196_1118315212 29 Left 1118315196 14:64721787-64721809 CCCCAGGAGAGCCCCTAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1118315212 14:64721839-64721861 CTGGGCCTCTGGGGACAGTTTGG 0: 1
1: 1
2: 3
3: 32
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118315196 Original CRISPR GCACCCTAGGGGCTCTCCTG GGG (reversed) Intronic
903770976 1:25764129-25764151 GCATCCTGGGGGCTTGCCTGTGG + Intronic
905303735 1:37003716-37003738 CCACCCAAGGGGCTGTCTTGGGG - Intronic
906531457 1:46526266-46526288 CCACCCTAGGGGAGCTCCCGAGG - Intergenic
907827242 1:58030637-58030659 CCACCCCAGGGGCTTTTCTGAGG - Intronic
908510471 1:64846787-64846809 GCTCCCCAGGGGCTCTGTTGAGG + Intronic
910227486 1:84950877-84950899 GCATTTTAGGGGCTCTCCTGGGG - Intronic
912067433 1:105761566-105761588 GCCACCTAGGAGCTTTCCTGTGG - Intergenic
921196055 1:212759487-212759509 GGGGCCAAGGGGCTCTCCTGTGG - Intronic
922787139 1:228288512-228288534 GCACCCTGGGACCTGTCCTGTGG + Intronic
923756468 1:236795503-236795525 GCGCCCTAGGGCCTCTCTCGGGG - Exonic
924653082 1:245948466-245948488 GACCACAAGGGGCTCTCCTGTGG - Intronic
1065046736 10:21752590-21752612 GCACCACATGGGCCCTCCTGGGG + Intergenic
1071004715 10:80869579-80869601 TCACATTAGGGGCACTCCTGAGG + Intergenic
1072563974 10:96602302-96602324 GCACCCTGGGGGGTCTCTCGAGG + Exonic
1073006018 10:100325369-100325391 GCACCGAAGTGGCCCTCCTGAGG + Intronic
1073052995 10:100681255-100681277 GATCCCCAGGGGGTCTCCTGTGG - Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1074382955 10:112995147-112995169 GCAGCCCAGGGGTTCCCCTGAGG - Intronic
1074493669 10:113960280-113960302 GCACCCACGGAGCTCCCCTGGGG - Intergenic
1075718634 10:124572016-124572038 ACACCCAAGGGGCTCTGCAGTGG - Intronic
1075871366 10:125774280-125774302 GCGCCCTTGGGGGTCTCCGGCGG + Exonic
1076006152 10:126949278-126949300 ACAGCTTAGGGGCTGTCCTGCGG - Intronic
1076170113 10:128312124-128312146 GCACCCTGGGGGCTGTTTTGAGG + Intergenic
1076450248 10:130552173-130552195 GCAACATAGGGGCTCTGCTGTGG + Intergenic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1077077538 11:708317-708339 GGACCCTAGGGGCTTCCCGGGGG - Intronic
1077533188 11:3106835-3106857 GCACACCTGGTGCTCTCCTGGGG - Intronic
1083655980 11:64229944-64229966 GGACCCTAGGGCCGCTCCAGTGG - Exonic
1083782452 11:64925386-64925408 GCAGCCTCCCGGCTCTCCTGAGG + Intronic
1089666803 11:120025826-120025848 GCACCGTAGGAGCTCTTCTCTGG + Intergenic
1090866379 11:130704315-130704337 CCACCCTAGTGGCTCCTCTGTGG - Intronic
1096631120 12:52927361-52927383 CCACCCTTGGGCCTCCCCTGGGG + Intronic
1098130478 12:67344995-67345017 GCACACCAGGGCCTGTCCTGTGG - Intergenic
1101334599 12:103785075-103785097 GCCTGCTAGGAGCTCTCCTGTGG - Intronic
1106773607 13:32986779-32986801 GCGCCCATGGGGCTATCCTGGGG + Intergenic
1109452317 13:62533125-62533147 GCAGCCTAGAGAATCTCCTGAGG + Intergenic
1111976090 13:94968267-94968289 ACACCGCAGGGCCTCTCCTGGGG + Intergenic
1118315196 14:64721787-64721809 GCACCCTAGGGGCTCTCCTGGGG - Intronic
1118437103 14:65781705-65781727 ACAGCCCATGGGCTCTCCTGGGG - Intergenic
1118738095 14:68716854-68716876 GCTCCCTGCGGGCTCTCCTAGGG - Intronic
1120967955 14:90184290-90184312 GCATCCTTCAGGCTCTCCTGGGG - Exonic
1121570518 14:94943337-94943359 GCCCCCTCGGGGCTATCATGAGG + Intergenic
1122067835 14:99185794-99185816 GCTCCCGAGGTGCTTTCCTGGGG + Intronic
1122218804 14:100222254-100222276 CCACCCCTGGGGCTCCCCTGTGG - Intergenic
1122865869 14:104603737-104603759 GCACCCTGGGGGCCCTCTGGGGG - Intronic
1123995127 15:25713076-25713098 GGAGCCTAGGGGCCCTGCTGAGG - Intronic
1124014053 15:25861841-25861863 TCTACCAAGGGGCTCTCCTGGGG + Intronic
1126094928 15:45081277-45081299 GCACCCTAGGGTATCTCTGGTGG - Intergenic
1129336037 15:74852766-74852788 ACACCTAAGGGGCTGTCCTGGGG - Intronic
1131151281 15:90048885-90048907 GCAACCCAGGGGCTCCCGTGTGG + Intronic
1132552666 16:559915-559937 GGCCCCTGGGGGCTGTCCTGGGG - Intergenic
1132850273 16:2021879-2021901 CCACCCTTGGAGCCCTCCTGTGG + Intergenic
1132889830 16:2197973-2197995 GAAGCCAAGGGGCTCACCTGGGG + Intergenic
1133343804 16:5056482-5056504 GCACCAGAGGGGCTCTCGTAGGG + Intronic
1135899440 16:26443348-26443370 GCACCCTCCAGGGTCTCCTGGGG - Intergenic
1136248567 16:28989221-28989243 CCAGCCTAGGGGCTGTGCTGGGG + Intronic
1141198983 16:81882833-81882855 GGACCAGAGGGGCTTTCCTGAGG - Intronic
1141446417 16:84061540-84061562 GCATCCCAGAGGCTCTCCTGGGG + Intronic
1142963724 17:3567561-3567583 GCAGGCGATGGGCTCTCCTGAGG - Intronic
1143574207 17:7780494-7780516 GCACTCTATGGATTCTCCTGAGG - Intronic
1144863267 17:18319005-18319027 GCACCCTGGAGGGTCCCCTGCGG + Intronic
1145780015 17:27556789-27556811 GCACCCTAGAGGGATTCCTGAGG - Intronic
1150124750 17:62628596-62628618 GCACACTAGTGGCCCTCCAGAGG + Intronic
1151049784 17:70964446-70964468 GCATCCTAGGGGCTCTCTGGAGG - Intergenic
1152562099 17:81083680-81083702 GCACTCTGGGGGCGCTTCTGGGG + Intronic
1152613812 17:81328887-81328909 GCCCCCAAGGGGCTCTGATGGGG + Intronic
1155751789 18:29433262-29433284 GCTCCCCAGGTGATCTCCTGGGG - Intergenic
1157624729 18:49041871-49041893 GCAGCCCAGGGACTGTCCTGTGG + Exonic
1159118206 18:64139390-64139412 GCACCAAAGTGGCTCTCCTAGGG - Intergenic
1162935818 19:13980952-13980974 GCACCCCTGAAGCTCTCCTGGGG + Intronic
1163643045 19:18472672-18472694 CCAGCCAAGGGGCTATCCTGGGG + Intronic
1164599167 19:29549448-29549470 GCAGCGTTGGGGCTCTCCTGGGG - Intronic
1165766542 19:38354944-38354966 TCAGCCTAGGGGCCCTCCTCAGG - Intronic
1167119427 19:47507780-47507802 GCACCCAAAGGGCTCTCGTGAGG - Intronic
1167713336 19:51125472-51125494 TCACCCTAAGCCCTCTCCTGGGG - Intronic
925756527 2:7138276-7138298 ACACCCTAGGGCCTGTCATGGGG + Intergenic
927717297 2:25360915-25360937 GCACCTGAGGGACTGTCCTGAGG + Intergenic
929124777 2:38513163-38513185 GCATCCTAGAGGCTCCACTGTGG + Intergenic
929552603 2:42903977-42903999 GCCCCATGGGGGCTCCCCTGGGG + Intergenic
929995818 2:46825744-46825766 CCACCCTTGGGCCTCTCCTCTGG + Intronic
931138086 2:59426979-59427001 TCACCCTAGGTGGTCTGCTGGGG - Intergenic
931885211 2:66609803-66609825 ACACCCTGGGGCCTGTCCTGGGG - Intergenic
933808747 2:86018741-86018763 CCAGCCTTGGGGCTTTCCTGCGG - Intergenic
934550717 2:95259928-95259950 GCTCCCCAGGAGCACTCCTGTGG - Intergenic
935085138 2:99837742-99837764 GCACCCCAGAGGCTCAACTGTGG + Intronic
937824744 2:126356402-126356424 GCATCCCTGTGGCTCTCCTGTGG + Intergenic
938379238 2:130827337-130827359 GGACCCTGGGGGCTCAGCTGAGG - Intergenic
943314405 2:186369276-186369298 GCAGCTTAGGGTCTCTCATGAGG + Intergenic
944227225 2:197360026-197360048 GGCCCCTAGGGGCCCTTCTGGGG - Intergenic
945175770 2:207041674-207041696 CCCCCATAGGAGCTCTCCTGCGG + Intergenic
947719923 2:232364015-232364037 GGAGCCTGTGGGCTCTCCTGAGG - Intergenic
948049625 2:234969709-234969731 GCATCCTAGGGGCCCACCAGAGG - Intronic
948703402 2:239774874-239774896 GCAGCCTAGAATCTCTCCTGAGG - Intronic
948708616 2:239811255-239811277 GCCCCCTTGGAGCTCTTCTGAGG + Intergenic
1168878321 20:1185744-1185766 GCGCAATAGGGGCTCTCCGGTGG - Intronic
1171225635 20:23439943-23439965 GCACTGTAGGGGCTGTTCTGGGG + Intronic
1172630992 20:36378051-36378073 CTTCCCCAGGGGCTCTCCTGGGG - Intronic
1173924677 20:46771811-46771833 GCTGCCTGGTGGCTCTCCTGAGG - Intergenic
1174292579 20:49519517-49519539 GCATCCCTGGGGCTCTCCAGTGG - Intronic
1176032028 20:63017335-63017357 GCCCACTGAGGGCTCTCCTGAGG - Intergenic
1178840679 21:36135507-36135529 GCACCCTCGGAGCGCTCCAGGGG - Intronic
1179631565 21:42681926-42681948 GCAGCCTAGGGGTCCTCCCGTGG + Intronic
1180151053 21:45948113-45948135 GGACCCTAGCCCCTCTCCTGAGG + Intergenic
1183308291 22:37095771-37095793 TCACCTGGGGGGCTCTCCTGGGG + Intronic
1183587052 22:38758857-38758879 GCACCCTTGGGGATCTGATGTGG + Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184249555 22:43252430-43252452 GCATCCGAGCCGCTCTCCTGAGG + Intronic
1185311777 22:50160098-50160120 GGGTCTTAGGGGCTCTCCTGCGG - Intronic
952898728 3:38095995-38096017 CCACCTTGGGGGTTCTCCTGGGG + Intronic
955895966 3:63700208-63700230 ACACCCTGGGGCCTGTCCTGGGG + Intergenic
961035341 3:123637981-123638003 GCAGCCTGGGGACCCTCCTGTGG + Intronic
962847727 3:139286350-139286372 GCTCCCGAGGGGCACACCTGTGG + Intronic
967937337 3:194739476-194739498 CCACCCTAGAGGCTCCACTGGGG + Intergenic
968786547 4:2626231-2626253 GCACCCTAGGAGCTGTGCTGGGG + Intronic
969318994 4:6399659-6399681 GCAGCCTTGGGCCTCTCCTAGGG - Intronic
969530016 4:7725405-7725427 TCACCCTTGGGCCCCTCCTGGGG + Intronic
972285862 4:37647540-37647562 GCACCATGGGTGATCTCCTGAGG - Intronic
972809012 4:42562375-42562397 TGACCTTAGAGGCTCTCCTGGGG + Intronic
976423837 4:84877227-84877249 GCACCCTGAGCCCTCTCCTGGGG + Intronic
977013627 4:91664079-91664101 GTAGCCAAGGTGCTCTCCTGTGG + Intergenic
979555556 4:122042698-122042720 GCAGCCGAGTGGCTCACCTGGGG + Intergenic
980283455 4:130752766-130752788 GCATCCTCTGGACTCTCCTGGGG - Intergenic
981000542 4:139825006-139825028 GCTGCCTAGGGGCTGCCCTGAGG - Intronic
981460706 4:145010655-145010677 GCACCCTGGGGCCTGTCGTGGGG + Intronic
985286787 4:188344384-188344406 GCGCTCTAGGGGCTCTGCTGAGG - Intergenic
985539118 5:479654-479676 GAATCCCAGGGGCTCTCGTGGGG - Intronic
988617817 5:32792571-32792593 GCTCCCTAGGGCCTCTTCAGTGG - Intergenic
993466447 5:88252715-88252737 GCACCCAAGGTGCTTTCCTTGGG - Intronic
1000019904 5:157309969-157309991 GCACCCTCGCGGCTCCCCTCCGG - Intronic
1001117939 5:168955323-168955345 GCTCCCTAGAGGCTCTCCCAAGG + Intronic
1001559370 5:172659298-172659320 GCCCCGCAGGTGCTCTCCTGGGG + Intronic
1001797729 5:174515959-174515981 GCATCCCAGAGGGTCTCCTGAGG + Intergenic
1002167485 5:177357562-177357584 CCACCCTGGGGGCGTTCCTGTGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1014833221 6:126127188-126127210 CCATCCTAAAGGCTCTCCTGAGG - Intergenic
1016038994 6:139412469-139412491 GCACACTGGGGCCTGTCCTGGGG + Intergenic
1017775896 6:157680629-157680651 GTAAGCTTGGGGCTCTCCTGGGG - Intergenic
1017948841 6:159118499-159118521 GCTCCCTAGTGGCCCTCCAGTGG + Intergenic
1018017942 6:159728043-159728065 CCTCCCTTGGGCCTCTCCTGAGG + Intronic
1018793703 6:167170090-167170112 GCACACCTGGGGCTCCCCTGAGG - Intronic
1018822630 6:167384991-167385013 GCACACCTGGGGCTCCCCTGAGG + Intergenic
1023365555 7:39459863-39459885 GCACCAAAGGAGCTTTCCTGTGG + Intronic
1024481324 7:49866398-49866420 GCTCACTTAGGGCTCTCCTGTGG + Intronic
1028832833 7:95345193-95345215 GGACCCTAGTGGCTCTACTGGGG - Intergenic
1030007686 7:105134748-105134770 GCTCCCTAGGGGGGCTCCAGAGG + Intronic
1032549525 7:132771587-132771609 GCACCCTGGTGGCCCACCTGGGG + Intergenic
1033279470 7:139995533-139995555 GCACCTTGGGGTCTCTCGTGTGG + Intronic
1035690804 8:1558112-1558134 GCATCCTGGGGGCTCCCATGTGG + Intronic
1037832940 8:22199728-22199750 GCACCCTATGAGCCATCCTGGGG - Intronic
1049657027 8:143803555-143803577 GCCCCCGTGGGGCTCACCTGTGG + Exonic
1049682636 8:143926502-143926524 GCAGCCTAGCGGCCGTCCTGTGG - Intronic
1049709418 8:144056931-144056953 GCACCCTGGGAGCCCACCTGGGG + Exonic
1052733548 9:32317315-32317337 ACACCCTAGAGGTTCTCCAGGGG - Intergenic
1060349360 9:122844186-122844208 CCACCCAAGGCGTTCTCCTGAGG + Intergenic
1061076670 9:128345544-128345566 GCCCCCTTGGGGCTCACCTGAGG - Exonic
1061373065 9:130208737-130208759 ACACACTGGGGGCTTTCCTGCGG + Intronic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062184640 9:135211480-135211502 GCACCCAGGGGGGGCTCCTGTGG - Intergenic
1062522203 9:136962759-136962781 CCACCCCAGGGGCTCTCCTGAGG + Intergenic
1188123645 X:26339935-26339957 GCACACCAGGGCCTGTCCTGGGG + Intergenic
1190816681 X:53935742-53935764 TCACCCTGGGAGCTCTCCTTAGG + Intergenic
1197638359 X:128941598-128941620 GCAAGCTAGGGGATGTCCTGTGG - Intergenic