ID: 1118315239

View in Genome Browser
Species Human (GRCh38)
Location 14:64722045-64722067
Sequence GGATTCCGAAAGTGCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118315234_1118315239 -1 Left 1118315234 14:64722023-64722045 CCTTCTGGCACCCTTTTTGAAGG 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1118315239 14:64722045-64722067 GGATTCCGAAAGTGCCGTCTTGG 0: 1
1: 0
2: 1
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118315239 Original CRISPR GGATTCCGAAAGTGCCGTCT TGG Intronic
916000742 1:160612771-160612793 GGACTCCCCAAGTGGCGTCTTGG + Intronic
920601699 1:207331819-207331841 GGATTCTGAGAGTACCTTCTGGG - Intronic
920739278 1:208564803-208564825 GAATCCCGAAAGTCCCTTCTGGG - Intergenic
924172587 1:241357268-241357290 GGCGTCCGAAGGTGCCGGCTCGG + Intergenic
1063781204 10:9327340-9327362 GCATTCTGAAAGTGGGGTCTGGG - Intergenic
1081348298 11:42017654-42017676 GGACACAGAAAGTGCCATCTGGG - Intergenic
1090475550 11:127016909-127016931 TGCTTCCGAAAGTGCTGGCTTGG - Intergenic
1095129440 12:38521676-38521698 GGAATCTGAAAGTGTCCTCTAGG - Intergenic
1103392130 12:120582085-120582107 TGGTTCTCAAAGTGCCGTCTGGG + Intergenic
1104033242 12:125080165-125080187 GGATTACGAAAGAGGCGACTGGG - Intronic
1108675024 13:52729188-52729210 GGATTTCTAAAGTGCCCTCTTGG - Intronic
1118315239 14:64722045-64722067 GGATTCCGAAAGTGCCGTCTTGG + Intronic
1128674117 15:69596196-69596218 GGCTTCAGAAAGTGGCATCTTGG + Intergenic
1129811140 15:78511058-78511080 GGCTTCCCAAAGTGCTGGCTGGG + Intronic
1142726819 17:1821461-1821483 GGAGTGCAATAGTGCCGTCTTGG - Intronic
1147427667 17:40353814-40353836 GGATGCAGGAGGTGCCGTCTGGG + Intronic
1151268072 17:72971838-72971860 GGATTCCAAATGAGCCATCTGGG + Intronic
1157324309 18:46657732-46657754 GGCTTCCGGAAGTGGCCTCTGGG + Intergenic
1157794042 18:50559463-50559485 GGATTCCGAGCGGGCCGCCTGGG - Intergenic
926581539 2:14635404-14635426 GGAATCCCGAAGTGCTGTCTTGG - Exonic
937126270 2:119476813-119476835 GGAGTCAGAAAGTGGAGTCTGGG + Intronic
947588120 2:231369645-231369667 GGAGTGCAACAGTGCCGTCTTGG + Intronic
1176419680 21:6504101-6504123 GGAGTGCGATAGCGCCGTCTCGG - Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1178254223 21:31036642-31036664 TGATTTCAAAAGTGCCTTCTAGG - Intergenic
1179695173 21:43112424-43112446 GGAGTGCGATAGCGCCGTCTCGG - Intergenic
951263191 3:20536306-20536328 GGAGTACAACAGTGCCGTCTCGG + Intergenic
955145460 3:56313935-56313957 GGATTCCTAAAGTACCCTTTAGG + Intronic
970639760 4:18051106-18051128 TGATTTCGAAAGTGCCATATGGG + Intergenic
975768707 4:77697853-77697875 GGAATCAGAAAGTGACATCTGGG - Intergenic
977308466 4:95354735-95354757 GGCTTCCCAAAGTGCTGTCTGGG + Intronic
995928229 5:117401963-117401985 GTATTCCAAAACTGCCATCTGGG + Intergenic
998183646 5:139962538-139962560 GGATTCCCAAAGTGCAGTCTGGG - Intronic
999941073 5:156543755-156543777 GGTTTCTGAAACTGCAGTCTTGG - Intronic
1018609102 6:165629582-165629604 GGAGTGCGATGGTGCCGTCTCGG + Intronic
1029418211 7:100456751-100456773 GGATGCCCAAAGTCCCCTCTAGG - Exonic
1032564349 7:132926210-132926232 GGATTCCAAACTTGCTGTCTTGG - Intronic
1041507431 8:58615336-58615358 GTATTCCATAAGTGCCGTATGGG - Intronic
1043923866 8:86014992-86015014 GGAGTCCCAAAGTTCCTTCTTGG + Intronic
1044624188 8:94220106-94220128 GTATTTAGACAGTGCCGTCTGGG - Intergenic
1044965477 8:97569840-97569862 GGTTTCCGTAAGTGCAGTTTAGG - Intergenic
1061131306 9:128709699-128709721 GGATTCCAATGGTGCCATCTTGG - Intronic
1061426446 9:130501443-130501465 GGAATCCAGAAGTGCCGCCTGGG + Intergenic
1187742988 X:22376127-22376149 GGATGCCGAAAAGGCCTTCTGGG - Intergenic
1191829593 X:65401997-65402019 GGATTCCAAGAGTGCCCACTTGG - Intronic
1192148851 X:68699478-68699500 GGGTTCCGAGTGTGCCCTCTGGG + Intronic
1196984474 X:121253412-121253434 TGAGTCCAAAAGTGCTGTCTGGG + Intergenic