ID: 1118315605

View in Genome Browser
Species Human (GRCh38)
Location 14:64724083-64724105
Sequence GTGGTGCTCTTCAGGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118315600_1118315605 6 Left 1118315600 14:64724054-64724076 CCTGGCTTGGGGGAATCTTATAG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 162
1118315595_1118315605 19 Left 1118315595 14:64724041-64724063 CCTGAGTTCTCATCCTGGCTTGG 0: 1
1: 0
2: 6
3: 50
4: 492
Right 1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118315605 Original CRISPR GTGGTGCTCTTCAGGTAGGA AGG Intronic
900465408 1:2822836-2822858 GTTGTGCTCTCCAGACAGGAGGG + Intergenic
902826789 1:18980076-18980098 TTGGACCTCTTCAGCTAGGAAGG + Intergenic
903002921 1:20279176-20279198 GTGGTGCTGTCCAGCTAGCATGG - Intergenic
903617196 1:24669240-24669262 GTGATGCTCTTCGTTTAGGAGGG - Exonic
904041659 1:27588878-27588900 GTTGTGCACTTCTGCTAGGAGGG + Intronic
906156892 1:43619189-43619211 GTGGTGCACTGCAGGTGAGAGGG + Exonic
907302764 1:53498809-53498831 GTGGGGGTCTCCAGCTAGGAAGG - Intergenic
908748037 1:67394785-67394807 GTGGTGTTTTCCAGGTAGGGAGG - Intronic
912555854 1:110515550-110515572 ATGGTGCAGTTCTGGTAGGAAGG - Intergenic
912783400 1:112574762-112574784 GTGGTTACCTTTAGGTAGGAAGG + Intronic
914694617 1:150065761-150065783 GTGGTTTTCTTCAGGAAGGAAGG + Intergenic
917840424 1:178973114-178973136 GAGGAGCTCTTCAGGTAGAGAGG + Intergenic
920756724 1:208739986-208740008 GTGGCGCTCCTCAGGGAGGCTGG - Intergenic
922626533 1:227051249-227051271 GAGCTGATCTTAAGGTAGGATGG + Intronic
924052710 1:240093355-240093377 GTGGTGGTCTTGATGTAGCAGGG - Exonic
1069685090 10:70312794-70312816 TCGGTGCTCTCCAGGGAGGAGGG + Intronic
1070916482 10:80158349-80158371 GTGCTGCTGCTCAGGCAGGAGGG + Intronic
1077153888 11:1083077-1083099 GTGGTGGTCTTCAAGTCCGATGG + Intergenic
1082705120 11:56485133-56485155 GTAGTGCTCTTGAGATGGGAAGG - Intergenic
1083299429 11:61732599-61732621 CTGGTGCTCTGCAGACAGGAGGG + Intronic
1084107456 11:66989101-66989123 GTGGTGCTCGTCGGGGAGGCTGG - Intergenic
1085486491 11:76868131-76868153 AGGTTGCTCTTCAGGGAGGATGG - Intronic
1089681323 11:120120512-120120534 GTGGGGCTGTGCAGGCAGGAGGG - Intronic
1092913113 12:13165600-13165622 TTGGTGCTCTTCAGCTTGCAGGG + Intergenic
1096431329 12:51545615-51545637 GAGGTGCTCTTCCAGAAGGAAGG - Intergenic
1097261142 12:57720855-57720877 GTGGGGCTCTCCAGGTGGGGAGG + Exonic
1101119185 12:101561696-101561718 GTGGTACTATTCTGGGAGGAGGG - Intergenic
1101902287 12:108799695-108799717 GAGATGCTCTTCAGACAGGAGGG + Intronic
1102909964 12:116705864-116705886 GTGGTTGTCTACAGGTAGAAAGG + Intergenic
1103200008 12:119080160-119080182 GTGGTTCTACTCAGGGAGGAAGG + Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1104442830 12:128808829-128808851 GCGATCCTCTTCAGGGAGGATGG + Exonic
1104870889 12:131994577-131994599 GTGGGGCTCTGCAGGAAGGTAGG + Intronic
1105037799 12:132939062-132939084 GTGGTGCTCGTCAGGGAGGCTGG - Intronic
1105746659 13:23383502-23383524 CTGGGGCTGTTCAGGAAGGAGGG - Intronic
1107050195 13:36038623-36038645 GTGATGCTATTCAGGTAGGTGGG + Intronic
1107426900 13:40303217-40303239 GTGGTGCTCTTTAAGGAGTAGGG + Intergenic
1108643931 13:52408127-52408149 GTGGTGCTCGTCAGGGAGCTCGG + Intergenic
1113291524 13:108911826-108911848 GTTATGCTCTGAAGGTAGGAAGG + Intronic
1113648844 13:112019302-112019324 GTGGGGCTCCTTATGTAGGATGG - Intergenic
1113862708 13:113500118-113500140 GTGGTGATCTGCACGTGGGATGG - Exonic
1114587996 14:23832435-23832457 GTAGTGCTCTTCAGGTTTGGGGG + Intergenic
1117555390 14:56878326-56878348 GTGGTGCCCTGCAAGTGGGAAGG + Intergenic
1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG + Intronic
1121844529 14:97161037-97161059 ATGGTGCTATTCAGTTAGAATGG + Intergenic
1126067672 15:44838409-44838431 GTGGTGGTTTTCAGCCAGGATGG - Intergenic
1126092207 15:45062473-45062495 GTGGTGGTTTTCAGCCAGGATGG + Intronic
1129608280 15:77035334-77035356 GAGGTGCCCCTCAGGCAGGAGGG - Intronic
1130955704 15:88626059-88626081 GTGGTGCACTGCAGGGAGGGAGG + Intronic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132501089 16:284998-285020 GTGGTTCTCTTCAAGAAGGTAGG + Exonic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134824121 16:17270807-17270829 GTGGTGCTTTTGTGCTAGGACGG + Intronic
1135983115 16:27164010-27164032 GTGGTGCTCTGCAGCAGGGAAGG + Intergenic
1138329364 16:56201123-56201145 CTCTTGCACTTCAGGTAGGAAGG + Intronic
1140250857 16:73293110-73293132 GTGTTCCTCTTCTGGTAGGTTGG - Intergenic
1142119580 16:88379387-88379409 GGGGTGCTCTGCAGGGAGCAGGG - Intergenic
1143167519 17:4904508-4904530 GTGTTCCTCGTGAGGTAGGAGGG + Intergenic
1143200410 17:5109484-5109506 TTGGAGCTCCTCAGGCAGGATGG + Exonic
1143509545 17:7387942-7387964 GAGGTGCTCTTCAGAAGGGAAGG - Intronic
1144723251 17:17486662-17486684 GTGGTGCTCGTCAGGGAGGCTGG - Intronic
1147375702 17:40021507-40021529 GGTGTGCTCTTTAGGCAGGAAGG + Intronic
1147743174 17:42680094-42680116 GCGCTGCTCTTCAGCCAGGATGG - Exonic
1149512282 17:57253824-57253846 CTGGAGCTCTTCAGGAAGGGTGG + Intergenic
1150358082 17:64505651-64505673 CTGGTGCTGTTGGGGTAGGAGGG - Intronic
1152116102 17:78388273-78388295 GTGGGTCTCCGCAGGTAGGACGG + Intronic
1152667430 17:81579451-81579473 GGGGTGTTGTCCAGGTAGGAGGG - Intronic
1152740007 17:82014669-82014691 GTGGTGCTGTTCTCGTTGGAGGG + Intronic
1155318201 18:24593121-24593143 TTGGTTCCCTTCAGGGAGGAAGG + Intergenic
1158169812 18:54585097-54585119 GTGGTCCTCCTCAGGTGTGAGGG + Intergenic
1158697216 18:59714144-59714166 GTGGTGCTCGTCAGGGAGGCTGG + Intergenic
1160396541 18:78576458-78576480 ATGGCACTCTTCAGGTGGGAGGG + Intergenic
1161062094 19:2220265-2220287 CTGCTGCTCTTCAGGCAGGAGGG + Intronic
1163103158 19:15109482-15109504 TTGGTGCTCCTCTGGGAGGAGGG - Intronic
1168472524 19:56651031-56651053 GTGGTTGTCTGCAGGAAGGAGGG - Intronic
925139424 2:1539750-1539772 GTGGTCCTCTTCAGGCAGGCGGG + Intronic
927073802 2:19556463-19556485 TTGCTGCTCTTCAGAAAGGAGGG - Intergenic
928599276 2:32887180-32887202 GAAGTGCTCTTAAGGGAGGAAGG + Intergenic
932866042 2:75344129-75344151 CTGGTGCCCATCATGTAGGAAGG + Intergenic
937746641 2:125422557-125422579 GTGGTGCTCGTCGGGAAGGCTGG - Intergenic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
941763024 2:169265319-169265341 CTGGTGAGCTTCAGGCAGGAAGG - Intronic
946804502 2:223457788-223457810 GCAGTGCTCCTCATGTAGGATGG + Intergenic
948917461 2:241042129-241042151 ATGGTGCTCCTGAGGCAGGAGGG + Intronic
1168930599 20:1620262-1620284 TTGGTGCTCTTAAGCCAGGAAGG + Intergenic
1170700573 20:18699552-18699574 GAGGTGGTCATCAGGGAGGATGG + Intronic
1172492072 20:35347554-35347576 GTGGTTCCCTCCAGGTATGAGGG - Intronic
1174061137 20:47833876-47833898 GTGGTGCTGTTCATGTCTGAGGG - Intergenic
1174070639 20:47896823-47896845 GTGGTGCTGTTCATGTCTGAGGG + Intergenic
1176139982 20:63540753-63540775 TTGGCGCTCTGCAGGGAGGAGGG + Intergenic
1178405566 21:32320489-32320511 GAGGTGCGCGTCAGGTGGGAAGG - Intronic
1178587817 21:33884723-33884745 GTGCTGCTCTTCGGTAAGGAAGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179986939 21:44927426-44927448 GGGGTGCTCTCCAGGCAGGAAGG - Intronic
1181114336 22:20621669-20621691 TTGGTGGCCTTGAGGTAGGAAGG - Intergenic
1183823477 22:40366160-40366182 GTGGTGATTTTTAGGTTGGATGG + Intronic
1184726720 22:46351501-46351523 GGCGTGCTCTTCAGGGAAGATGG - Intronic
1184879491 22:47295946-47295968 GTGTTGCTCTTTAAGGAGGAGGG - Intergenic
949138997 3:608986-609008 GTGGTGCTCATGAGGTATCAAGG + Intergenic
953414341 3:42707068-42707090 GAGGTGATCTTGAGGAAGGATGG + Intronic
954759074 3:52861036-52861058 GTGGTGCTTTGCAGGATGGAGGG + Intronic
955186468 3:56719241-56719263 GTGGTGCTCATCGGGGAGGCTGG - Intergenic
957560124 3:81812060-81812082 GTGGCGCTCGTCAGGGAGGCTGG + Intergenic
959377044 3:105600374-105600396 GTGGTTTTTTTCAGGTAGGCAGG - Intergenic
961058735 3:123810648-123810670 GTCGTGCTCCTCAGGTAGGCAGG + Intronic
961192472 3:124973535-124973557 GTGTTGCTATTGAGGTATGAAGG - Intronic
969262199 4:6041097-6041119 GTGATGCAATTCAGGCAGGAAGG - Intronic
970746649 4:19306287-19306309 GTGGTGGTGTTAAGGTATGAGGG + Intergenic
971811996 4:31438961-31438983 GTGGTGCTCATCGGGGAGGCTGG - Intergenic
972119709 4:35685234-35685256 GAAGTGCTCTTCAGGTGGAAGGG - Intergenic
975501340 4:75088499-75088521 GTGGTTTTCTTCAGGCAGGAAGG - Intergenic
978401657 4:108337398-108337420 GTGGGGCTCTTCAGGAAGAAAGG - Intergenic
978727621 4:111988161-111988183 GTGGTATGCTTGAGGTAGGAGGG + Intergenic
981712734 4:147724979-147725001 CTGGTGCTGAGCAGGTAGGATGG + Intergenic
981759343 4:148176316-148176338 GAGGTGGTCTGCAGGTAGGAAGG + Intronic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
984373700 4:178899855-178899877 GTGGCGCTCATCAGGATGGATGG + Intergenic
984552278 4:181174930-181174952 GTGGTGCTCTGCTCGCAGGAGGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
986540289 5:8838307-8838329 ATGGTGCTCTCCAGGTAGTTAGG + Intergenic
999401703 5:151269309-151269331 GTGGGGCTCTTTTGGTTGGAAGG + Exonic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1004499999 6:16200785-16200807 ATGGTGCACTTCAGGGAGGTTGG + Intergenic
1005032365 6:21522990-21523012 GTGATGCTATGCAGCTAGGATGG - Intergenic
1005675336 6:28148709-28148731 CTGGAGCTCCTCAGGTAGGATGG - Exonic
1005700719 6:28398097-28398119 CTGGAGCTCCTCAGGTAGGATGG + Exonic
1005719370 6:28586391-28586413 CTGGAGCTCCTCAGGCAGGATGG + Exonic
1006006903 6:31009994-31010016 GTGCTGCTCTGCAGCTGGGAAGG + Intergenic
1006311472 6:33264212-33264234 GTGGTGCACTGTGGGTAGGAGGG - Intronic
1006864803 6:37200688-37200710 GAGGTGCTCACAAGGTAGGAGGG - Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1008195176 6:48510059-48510081 GTAGGGCTCTTCTGGTAAGAGGG - Intergenic
1013990543 6:116250629-116250651 GAGGTGCTCTCCAGGGAAGAGGG - Exonic
1014433815 6:121399677-121399699 GTGACTCTCTTCAGGAAGGAAGG - Intergenic
1016217249 6:141618524-141618546 GCGGTGCTCGTCAGGGAGGCTGG - Intergenic
1017711985 6:157178295-157178317 GTGGTGCTCTGCATGCTGGAGGG - Intronic
1021937462 7:25645591-25645613 GTGGAGCTCTGCTGGTAGGCAGG - Intergenic
1022602314 7:31772963-31772985 GTGATGCTCCTGAGGCAGGAAGG + Intronic
1029291677 7:99506343-99506365 CTGGAACTCTTCAGGCAGGATGG - Exonic
1033328332 7:140398024-140398046 GGGATGCTTTTCAGGTAGGTGGG - Intronic
1034080039 7:148268218-148268240 GTGGTGATGTACAGGTGGGAGGG + Intronic
1034341960 7:150363127-150363149 TTGGTGCTCTCCAGCTGGGAAGG + Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034655995 7:152730326-152730348 GTGGTGCTCGTCGGGGAGGCTGG + Intergenic
1035687139 8:1532908-1532930 GTGGTGCTCGGCAGGTGGAAAGG - Intronic
1035693884 8:1578903-1578925 GTGGTGCTCTGCACGTGGGCAGG - Intronic
1036210264 8:6835269-6835291 GACGTGCTCTGCAGGTGGGATGG + Intronic
1036274679 8:7340031-7340053 GAGGTGCTCCACAGGCAGGAAGG - Intergenic
1036346674 8:7970315-7970337 GAGGTGCTCCACAGGCAGGAAGG + Intergenic
1036841997 8:12131069-12131091 GAGGTGCTCCACAGGCAGGAAGG + Intergenic
1045826412 8:106403477-106403499 GTGGAGCTCTTCAAGAATGATGG + Intronic
1047665531 8:127087066-127087088 GTGATGCTCTTCGTTTAGGAGGG + Intergenic
1048706717 8:137161848-137161870 GTGGTCCTCTTCTGGCAGCATGG - Intergenic
1049040494 8:140109207-140109229 CTGGTGCTCAGCAGGTAGGGGGG - Intronic
1050920656 9:11197175-11197197 GTGGTGCTCGTCGGGGAGGCTGG - Intergenic
1056751821 9:89357536-89357558 GTGGGGATCTTCAGCTATGATGG + Exonic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057383623 9:94589701-94589723 GGGGTGCTGTTCAGGGAAGAGGG - Intronic
1057495229 9:95555215-95555237 TAGGAGCTCTTCAGGTTGGATGG + Intergenic
1058751152 9:108039475-108039497 GTGCTGCTCTTCGGGTAGCAGGG + Intergenic
1060554553 9:124501564-124501586 GTGGTGCTCAGCAGGGATGATGG + Intronic
1185629745 X:1507451-1507473 GTGATGATTTTCAGCTAGGAAGG - Intronic
1186715900 X:12251201-12251223 TTGGTGCTTTCCAGGTAGGGCGG + Intronic
1187904055 X:24050001-24050023 GTGGTGCTCCTCGGGGAGGCTGG - Intergenic
1190598113 X:52066372-52066394 GTGATGCTCTCCAGGTGGGTGGG + Exonic
1190610711 X:52187701-52187723 GTGATGCTCTCCAGGTGGGTGGG - Exonic
1192435433 X:71140727-71140749 CTGCTGCTGCTCAGGTAGGATGG - Exonic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1193254728 X:79334168-79334190 GGAGTGCTCTTCATGTGGGATGG + Intergenic
1196479354 X:116127540-116127562 GTGGAGCACTTTAGGTAGAATGG - Intergenic
1196827230 X:119750873-119750895 GTGGTGCTCGTCGGGGAGGCTGG + Intergenic
1197505304 X:127295008-127295030 GTGGTGTTCAGCAGATAGGAAGG + Intergenic
1198626795 X:138584617-138584639 GTGATGCTGTTCAGGGAGAAGGG - Intergenic
1199953793 X:152726242-152726264 GTGGGTTTCTTCAGGTAGGCGGG + Intergenic
1202275683 Y:23117243-23117265 GAGGCGCACTTCAGGCAGGAGGG + Intergenic
1202290345 Y:23303448-23303470 GAGGCGCACTTCAGGCAGGAGGG - Intergenic
1202428675 Y:24750962-24750984 GAGGCGCACTTCAGGCAGGAGGG + Intergenic
1202442116 Y:24919127-24919149 GAGGCGCACTTCAGGCAGGAGGG - Intergenic