ID: 1118317228

View in Genome Browser
Species Human (GRCh38)
Location 14:64732698-64732720
Sequence CTGGAGCTGGGTGGGTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 474}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118317216_1118317228 16 Left 1118317216 14:64732659-64732681 CCAGCTGGAAGATGGAGGGAGCT 0: 1
1: 0
2: 1
3: 24
4: 285
Right 1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG 0: 1
1: 0
2: 3
3: 33
4: 474
1118317215_1118317228 17 Left 1118317215 14:64732658-64732680 CCCAGCTGGAAGATGGAGGGAGC 0: 1
1: 0
2: 2
3: 26
4: 287
Right 1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG 0: 1
1: 0
2: 3
3: 33
4: 474
1118317211_1118317228 26 Left 1118317211 14:64732649-64732671 CCTGAAGCTCCCAGCTGGAAGAT 0: 1
1: 0
2: 1
3: 26
4: 177
Right 1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG 0: 1
1: 0
2: 3
3: 33
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118317228 Original CRISPR CTGGAGCTGGGTGGGTATAG AGG Intronic
900487574 1:2930698-2930720 CTGGCGCTGGGTGGGGGCAGCGG - Intergenic
900742175 1:4337314-4337336 GTGGGGCTGGGTGGGAAGAGGGG + Intergenic
902332976 1:15739557-15739579 CTGGACCTGGGTGGGCCAAGGGG - Exonic
902957412 1:19935022-19935044 CTGTTGCTGGCTGGGTGTAGTGG - Intergenic
903189819 1:21650390-21650412 CTGGATCTGGGTGGATTTGGGGG - Intronic
904686612 1:32265481-32265503 CTGTAGCTGGGGGGCCATAGAGG + Intronic
905203784 1:36331188-36331210 CAGAAGCTGGGTGGTTAGAGAGG - Intergenic
905591523 1:39167950-39167972 CTTGAGCTGTGGGGGTAAAGTGG - Intronic
906835029 1:49074077-49074099 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
907565643 1:55430862-55430884 CTAGAGCTTGGTGGGGGTAGAGG + Intergenic
910331008 1:86072308-86072330 CTTGAGCTTGGTGGGGAGAGGGG + Intronic
911216504 1:95200914-95200936 CTGGAGCTGGATGAGCATGGGGG - Intronic
911724559 1:101228941-101228963 ATGGAGCTGAGTGTGTAGAGGGG + Intergenic
912135918 1:106659998-106660020 CAGGACCTGGGTGGGTCCAGAGG - Intergenic
912521647 1:110249820-110249842 CTGGAGATGGATGGCTATATAGG - Intronic
912659065 1:111512625-111512647 CTGCAGCTGGGTGGGGTTGGGGG + Intronic
912675058 1:111671759-111671781 CTGGAGCTGGCAGGGCGTAGTGG - Intronic
912763336 1:112387558-112387580 CTGGTCCTGGCTGGGTACAGTGG + Intergenic
913134568 1:115875646-115875668 CTGAAGCTGGGAGGAAATAGGGG - Intergenic
913507049 1:119526720-119526742 CTTGAGCTTGGTGGGGAGAGGGG - Intergenic
914419734 1:147518388-147518410 TAGGAGCTGGCTGGGTAAAGAGG - Intergenic
915992258 1:160529791-160529813 CTCGAGCTTGGTGGGGACAGGGG - Intergenic
916165592 1:161964575-161964597 GTGGAGCTGGCTGGGTGCAGTGG + Intergenic
916955798 1:169833265-169833287 CTGTGGATGGGTGGGTATGGAGG + Intronic
918934224 1:190899267-190899289 CTTGAGATGGGTGGGTCCAGAGG - Intergenic
918945082 1:191053313-191053335 ATGTAGCTGGGTGGGTTTGGTGG + Intergenic
920098278 1:203500337-203500359 GTGGAGGTGGGTGGTGATAGAGG - Intronic
920428676 1:205899736-205899758 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
922505514 1:226123351-226123373 CTGGGGCTGGGTGTGTTTAGGGG + Intergenic
922666550 1:227474196-227474218 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
923289026 1:232526395-232526417 CTGGAGTGGGGTGGGTAGGGTGG + Intronic
1064692272 10:17930464-17930486 CTGGAGCTAAGTGGCTATAATGG + Intergenic
1064712079 10:18138814-18138836 CTGGAGCTGGATGGGCACGGTGG + Intergenic
1065287669 10:24201599-24201621 CTGGAGCCAAGTGGGTAGAGGGG - Intronic
1066389394 10:34966421-34966443 GTGCAGCTGGGTGGGTTTTGGGG - Intergenic
1067225465 10:44373385-44373407 CTGGAGCTGGCTGGGTGTGGGGG - Intronic
1067335462 10:45359154-45359176 CTGCAGCTGGGTGGGGGGAGGGG + Intergenic
1068651614 10:59528600-59528622 CTGGAGCTTGGTGGGCAGAGGGG + Intergenic
1069772794 10:70910185-70910207 CCAGAGCTGGGTGGGGACAGGGG + Intergenic
1070027430 10:72645473-72645495 ATGGAGCTGGCTGGGCACAGTGG + Intergenic
1070632488 10:78096669-78096691 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1070767018 10:79062590-79062612 CCGGAGCAGGGGAGGTATAGAGG - Intergenic
1071226576 10:83537381-83537403 ATGGAGGTGGGAGGGGATAGGGG - Intergenic
1074361250 10:112825446-112825468 CTGGATCTGGGGGGGGCTAGAGG - Intergenic
1074867730 10:117554522-117554544 CTGGAGCTGGCTGGGAGCAGGGG - Intergenic
1075737252 10:124671547-124671569 CTGGAGCTCTGTGGGTGGAGTGG - Intronic
1076131878 10:128019117-128019139 CTGGGGCTGGGAGGGGAGAGGGG - Intronic
1076818646 10:132927147-132927169 CTCGAGCGGGGTGGGTTTAGTGG - Intronic
1077655666 11:4016783-4016805 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1077836269 11:5930346-5930368 CCGGATCTAGGCGGGTATAGTGG - Intronic
1078321628 11:10340025-10340047 CTGAAGCCTGGTGGGGATAGGGG + Intronic
1078645896 11:13141179-13141201 CTGGCACTGGGTGGGGACAGAGG + Intergenic
1078790806 11:14540119-14540141 ACAGAGCTGGGTGGGTAGAGAGG - Intronic
1079034663 11:17011773-17011795 CTGAAGCTTGGTGGGGAGAGAGG - Intronic
1080710068 11:34738132-34738154 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1081380452 11:42408251-42408273 ATGGAGCTGGGTGGGAAAGGGGG - Intergenic
1081786222 11:45749760-45749782 CTGGAGGTGGGTGGGGAAGGAGG + Intergenic
1082241034 11:49870888-49870910 CTGATGCGGGGTGGGTGTAGGGG + Intergenic
1082872134 11:57953375-57953397 CTGGAGCTTGGTGGGAGGAGGGG - Intergenic
1083430283 11:62610843-62610865 CTGGGGCGGGGTGGGTTGAGGGG + Intronic
1085042296 11:73333693-73333715 CTGGAACAGGGTGGGAGTAGGGG + Intronic
1085782329 11:79420800-79420822 CTGGAGCTGGGATGGGACAGAGG + Intronic
1086129208 11:83383268-83383290 CTCAAGCTGGGTGGGGGTAGGGG + Intergenic
1086279732 11:85171763-85171785 CTGGAGCTGGCAGGGTAGAATGG - Intronic
1086456855 11:86967806-86967828 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1087427780 11:98012685-98012707 CTCGAGCTTGGTGGGGAAAGGGG + Intergenic
1088066465 11:105726190-105726212 CTCGAGCTTGGTGGGGAGAGGGG + Intronic
1088837110 11:113587170-113587192 CTGGAGCTTTCTGGGTAAAGGGG - Intergenic
1089310888 11:117557432-117557454 CTGGAGGGGGTTGGGTACAGTGG + Intronic
1089320380 11:117622424-117622446 CTGGAGCTGGCTGGCAATGGTGG + Intronic
1089432413 11:118435583-118435605 CTGAAGCTGGGTGGCTAACGGGG - Intergenic
1090020199 11:123121659-123121681 TCTGAGCTGGGTGGGTTTAGTGG + Intronic
1091336483 11:134772257-134772279 CTGGAATTGGCTGGGTACAGTGG + Intergenic
1092057950 12:5522875-5522897 CTGGAGATGGGAGGGCAGAGAGG - Intergenic
1092237093 12:6817121-6817143 CTGGAGCTGAGTGGCTGCAGAGG - Exonic
1093290338 12:17311927-17311949 CTGGAGCTGGATGCGCACAGTGG - Intergenic
1094733112 12:33200709-33200731 CTCGAGCTTGGTGGGGAGAGAGG - Intergenic
1094757864 12:33492868-33492890 CTGGAGCTTTGTGGGGAGAGGGG + Intergenic
1094794110 12:33950760-33950782 CTGGAGCTGGGTTGGTCTAGAGG + Intergenic
1095105974 12:38233377-38233399 CTGGAGCTGGGTTGGTCTAGAGG + Intergenic
1095547352 12:43387871-43387893 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1095647003 12:44558973-44558995 CTCGAGCTTGGTGGGGATAGGGG + Intronic
1096529651 12:52234631-52234653 CTGGAGGTGGGAGGCAATAGAGG - Intronic
1097104662 12:56614953-56614975 ATGGAGCTCGGGGGGGATAGTGG - Intronic
1097224886 12:57471329-57471351 CAGGGGGTGGCTGGGTATAGGGG - Exonic
1097409898 12:59238909-59238931 CTGGAGATGGGTGGTGACAGTGG + Intergenic
1097619517 12:61922895-61922917 CTCGAGCTTGGTGGGGAGAGGGG + Intronic
1097737389 12:63196820-63196842 CTTGAGCTTGGTGGGAAGAGGGG + Intergenic
1098360914 12:69653788-69653810 CTGGAGCTGGGAGGCTAATGGGG - Exonic
1098705663 12:73685537-73685559 CAGGCCCTGGGTGGGTACAGAGG - Intergenic
1098907847 12:76180115-76180137 CTGGGGTGGGGTGGGTGTAGTGG + Intergenic
1099071359 12:78049060-78049082 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1100165668 12:91914842-91914864 CTTGAGCTGGGTGGGAAAGGAGG - Intergenic
1100558458 12:95722209-95722231 CTGCAGATGGGTGGGTTTGGGGG - Intronic
1100605921 12:96152145-96152167 CTGCGGCTGGGAGGGTATCGGGG - Intergenic
1101328963 12:103741908-103741930 GTGGAGCTGGGTGGTCATGGGGG - Intronic
1101472661 12:105013321-105013343 CTTGAGCTTGGTGGGAAAAGGGG - Intronic
1102611044 12:114112569-114112591 TGGGAGCTGGGTGGGTGCAGGGG + Intergenic
1103328223 12:120135732-120135754 CTGGAGTTGGGTGGGTGTGCAGG + Intronic
1105552469 13:21410702-21410724 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1106377434 13:29203353-29203375 CTGGAGCTTGGTGGAGAAAGGGG - Intronic
1106429429 13:29665871-29665893 CTGGAGCTTGGTGGGAAAAGGGG + Intergenic
1106951745 13:34892145-34892167 CTGGAACTGGCTGGGTATGGTGG + Intergenic
1107281797 13:38744777-38744799 TTGGAGCTGGCTGGGCGTAGTGG - Intronic
1107641955 13:42453011-42453033 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1108236842 13:48416734-48416756 CTGGAGCTTGGTGGGAGGAGGGG + Intronic
1108489344 13:50964935-50964957 TAGGAGCTGGGTGGGGGTAGGGG - Intronic
1110826323 13:79975360-79975382 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1111635083 13:90892984-90893006 CTTGAGCTTGGTGGGGAGAGGGG + Intergenic
1112131087 13:96524593-96524615 CTGGAGCTTGGTGGGGGAAGGGG - Intronic
1112754072 13:102610853-102610875 CTTGATCTGGGTGGGTACAATGG - Intronic
1112793626 13:103030186-103030208 CTGGAGTGGGCTGGGTATTGGGG + Intergenic
1114209789 14:20605005-20605027 CTGTAGCTGGATGGGGATGGTGG - Intronic
1114744986 14:25137020-25137042 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1115538058 14:34391817-34391839 CTTGAGCTTGGTGGGGGTAGGGG + Intronic
1116866811 14:50038047-50038069 CTGGAGCTGGTTTTGTAAAGTGG - Intergenic
1117121071 14:52568593-52568615 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1117930533 14:60837063-60837085 CTTGAGCTTGGTGGGGGTAGGGG - Intronic
1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG + Intronic
1118613090 14:67556564-67556586 CTGGTGCAGGGTGGGTGTGGTGG - Intronic
1119173840 14:72554905-72554927 CCGGAGCTGGGTAGGGATGGTGG - Intronic
1119757562 14:77129685-77129707 CGGGATCCGGGTGGGGATAGTGG - Intronic
1120798827 14:88666947-88666969 CTGGAGCTGGGTGGCAGCAGTGG + Intronic
1120998920 14:90437392-90437414 CTGCTGCTGGGTGGGCAAAGGGG + Intergenic
1121554894 14:94829101-94829123 CTGGAGCTGGGAGGGGACAGTGG - Intergenic
1122697784 14:103565245-103565267 CTGGTGCTGGCTGGGCATGGTGG - Intronic
1122919681 14:104874871-104874893 CTGCAGCTGGGTGGGGCTCGTGG - Intronic
1123744654 15:23310266-23310288 CTGGAGCTGGCTGTGCAGAGAGG + Intergenic
1124144516 15:27111697-27111719 GTGGAGCTGCCTTGGTATAGGGG + Intronic
1124270136 15:28272903-28272925 CTGGAGCTGGCTGTGCAGAGAGG - Exonic
1125083785 15:35706066-35706088 CTGGAGGTGTGTGGGTGGAGAGG + Intergenic
1125219564 15:37317671-37317693 CTTGAGCTTGGTGGGGAGAGGGG + Intergenic
1125715406 15:41817154-41817176 CTGGAGCTGGTTGGGAAGATAGG + Intronic
1126166616 15:45659062-45659084 CTGGTGCTGGGTGGGGGCAGTGG + Exonic
1126792330 15:52232393-52232415 CTTCTGCTGGGTGGGTACAGTGG - Intronic
1128061867 15:64740503-64740525 CTGAAGCGGGGTGGGTGCAGGGG + Exonic
1128453596 15:67821074-67821096 CAGGAGCTGGGTGGGTCTCCTGG + Intronic
1128524909 15:68405765-68405787 TCGGAGCTTGGTGGGCATAGGGG + Intronic
1128528178 15:68426451-68426473 CCTGAGCTGGGTGGGGAGAGGGG + Intronic
1129273632 15:74432293-74432315 CTGGAGCTGGGATGGCAGAGGGG + Intronic
1129566828 15:76632478-76632500 CAGGAGCTGGCTGGGTGTAGTGG - Intronic
1129879556 15:78997877-78997899 CTGGCGCAGGGTGGGGAGAGAGG + Intronic
1129903444 15:79169459-79169481 AAGGAGCTGGGTGGGTCTGGAGG + Intergenic
1130355768 15:83129115-83129137 CTGGACCTGGTTGGGTGTGGTGG - Exonic
1130563712 15:84977953-84977975 CTGGAGCTGAGGGGGTGAAGGGG + Intergenic
1131204847 15:90435187-90435209 CTGAGGCTGGGTAGGTACAGTGG + Intronic
1131371864 15:91888693-91888715 CAGTAGCTGGCTGGGTACAGTGG + Intronic
1131688780 15:94803477-94803499 ATGGAGGAGGCTGGGTATAGTGG - Intergenic
1132007387 15:98241152-98241174 GTGGAGCTGTGTGGATAAAGAGG - Intergenic
1134042652 16:11080332-11080354 CTGGGGGTGGGTGGGTAAACAGG + Intronic
1134076007 16:11291905-11291927 CAGGAGCTGGCTGGGTGCAGTGG + Intronic
1134540213 16:15057965-15057987 GTGGAGCTGGGTGGGAAGAGAGG - Intronic
1135127548 16:19823647-19823669 ATGGAGCTGGCTGGGCACAGTGG + Intronic
1135779511 16:25287988-25288010 CTGGAACTGGCTGGGCACAGTGG - Intergenic
1136064888 16:27751931-27751953 CTGGAGCTGGGGGGCTGTGGGGG + Intronic
1136181191 16:28553670-28553692 CTGGAGGTGGGTGGGCGCAGGGG - Intergenic
1136366360 16:29810989-29811011 CTGGAGCTGGGGTGGAAGAGGGG - Exonic
1136685413 16:31991271-31991293 TTGGAGTTGGGTGGGTTCAGGGG + Intergenic
1136705131 16:32181264-32181286 CTGGAGCTGGCTGTGCAGAGAGG - Intergenic
1136762781 16:32748142-32748164 CTGGAGCTGGCTGTGCAGAGAGG + Intergenic
1136786027 16:32934801-32934823 TTGGAGTTGGGTGGGTTCAGGGG + Intergenic
1136805319 16:33122244-33122266 CTGGAGCTGGCTGTGCAGAGAGG - Intergenic
1136883748 16:33919002-33919024 TTGGAGTTGGGTGGGTTCAGGGG - Intergenic
1137968732 16:52962493-52962515 CTGGAGCTGGGTGGGGGTCGAGG - Intergenic
1138133675 16:54503133-54503155 CTGGAGCTGGGTGCTTAGAAAGG - Intergenic
1138530333 16:57631209-57631231 CTGCAGCAGGGTTGGTGTAGGGG + Intronic
1139504256 16:67391240-67391262 CTGGAGCTGCCTGGGGAGAGGGG + Exonic
1140238615 16:73181375-73181397 CTGCAGCTGGCTGGGCATGGTGG - Intergenic
1141196895 16:81866952-81866974 CTGGGGCTGGCTGGGCACAGCGG - Intronic
1141246109 16:82309254-82309276 CTCGAGCTTGGTGGGGAGAGGGG - Intergenic
1141780862 16:86159854-86159876 CTTGAGCTAGGTGGCTATATGGG - Intergenic
1203064937 16_KI270728v1_random:1008461-1008483 CTGGAGCTGGCTGTGCAGAGAGG + Intergenic
1203088260 16_KI270728v1_random:1196459-1196481 TTGGAGTTGGGTGGGTTCAGGGG + Intergenic
1142602084 17:1058488-1058510 CTGGGGGTGGGTGGGTGAAGGGG + Intronic
1142668994 17:1478826-1478848 CTGGAGCTGGGAGTGCAGAGTGG - Intronic
1143035448 17:3993166-3993188 CTGTAGCTGGCTGGGCACAGTGG + Intergenic
1143585122 17:7847128-7847150 CTGGAGCTGGGTATGGATATGGG - Exonic
1144671963 17:17138038-17138060 CTGGGGCTGGGAGGGGAGAGCGG - Exonic
1146004020 17:29149486-29149508 CAGGGACTGGGTGGGTGTAGGGG - Intronic
1146698818 17:34935314-34935336 CTGGAGATGGGTGGTGATAATGG + Intronic
1146845517 17:36179387-36179409 CTGCAGCAGGGTGGGGGTAGGGG - Intronic
1146873733 17:36391228-36391250 CTGCAGCAGGGTGGGGGTAGGGG - Intronic
1146881091 17:36442318-36442340 CTGCAGCAGGGTGGGGGTAGGGG - Intergenic
1147065656 17:37921643-37921665 CTGCAGCAGGGTGGGGGTAGGGG + Intergenic
1147511312 17:41071157-41071179 CTGGAGTTGGGTGGGAGGAGGGG + Intergenic
1148200630 17:45747900-45747922 GTGGAGGTGGCTGGGTATTGAGG + Intergenic
1149191926 17:54073138-54073160 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1152045208 17:77930745-77930767 TTGGAGCTGGGTGGGGAAGGTGG - Intergenic
1152363090 17:79841326-79841348 CAGAAGCTGGGTGGGTGTACAGG + Intergenic
1152396314 17:80035782-80035804 CGGGACCCGGGTGGGTATCGGGG - Exonic
1152433826 17:80263369-80263391 GTTGGGCTGGGTGGGGATAGGGG - Intronic
1152569218 17:81114259-81114281 ATGGGGCTGGCTGGGCATAGTGG - Intronic
1153083742 18:1258787-1258809 CTAGAACTGGCTGGGCATAGTGG - Intergenic
1153761076 18:8333180-8333202 GTTGAGATGGGTGGGTATAAGGG - Intronic
1154006211 18:10529464-10529486 CTGTAGCTGGCTGGGTACAGTGG + Intronic
1154380803 18:13848413-13848435 CTGGTGCTGGGTGGGAGTGGTGG - Intergenic
1155135273 18:22985566-22985588 CTGGAGCAGAGTGAGTAAAGGGG + Intronic
1157292353 18:46419205-46419227 CTGGAGCTTGATGGGAAGAGGGG + Intronic
1158462613 18:57659574-57659596 CTAGAGCTGGCTGGCTATGGAGG + Intronic
1158550337 18:58430596-58430618 CAGGAGCCTGGTGGGAATAGGGG + Intergenic
1159092786 18:63868673-63868695 CTGTAGCAGGCTGGGTATGGTGG + Intergenic
1159562199 18:70007556-70007578 CTCGAGCTTGGTGGGGAGAGGGG + Intronic
1160596716 18:79980594-79980616 ATGGAGCAGGGTGGGGAGAGGGG + Intronic
1160784302 19:892551-892573 CTGGAGATTGGGGGTTATAGGGG - Intronic
1161301382 19:3544575-3544597 CGGGAGCTGGGTGAGGATGGAGG + Exonic
1161535698 19:4817495-4817517 CTGGAGCTGCGGGGGTATCAGGG + Exonic
1161609849 19:5236420-5236442 CTTGTGCTGGTTGGGTATGGCGG + Intronic
1162094520 19:8302653-8302675 ATGGAGCTTGGTGGGTGTGGGGG - Intronic
1162760633 19:12886304-12886326 CTGGAGCTGGGGGGGGAGCGGGG - Intronic
1162792985 19:13072534-13072556 CTGGAGCTGGGTGGGGGATGGGG + Intronic
1163030865 19:14543258-14543280 CAGGAGCTGGGTGGGGTTGGAGG + Intronic
1163072441 19:14855510-14855532 CTGGAGTGGGCTGGGTATGGTGG - Intergenic
1163418217 19:17199831-17199853 ATGGATCTGGCTGGGTATGGTGG - Intronic
1165315960 19:35055636-35055658 CTGGAGCAGGGTGGGGGCAGTGG - Intronic
1165329870 19:35135422-35135444 CTGGAGCAGGGTGGGAGGAGAGG + Intronic
1166218176 19:41350131-41350153 CTCTAGCTGGGTGGGTGTGGTGG - Intronic
1166274951 19:41746880-41746902 CTGGAGCAGAGAGGGTATACGGG + Intronic
1167643522 19:50694540-50694562 CTGGAGGGGGGTCGGTTTAGGGG + Intronic
1168017921 19:53588215-53588237 CTGGAGGGGGCTGGGTACAGTGG - Intergenic
1168100136 19:54137268-54137290 CTGGAAGTGGGTGGGGAAAGCGG - Intergenic
1168675139 19:58272274-58272296 CTGGAGTTGGATGGGTGTGGTGG + Intronic
925728301 2:6895925-6895947 CTGAAGCTGGATTGGTAGAGCGG + Exonic
926453115 2:13030816-13030838 CTGCAGCTGGGTGTGTACTGGGG + Intergenic
927926152 2:27015022-27015044 CTGGAGCTGGGGAGGGATTGTGG + Intronic
928576707 2:32663019-32663041 CTCGAGCTTGGTGGGGACAGGGG - Intronic
929281608 2:40086785-40086807 CTGGATCTGGGTGGGGGTGGCGG + Intergenic
931046820 2:58363140-58363162 CTGGAGCAGGGAGGGAACAGTGG - Intergenic
931886696 2:66625823-66625845 CTCGAGCTTGGTGGGGAGAGGGG - Intergenic
932051815 2:68405495-68405517 CTCAAGCTGGGTGGGGAAAGGGG + Intergenic
933387919 2:81634775-81634797 CAGGTGCTGGGTGGGTCCAGAGG - Intergenic
933586797 2:84187949-84187971 GTAGATTTGGGTGGGTATAGAGG - Intergenic
933592933 2:84252447-84252469 CTGGCTCTGGGTGTGTGTAGGGG + Intergenic
934619815 2:95797205-95797227 CTGGGGCGGGGTGTGTATCGGGG + Intergenic
934641073 2:96027352-96027374 CTGGGGCGGGGTGTGTATCGGGG - Intronic
935325842 2:101935967-101935989 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
935565701 2:104604959-104604981 GTGGATCTGGGTGGATGTAGTGG + Intergenic
935960806 2:108423939-108423961 CTGGGGCTGGGTGGACACAGTGG - Intergenic
936911904 2:117602257-117602279 CTGGACTTGGGTGGGCATGGGGG - Intergenic
938226109 2:129617833-129617855 CTGGAGCTGGGTGGTGATGATGG + Intergenic
940966833 2:159847483-159847505 CTGGTTCTGGGTGGGCATGGTGG - Intronic
941565347 2:167099347-167099369 CTCGAGCTTGGTGGGTGGAGGGG - Intronic
941832504 2:169978016-169978038 CTGTTTCTGGGTGGGTATAGTGG + Intronic
942083741 2:172426135-172426157 CAGGAGCTGTGTGTGCATAGGGG - Intergenic
942953680 2:181750380-181750402 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
943836828 2:192524772-192524794 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
944502358 2:200375205-200375227 CTGGAGTTACGTGGGTATATAGG + Intronic
945486891 2:210407036-210407058 CTCGAGCTTGGTGGGAAGAGGGG - Intergenic
945890852 2:215429217-215429239 CTGTAGATGTTTGGGTATAGGGG - Intronic
946432533 2:219633308-219633330 CTGGAGCTCGATGGGTTTCGGGG - Exonic
946697346 2:222372775-222372797 CAGGCCCTGGGTGGGTACAGAGG - Intergenic
947666483 2:231909113-231909135 CTGGAGCAGGGTGGGAGCAGAGG + Intergenic
948577430 2:238963839-238963861 TTGGGGCTGGGTGGGCACAGTGG - Intergenic
1168751919 20:288606-288628 CTGATGCTGGGTGGGGATAGAGG - Intronic
1169552253 20:6713174-6713196 CTGGAACTGGCTGGGCATGGTGG - Intergenic
1171452567 20:25246856-25246878 CTGGAGCTGGGTGGGCTGTGGGG + Intergenic
1172037648 20:32021014-32021036 ATGGACCTGGGTGGGTACAGGGG - Intronic
1172095240 20:32457224-32457246 CTGGGGCTGGGTGGGCAGAGAGG - Intronic
1173182418 20:40815235-40815257 CTGGAGCTGGGAGAGTACACAGG + Intergenic
1173318633 20:41968014-41968036 CTGGAACTTGGTGGGGGTAGGGG - Intergenic
1174101178 20:48127321-48127343 CTGGAGCTGAGCGGGTGGAGAGG - Intergenic
1174362100 20:50035239-50035261 GTGGAGCCGGGTGGATAGAGGGG + Intergenic
1175040956 20:56050165-56050187 CTCAAGCTTGGTGGGGATAGGGG + Intergenic
1175549187 20:59805656-59805678 GTGGAGCTGGGTGGGGGCAGTGG + Intronic
1175852530 20:62101513-62101535 GTGGAGCAGTGTGGGTGTAGGGG + Intergenic
1175900731 20:62359000-62359022 CTGGGGCTGGCAGGGTATAAGGG - Intronic
1175922934 20:62458551-62458573 CTGGAGCTGGGTGCGCTGAGAGG + Intergenic
1176194669 20:63831539-63831561 CTGGAGCTCGCTGGGCATTGTGG + Intergenic
1178706909 21:34883336-34883358 GTGGAGGCGGGTGGGTAAAGGGG + Intronic
1178737595 21:35166921-35166943 GAGGAGCTGGGTGGGTGTGGAGG - Intronic
1179049700 21:37878738-37878760 GTGGGGCTGGGTGGGGAAAGAGG + Intronic
1179722104 21:43321755-43321777 ATGGAGCTGGGTGGGCAAAAAGG + Intergenic
1180044798 21:45300307-45300329 CTGGAGCTGGCTGGGCTTTGAGG + Intergenic
1180152542 21:45958133-45958155 CTCGAGCTGGGTTGGAAAAGTGG - Intergenic
1180237548 21:46472791-46472813 CTGTAGCTGGTTGGGTGTTGTGG + Intronic
1180620970 22:17161579-17161601 CTGGAGTTGGGTGGGTATGGTGG + Intronic
1180622741 22:17172512-17172534 CTGGAGCTAGGTAGGTGCAGAGG - Intergenic
1181444743 22:22960355-22960377 CTGGGGCTGGGTGGGGACAGTGG - Intergenic
1181885347 22:26017932-26017954 TTGGAGCTGGGTGGTGATAAGGG - Intronic
1182087391 22:27570730-27570752 CTGGAGTGGAGTGGGTAAAGGGG - Intergenic
1182309320 22:29393500-29393522 GTGTAGCTAGGTGGGTTTAGTGG - Intronic
1182738802 22:32551327-32551349 CTGGTGCAGGGTGGGGGTAGGGG - Intronic
1183072901 22:35408649-35408671 CTGGAGCAGGGTGAGTAGGGTGG + Intronic
1183653826 22:39173861-39173883 CTGGAACAGGGAGGGTGTAGGGG - Intergenic
1184890248 22:47374896-47374918 CTAGAGCTAGGTGGGAATGGGGG + Intergenic
1185239459 22:49734955-49734977 CCGGAGCAGGGTGGGTAGAGGGG - Intergenic
1185413886 22:50699462-50699484 CTGGAGCTGGGTGCGTGTCTTGG + Intergenic
949339927 3:3018533-3018555 ATGGCTGTGGGTGGGTATAGAGG + Intronic
950671884 3:14532249-14532271 CTGGAGCAGAGTGGGGAAAGTGG - Intronic
951183169 3:19682498-19682520 CTGGAGCTGGGCGGGGGGAGGGG - Intergenic
952282860 3:31940006-31940028 ATGGAGTGGGCTGGGTATAGTGG - Intronic
952654447 3:35768024-35768046 CTGGAGCTGGATGCGTTTATTGG - Intronic
953627082 3:44580155-44580177 CTGGGGCTGGGAGGGGAGAGCGG + Intronic
953749613 3:45599330-45599352 CAGGAGCTGGGAGGGGATGGGGG - Intronic
954431081 3:50471139-50471161 CAGGAGGTGGCTGGGTAGAGGGG + Intronic
954864272 3:53715723-53715745 CTTCAGCTGGGTTGGGATAGTGG - Intronic
954946952 3:54434354-54434376 CTGCTGCTGGGTGGGTGTGGAGG - Intronic
955525898 3:59819533-59819555 CTGGAGCAGGGTGGTCAAAGAGG - Intronic
956220095 3:66893325-66893347 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG + Intronic
956891543 3:73619081-73619103 CTTGATCTGGGTGGATCTAGTGG + Intronic
958520908 3:95184594-95184616 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
959466956 3:106700140-106700162 CTGTTGCAGGGTGGGTACAGAGG + Intergenic
959815813 3:110671866-110671888 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
961550415 3:127667757-127667779 CTGGAGCTGGGCTGGAACAGAGG - Intronic
964943159 3:162186682-162186704 CTGTTGTTGGGTGGGGATAGTGG - Intergenic
965157494 3:165082900-165082922 CTTGTGCTGTGTGGCTATAGAGG + Intergenic
966832059 3:184018070-184018092 CGGGAGCTCGGTGGGAAGAGGGG - Intergenic
967951296 3:194843002-194843024 GTGGGGCTGGCTGGGCATAGTGG + Intergenic
968049327 3:195643325-195643347 CTGGAGCTCAGTGGGTTGAGAGG + Intergenic
968605319 4:1532586-1532608 CTGGACCTGGGTGGGTGGGGGGG - Intergenic
968666424 4:1824750-1824772 CTGGAGCTCCGTGGGGATATGGG - Intronic
968702955 4:2065332-2065354 CTTGGGCTGGGTGGGAAGAGGGG + Exonic
968725611 4:2246540-2246562 ATGGAGCTGGGTGGTCATACGGG - Intergenic
968766190 4:2470762-2470784 CTGTAGCTGGGTGAGGATGGAGG + Intronic
968829096 4:2922979-2923001 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
969340823 4:6539865-6539887 GTGCAGCTGTGTGGGTAGAGGGG + Intronic
970412054 4:15818152-15818174 ATGGAGCTGGGTGGGGGGAGGGG + Intronic
971489370 4:27194831-27194853 CTGGAGCAGAGTGGGTGAAGGGG + Intergenic
972698442 4:41470483-41470505 CTGGAGATGGGTGTGTAGAGAGG - Intronic
973237638 4:47922768-47922790 CTGGAGCTTGGTGGGGGAAGGGG - Intronic
975642529 4:76514477-76514499 CAGGGGCTGGTTTGGTATAGGGG + Intronic
975764693 4:77655044-77655066 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
976023930 4:80664571-80664593 CTTGAGCTTGGTGGGGAGAGGGG - Intronic
976133931 4:81914176-81914198 TTGGAGCTGGGTGGGAATCTGGG + Intronic
978108275 4:104930858-104930880 CTGGAGCTTGGTGGGAGGAGGGG + Intergenic
978237275 4:106474264-106474286 CTGGAGTTAGGTGGGAACAGGGG + Intergenic
979099896 4:116600102-116600124 CTGGAGCAGGGAGGGGAGAGGGG - Intergenic
981850988 4:149229808-149229830 CTGGAGCTTGGTGGGGAGAGGGG + Intergenic
982271483 4:153593618-153593640 GTGGAGCTGGGTGGGAATGTGGG + Intronic
982794534 4:159629568-159629590 CTCGAGCTTGGTGGGGAGAGGGG - Intergenic
983631290 4:169852301-169852323 CTGGAGCTGGGAGTGTGGAGAGG + Intergenic
984687751 4:182690408-182690430 ATGGAGCTGTTTGGTTATAGAGG - Intronic
984762884 4:183377623-183377645 CTAGAGCTGGCTGGGCATAGCGG - Intergenic
985757360 5:1726883-1726905 CTTGAGCTGGGTGGGGTGAGGGG + Intergenic
988065993 5:26229230-26229252 CTGGAGCTGAGCGGGTTGAGAGG - Intergenic
988133498 5:27137408-27137430 CTGAGGCTGGGTGGGTTTTGGGG + Intergenic
988181299 5:27797353-27797375 CTGGGGCTGTGTGGGTATGCTGG - Intergenic
988767019 5:34389015-34389037 CTGGAGCTTGGTGGGGGAAGGGG - Intergenic
988772578 5:34447639-34447661 CTGGAGCTTGGTGGGGGAAGGGG - Intergenic
989363949 5:40634760-40634782 CTCGAGCTTGGTGGGGAGAGGGG + Intergenic
989629039 5:43461832-43461854 CAGGCCCTGGGTGGGTCTAGAGG - Intronic
989825344 5:45848100-45848122 CTGGAGCTAGGTGGGGGGAGGGG + Intergenic
991187765 5:63830457-63830479 CAGGAGTTAGGTGGGTACAGGGG + Intergenic
991187871 5:63831743-63831765 CAGGAGTTAGGTGGGTACAGGGG - Intergenic
991475338 5:67012404-67012426 CTAGAGATGGGTGTGTATGGAGG - Intronic
992042533 5:72849005-72849027 CTGCAGCTGTGTGGGTCTTGGGG + Intronic
992077869 5:73207368-73207390 CTGGAGCTTGGTGGGAGGAGGGG + Intergenic
992450958 5:76875355-76875377 CTCGAGCTGGGTGGGCATGTCGG - Exonic
992758384 5:79930494-79930516 TGGGAGCTGGGTGGCTACAGTGG + Intergenic
992910797 5:81394177-81394199 CTGGAGCTGGGCGGGGAGGGCGG - Intronic
993609019 5:90031808-90031830 CTTGAGCTTGGTGGGGGTAGAGG + Intergenic
994142851 5:96361172-96361194 CTCGAGCTTGGTGGGAAGAGGGG - Intergenic
994641964 5:102421420-102421442 CTCGAGCTTGGTGGGGAGAGGGG + Intronic
994643211 5:102435903-102435925 CTGGAGCTGGAGGTTTATAGTGG + Intronic
995136566 5:108685941-108685963 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
995480375 5:112586635-112586657 CTGGAGCAGGGTGGGGGGAGGGG + Intergenic
995527487 5:113061776-113061798 TTGAAGCTGGGTGGTTACAGCGG + Intronic
996549319 5:124713045-124713067 CAGGTGGTGGGTGGGGATAGAGG - Intronic
997261490 5:132468687-132468709 CTGGTGCTGTGTGGGTATTCTGG - Intronic
997463537 5:134071703-134071725 CTGGAACTGGGTGGGGGTGGGGG - Intergenic
997497016 5:134337063-134337085 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998934203 5:147216667-147216689 CTGGAGCTTGGTGGGAGGAGGGG + Intergenic
999452463 5:151688615-151688637 CTGGAGCAGCGTGGGCACAGAGG - Intergenic
1000090348 5:157924670-157924692 CTGAAACTGGGTGGAGATAGAGG + Intergenic
1001108561 5:168876262-168876284 CTGAAGCTGTGTGGGCAGAGAGG - Intronic
1001402100 5:171451635-171451657 TTGGAGCTGGGTGGGGGTGGAGG - Intronic
1001490912 5:172154479-172154501 CTGGAGCTGGGTAGATAAAGAGG - Intronic
1001792082 5:174466304-174466326 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1002168429 5:177362193-177362215 CTGGAGATGGGTGGGAGTGGGGG - Intronic
1002316582 5:178348119-178348141 CTGGAGCTGGATGGGAACAGGGG - Intronic
1002409497 5:179062361-179062383 CTGGTGCTGGGTGGGGAGAATGG + Intronic
1002904577 6:1438320-1438342 CAGGAGCTGGGTGGGATGAGAGG - Intergenic
1003731724 6:8832147-8832169 CCGGAGCAGGGCGGGTATATGGG - Intergenic
1004271467 6:14199888-14199910 CTGGCGCTGGGTGAGTCTCGAGG + Intergenic
1004307693 6:14515822-14515844 CTGCAGCTGGGTGGCTATGCAGG + Intergenic
1004728931 6:18338638-18338660 CAGGAGTTGGCTGGGTATGGTGG - Intergenic
1005509020 6:26495543-26495565 CTATAGCTGGGTGGGTGCAGTGG + Intergenic
1006414054 6:33893033-33893055 CTGGCGCGGGGTGGGGAGAGGGG + Intergenic
1006572295 6:35015663-35015685 CTGGAGCTGGGAGGGGAGAGGGG + Intronic
1006997712 6:38277619-38277641 CTGTAGCTGGCTGGGCATGGTGG - Intronic
1007134598 6:39508641-39508663 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1007680878 6:43632544-43632566 CTGGATCTGGCTGGGCATAGTGG - Intronic
1008059892 6:46985686-46985708 CCGGGACTGGGAGGGTATAGTGG + Intergenic
1008584173 6:52933957-52933979 CTGGAGATGGATGGGAATGGTGG + Intergenic
1010039139 6:71361162-71361184 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1010932499 6:81819576-81819598 CTGGGGCAGAGTGGATATAGAGG - Intergenic
1010991010 6:82479987-82480009 CTGGAGCTGGCTGAGTAGAATGG - Intergenic
1011298269 6:85847169-85847191 CTGGAGCTTGGTGAGGAAAGGGG - Intergenic
1011318687 6:86065628-86065650 CTTGAGCTTGGTGGGGACAGGGG - Intergenic
1011371748 6:86644445-86644467 CTGGAGATGGGTGATTACAGTGG - Intergenic
1011578197 6:88827690-88827712 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1012444191 6:99291645-99291667 CTGGGGCTGGGTGGGCAGTGGGG - Intronic
1012453223 6:99375670-99375692 CTGGTGCTGGCTGGATATGGTGG - Intronic
1012597110 6:101053992-101054014 CTTGAGCTTGGTGGGGAAAGGGG - Intergenic
1012973468 6:105755584-105755606 ATGGAGTGGGGTGGGTACAGAGG - Intergenic
1015179301 6:130344921-130344943 ATGGAGGGGGGTGGGCATAGGGG - Intronic
1016111484 6:140230437-140230459 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1016483485 6:144508079-144508101 CTGGAGCTTGGTGGTGAGAGGGG - Intronic
1016856013 6:148671402-148671424 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1017535261 6:155340702-155340724 CTGGGGCTGAGTGGGAATACTGG + Intergenic
1017949735 6:159126660-159126682 CTGGAGCTGGGCAGGTGTGGAGG + Intergenic
1018040760 6:159919758-159919780 CTGGAAGTGGGAGGGTACAGAGG + Intergenic
1018152834 6:160956230-160956252 CTGGAGCTCGGTGGGTAGGTGGG + Intergenic
1018341637 6:162857088-162857110 TTGCAGCGGGGTGGGTAAAGAGG + Intronic
1019376359 7:694607-694629 CTGGAGGTGGGTGGGGGAAGGGG - Intronic
1021907786 7:25352787-25352809 CTGGAGCTGAGTGGCGTTAGAGG + Intergenic
1022748686 7:33201147-33201169 CTGGACCTGGGTGGGGAAGGAGG + Intronic
1022876055 7:34531557-34531579 CTGGAGGTGAGGGGGTATGGAGG + Intergenic
1024242090 7:47443399-47443421 CTGCAGCTTTGTGGGCATAGGGG - Intronic
1024447988 7:49503965-49503987 CAGCAGCTCTGTGGGTATAGTGG - Intergenic
1024653053 7:51425176-51425198 CTGGATTTGGGTGGGCACAGTGG - Intergenic
1025038228 7:55615806-55615828 CTGGATTTGGGTGGGCACAGTGG - Intergenic
1025092859 7:56077869-56077891 CTGGAGCCCTGTGGGTACAGGGG + Intronic
1025799971 7:64776746-64776768 CCTGAGCAGGCTGGGTATAGTGG - Intergenic
1026202036 7:68222668-68222690 CTGGATGTGGAAGGGTATAGAGG + Intergenic
1029959557 7:104675306-104675328 CTGGAGCAGAGTGGGCAGAGGGG + Intronic
1030409694 7:109160310-109160332 CTGGGGCTGGATTGGGATAGGGG + Intergenic
1030650618 7:112112354-112112376 CTGGAGCTGGCTGGGTGTGGTGG + Intronic
1031137682 7:117902787-117902809 CTGGGGCAGGATGGGGATAGGGG - Intergenic
1031397733 7:121293347-121293369 CTCGAGCTTGGTGGGGGTAGGGG - Intronic
1031511533 7:122656630-122656652 CTAGAGCTGTGTTGGTATTGTGG - Intronic
1031591259 7:123595019-123595041 CTGGAGCTTGGCGGGTGGAGGGG - Intronic
1033128020 7:138721807-138721829 GTAGAGCTGGGTGGGTCTGGAGG - Intronic
1033142676 7:138841425-138841447 CTGCAGATGTCTGGGTATAGGGG - Intronic
1033757225 7:144404917-144404939 TTGGAGCTGGGTGGGGAGCGGGG + Intronic
1034386433 7:150744721-150744743 CTGGGGCTGGGTGGGGAGGGGGG - Intronic
1034548707 7:151806678-151806700 CCAGAGCTGGCTGGGTACAGTGG + Intronic
1034715108 7:153234833-153234855 CTCGAGCTTGGTGGGTGGAGGGG - Intergenic
1035110940 7:156481209-156481231 CAGGAGCTGGGTGGCCATAGCGG - Intergenic
1035171143 7:157018061-157018083 CGGGAGCCGGGAGGGTAGAGAGG + Intergenic
1035332649 7:158106378-158106400 CTGGAGCTGGGAGGGAGCAGAGG - Intronic
1037050734 8:14370073-14370095 CTGGAGCTCTGTGGATGTAGTGG + Intronic
1037285467 8:17294294-17294316 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1037390293 8:18386236-18386258 GTGGAGCTGAGTGGGGGTAGAGG - Intergenic
1037832018 8:22195358-22195380 GGGGAGCTGGGTGGGTCTTGGGG + Intronic
1038296055 8:26291729-26291751 CTGGGGATGGGGGGGTAGAGAGG - Intronic
1038399344 8:27271117-27271139 CTGGAGCTGGGAGGTCACAGTGG - Intergenic
1038604511 8:28985874-28985896 CTGGGGCTGGATGGTGATAGTGG - Intronic
1039384885 8:37126705-37126727 GTGGAGCAGGGAGGGTATAGTGG - Intergenic
1041471087 8:58209749-58209771 GTGAAGCTGGGTGGGGCTAGGGG + Intergenic
1041574755 8:59381199-59381221 CTCGAGCTTGGTGGGGAGAGGGG + Intergenic
1042354847 8:67815687-67815709 GTGGAGCGGGGTGGGGATTGGGG + Intergenic
1043418100 8:80071963-80071985 CTGCAGGTTGGAGGGTATAGTGG - Intronic
1043570227 8:81594771-81594793 ATGGGGGTGTGTGGGTATAGGGG - Intergenic
1043647241 8:82536208-82536230 CTCAAGCTTGGTGGGTAGAGGGG - Intergenic
1044595249 8:93953111-93953133 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1045057272 8:98380128-98380150 CTGAAGCTGGGTAGGGTTAGGGG + Intergenic
1045839354 8:106561274-106561296 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1045975090 8:108122867-108122889 CTCGAGCTTGGTGGGGAGAGGGG - Intergenic
1046106504 8:109672830-109672852 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1047934585 8:129764430-129764452 CTGGAGCTGAATGGGGAAAGGGG + Intronic
1048467060 8:134674397-134674419 CTGGAGCTTGGTGGGGGAAGGGG + Intronic
1049178299 8:141207096-141207118 CTGGAGCCTGGTGGGTCTAGTGG - Intergenic
1049469678 8:142769742-142769764 CTGCAGCTGGGTGAGTCCAGGGG - Intronic
1050239894 9:3624177-3624199 CTCGAGCTCGGTGGGAGTAGGGG - Intergenic
1051571483 9:18563853-18563875 CTGGAGCTTGGTGGGGGTAGGGG - Intronic
1052746663 9:32448365-32448387 CTCGAGCTTGGTGGGCAGAGGGG - Intronic
1055239232 9:74163794-74163816 CTAGAGCTTGGTGGGTGGAGGGG + Intergenic
1056302626 9:85257990-85258012 CTGGAGCTTGGTGGGGGGAGGGG - Intergenic
1056628537 9:88274024-88274046 GTGGAGATGGGTGGGGATGGAGG + Intergenic
1057725252 9:97563896-97563918 CAGGGGCTGGGTGGGGGTAGGGG - Intronic
1057830086 9:98399581-98399603 CTGGCACTGGTTGGGTATGGGGG - Intronic
1058017243 9:100048165-100048187 CAGGAGTTGGGTGGGTGGAGGGG + Intronic
1058281535 9:103122076-103122098 CTGGAGCAGGTTGGCTAGAGTGG - Intergenic
1059259261 9:112960144-112960166 CTGGAGGTGGGTAGGTCTCGGGG - Intergenic
1060945427 9:127567456-127567478 CTGGGGCTGGCTGGGCACAGGGG - Intronic
1061219595 9:129242579-129242601 GTGGAGCTGGGTGAGAATGGAGG + Intergenic
1061689835 9:132318186-132318208 CAGGAGCTAGTTGGGGATAGAGG - Intronic
1061893072 9:133632974-133632996 CTGGAGCTGGGTGAGTGAACAGG - Intergenic
1061967102 9:134021326-134021348 CTGTAGTTGGCTGGGCATAGTGG + Intergenic
1062227438 9:135460734-135460756 CTGGGGCTGGGAGGGTAAGGAGG - Intergenic
1062385139 9:136306320-136306342 CTGGAGCATGGTGGGTGGAGTGG - Intronic
1185520142 X:732508-732530 CTGGAGCAGGCTGGGCACAGTGG + Intergenic
1186452445 X:9684875-9684897 CTGGAGCAGGTTGGTTAGAGAGG + Intronic
1187248354 X:17574414-17574436 CTGGAGCTTGGTGGGGGGAGGGG - Intronic
1187770639 X:22692029-22692051 CTGGGGCTGAGTGCGAATAGAGG - Intergenic
1188130011 X:26419606-26419628 CTCGAGCTTGGTGGGGGTAGGGG - Intergenic
1188456260 X:30369958-30369980 CAGGAGCTGGCTGGGTGCAGTGG - Intergenic
1189619076 X:42816508-42816530 CTGGAGCTTGGTGGGGAGAGGGG - Intergenic
1189754141 X:44253421-44253443 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1190069689 X:47269644-47269666 CTGGAGCTGGCTGGGCGTGGTGG + Intergenic
1191112011 X:56811597-56811619 CTGGAGCTTGGTGGGGGGAGTGG - Intergenic
1191135402 X:57058764-57058786 CTTGAGCTTGGTGGGGAGAGGGG - Intergenic
1191902780 X:66056289-66056311 CTGGGAATGGGTGGGAATAGCGG - Intergenic
1191969675 X:66799330-66799352 CTGGAGCTTGGTGGGGGTAGGGG + Intergenic
1192192579 X:69000788-69000810 TTGGAGCTGAGTGGGGAAAGAGG - Intergenic
1192200261 X:69062089-69062111 CTGGAGCTGCGTGAGCATAGTGG + Intergenic
1192941347 X:75915169-75915191 CTGGGACTGGGTGGTTATGGGGG - Intergenic
1193068594 X:77283127-77283149 CTTGAGCTTGGTGGGAAGAGAGG + Intergenic
1193159206 X:78208800-78208822 CTGGAGCTGGTTGGGGGTGGGGG + Intergenic
1193246754 X:79238662-79238684 GTGGAAATGGGTGGGTAGAGTGG - Intergenic
1193280671 X:79645382-79645404 CTGGAGAAGGGAGGGTGTAGGGG - Intergenic
1193352036 X:80474995-80475017 CTCGAGCTTGGTGGGGAAAGGGG - Intergenic
1194139868 X:90196258-90196280 CTTGAGCTTGGTGGGTGGAGGGG + Intergenic
1194203524 X:90983606-90983628 CTAGAGCTTGGTGGGTGGAGGGG + Intergenic
1195151231 X:102072205-102072227 CTGTGGGTGGGTGGGTATGGTGG - Intergenic
1195217183 X:102713212-102713234 CTGGAGGTGTGTGGGGATGGGGG + Exonic
1195431561 X:104795153-104795175 CTGGAGAATGGTGGGTAGAGGGG + Intronic
1197157230 X:123283544-123283566 CTGGAGCTTGGTGGGGGGAGGGG + Intronic
1197181819 X:123544781-123544803 CTGGAGTTGGCTGGGTGTGGTGG + Intergenic
1197906256 X:131428563-131428585 CTGGAGCTTGGTGGGGGGAGGGG + Intergenic
1198322278 X:135530232-135530254 CTGTTGCTGGGTGAGTATTGTGG + Intronic
1199855062 X:151753164-151753186 CTGAAGCTGGATGGGAACAGTGG + Intergenic
1200485615 Y:3765227-3765249 CTTGAGCTTGGTGGGTGGAGGGG + Intergenic
1200549354 Y:4559045-4559067 CTAGAGCTTGGTGGGTGGAGGGG + Intergenic
1200688203 Y:6276743-6276765 CTGGAGTTGGCTGGGCACAGTGG + Intergenic
1200732576 Y:6758475-6758497 CTGGAGCTTGGTGGGAGGAGGGG - Intergenic
1201047064 Y:9897945-9897967 CTGGAGTTGGCTGGGCACAGTGG - Intergenic
1201760914 Y:17537143-17537165 CTGCTGCTGGGTGGGGGTAGGGG + Intergenic
1201840638 Y:18368847-18368869 CTGCTGCTGGGTGGGGGTAGGGG - Intergenic