ID: 1118318396

View in Genome Browser
Species Human (GRCh38)
Location 14:64739110-64739132
Sequence GCAGCTAGTGGAAATGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118318394_1118318396 -8 Left 1118318394 14:64739095-64739117 CCATGTCAAGGGCACGCAGCTAG 0: 1
1: 0
2: 2
3: 15
4: 137
Right 1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1118318389_1118318396 12 Left 1118318389 14:64739075-64739097 CCCTTTGGGCAGATGCAGTCCCA 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1118318390_1118318396 11 Left 1118318390 14:64739076-64739098 CCTTTGGGCAGATGCAGTCCCAT 0: 1
1: 0
2: 2
3: 18
4: 173
Right 1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1118318388_1118318396 13 Left 1118318388 14:64739074-64739096 CCCCTTTGGGCAGATGCAGTCCC 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1118318393_1118318396 -7 Left 1118318393 14:64739094-64739116 CCCATGTCAAGGGCACGCAGCTA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118318396 Original CRISPR GCAGCTAGTGGAAATGAACC AGG Intronic
905138050 1:35815766-35815788 GCATCTAGTGGAAAGGACCCAGG - Intronic
906406307 1:45545112-45545134 GTAGCTACTGGAAATGGCCCTGG - Intergenic
907415167 1:54309433-54309455 GCAGCAAAGGGAAATGAAGCTGG + Intronic
911059938 1:93738994-93739016 GCAACTGGTGGAAAGGCACCTGG + Intronic
915989245 1:160496610-160496632 GCAGCTAGTCTAGATGAAACCGG + Intronic
919810454 1:201405847-201405869 GCAGCTGGTGGAGATGGGCCTGG - Exonic
920443858 1:206000990-206001012 GCATCTAGGGGAAAGGAACCAGG - Intronic
920774504 1:208923115-208923137 GCAGCTCCTGGAAAAGCACCTGG + Intergenic
921671643 1:217931467-217931489 GCAGCTTTTGGAAAGGAAGCTGG + Intergenic
1063758810 10:9047916-9047938 GCAGATAGGGGAAAGGAGCCAGG - Intergenic
1068675118 10:59762568-59762590 CCAGCCTGTGGAAATGAACAAGG + Intergenic
1069125439 10:64626950-64626972 ACAGCTGGTGGAAATGAGCAAGG + Intergenic
1069224041 10:65919312-65919334 GCAGTTAATGGCAATGAAGCTGG - Exonic
1072195720 10:93115998-93116020 GGAGCTAGAGGAAAGCAACCAGG + Intergenic
1072682750 10:97518328-97518350 GCAGCTAGGGAGAAAGAACCAGG - Intronic
1076050300 10:127328221-127328243 GCAGGTCTTGAAAATGAACCCGG + Intronic
1076189016 10:128469885-128469907 GCTGATTGTGGAAAAGAACCTGG + Intergenic
1076226479 10:128780501-128780523 GCAGCCAGTGGAAATCAGCCCGG + Intergenic
1077926063 11:6683043-6683065 GCTGCAAGTGGAAAGGGACCGGG - Intronic
1082238373 11:49847710-49847732 GCAGCTAGTCCAAAAGAAGCTGG - Intergenic
1088626485 11:111733815-111733837 GCAGGCAGTGGAAGGGAACCAGG + Intronic
1090119667 11:124012917-124012939 GCAGGGAATGGAAATGAACATGG - Intergenic
1091999201 12:5018883-5018905 GCAGGGAGTGGCAATGCACCAGG - Intergenic
1092285701 12:7128221-7128243 CCAGCCAGGGGAAATGTACCTGG + Exonic
1093372594 12:18382674-18382696 GCATCTAGTGGAAAGAAGCCGGG - Intronic
1094583788 12:31758491-31758513 GCAGGTAATGGGAATGAATCAGG - Intergenic
1102729205 12:115093020-115093042 GCAGATATTGGAAATCAATCAGG - Intergenic
1103593484 12:122008805-122008827 GCAGATAGTGGAAATAATTCAGG - Intergenic
1104339734 12:127937147-127937169 GCAGGTAGTGGAAATGAGCTTGG - Intergenic
1104412197 12:128568272-128568294 GCAGCCAGAGGATATGAAACTGG + Intronic
1104803262 12:131569143-131569165 GCAGCTGGAGGAAATGCAGCTGG + Intergenic
1106834166 13:33615747-33615769 GATGCTATTGGAAAGGAACCTGG - Intergenic
1114160185 14:20157041-20157063 GCAGCTATTGGAGATAAAGCTGG + Intergenic
1115438274 14:33402060-33402082 GCAGATAGTGGATATGAAAATGG - Intronic
1117241226 14:53836088-53836110 TCAGCTAATGGTAATGAACTGGG + Intergenic
1118318396 14:64739110-64739132 GCAGCTAGTGGAAATGAACCAGG + Intronic
1118991638 14:70802102-70802124 GCAGCCACTGGAAACTAACCTGG + Intronic
1119935551 14:78589424-78589446 GCAAGTAGATGAAATGAACCGGG - Intronic
1120206386 14:81591393-81591415 TCAGCATGTGGAAATAAACCTGG - Intergenic
1120431983 14:84430567-84430589 GATGCTAGTGGACATGAACAAGG + Intergenic
1121598521 14:95185218-95185240 GCAGCTCATGGAAGTGAGCCCGG - Exonic
1124029420 15:25996189-25996211 GCTGCTGGTGGAAATGAAAATGG - Intergenic
1125050318 15:35290367-35290389 GTAGCTTGTTGACATGAACCAGG + Intronic
1125409991 15:39396088-39396110 ACAGCAAGTGGAGAAGAACCAGG - Intergenic
1126511072 15:49475370-49475392 GGTGCTAGTGAAAAGGAACCAGG + Intronic
1127269953 15:57391421-57391443 GCCACTTGTGAAAATGAACCAGG + Intronic
1127608771 15:60616780-60616802 GCAGCTAGTCGAGCTGAACCTGG - Intronic
1128813577 15:70588933-70588955 ACAGCAAGTGAAAAGGAACCTGG + Intergenic
1129698244 15:77752810-77752832 GCAGCTGGTGGCAGTGAGCCTGG - Intronic
1129793769 15:78360793-78360815 GCAGCTAGTAGAAGTGACACAGG + Intergenic
1129951719 15:79597807-79597829 GCAGCTAGTGGCAAGGCAGCAGG - Intergenic
1131449440 15:92527276-92527298 GCAGCTAGTGGAACTTAGCCTGG + Intergenic
1131907082 15:97154548-97154570 GTAGCAAGTGAAATTGAACCCGG - Intergenic
1138343380 16:56305517-56305539 GCCCCTAGTGGAAATGAGGCTGG + Intronic
1139258082 16:65562702-65562724 ACAGCTATTGGTAATGAATCAGG - Intergenic
1139478633 16:67216000-67216022 GCAGCTGGTGGACATGAACAGGG - Intronic
1140571209 16:76108369-76108391 GCAGTTACTGGAAAAGAACATGG + Intergenic
1140971205 16:80014532-80014554 GCATCTAGTGGGTAGGAACCAGG - Intergenic
1141105524 16:81230347-81230369 CCAGGTAGTGGAGATGAACATGG + Intergenic
1141748228 16:85940487-85940509 GCAACTAAAGGAGATGAACCAGG - Intergenic
1143694249 17:8599570-8599592 GGAGCTTGTGAAAATGAAGCAGG - Intronic
1148389228 17:47258269-47258291 GCCACTAGTGGAAATGAAGGTGG + Intronic
1148664364 17:49363122-49363144 ACAGGGAGAGGAAATGAACCCGG + Intergenic
1151259089 17:72902723-72902745 GCAGCTGGTGGAGGTAAACCAGG + Intronic
1157070320 18:44399994-44400016 TGAGCTAGTGGAAATAAAGCTGG - Intergenic
1161253554 19:3294016-3294038 GGAACTAGTGGAAATGGAGCGGG - Intronic
1166266494 19:41687869-41687891 GCAGCTAGTGATGATTAACCAGG + Intronic
926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG + Intergenic
926830703 2:16959003-16959025 GCAGTTAGTGGAAAGAACCCTGG - Intergenic
927019649 2:19003258-19003280 GAAGCAAATGGAAATGAGCCTGG - Intergenic
927068525 2:19499199-19499221 GCATCTAATGAAAATGTACCAGG - Intergenic
930573452 2:53115465-53115487 GCTGCCAGTGGACATCAACCTGG + Intergenic
931201915 2:60105834-60105856 GCAGCAAGGGGAAATGGATCTGG + Intergenic
932015347 2:68020839-68020861 GCAGACAGTGGAAAGGAAGCAGG - Intergenic
932608044 2:73177329-73177351 GAAGCTACGGGAAATGAAGCTGG - Intergenic
932915320 2:75852089-75852111 CCATGTAGTGGAAATGAGCCAGG + Intergenic
935047640 2:99496828-99496850 GCAGCTGATTGAAATGAATCAGG - Intergenic
937122677 2:119451764-119451786 GCTGCTTGTGGGAAAGAACCAGG + Intronic
938817649 2:134919714-134919736 GGAGGTATTGGAAAAGAACCTGG + Intronic
941621042 2:167779362-167779384 GAAGCTAGTGGAAATGTCTCAGG + Intergenic
943105350 2:183539935-183539957 GCAGCTAGTGAAAATGATCATGG + Intergenic
943952582 2:194148973-194148995 GCAGCTAGTGGAAATAAATATGG - Intergenic
944436585 2:199696317-199696339 GCAGCCAGTGCACATGAACATGG + Intergenic
945892695 2:215447011-215447033 TCAGCTAGTGGGAATGAACAAGG - Intergenic
945974698 2:216261104-216261126 GCAGCAATAGGAAATGAATCCGG - Intronic
948252085 2:236537310-236537332 GCGGCTGGTGGAGATGAGCCAGG + Intergenic
948438280 2:237968084-237968106 GAAGCTTCTGGAAATGAACAGGG + Intronic
1171114460 20:22512665-22512687 GCAGCCAATGGAAACGCACCTGG + Intergenic
1175230257 20:57469386-57469408 GCAGCCAGCGGAAAGGAAGCAGG - Intergenic
1175256726 20:57652376-57652398 GCAGCAGCTGGAACTGAACCGGG - Exonic
1182321638 22:29481611-29481633 GCAGGTAGTGGGAAGGAGCCTGG - Intronic
1182890388 22:33813333-33813355 GAAGCTTGTGGAAATAAATCAGG + Intronic
1183353700 22:37347526-37347548 GCAGCTGCTGGGAATGTACCTGG + Intergenic
952122639 3:30263442-30263464 GCTGCTAGTGGAATTGAAGAAGG + Intergenic
953836840 3:46353809-46353831 GCAGAGAGTGGAAATGTTCCAGG + Exonic
957791241 3:84943685-84943707 GCAATTTGTGGAAATGATCCAGG + Intergenic
963677592 3:148332294-148332316 GTAGCTAGTGGAAAGGAAATGGG - Intergenic
963678222 3:148341203-148341225 GCAGCTGGTGCAAAGGAACTGGG + Intergenic
963948356 3:151170810-151170832 GCAGGTAGTGGGAATGAGTCGGG + Intronic
964968842 3:162534408-162534430 CCAGTTAGTGGAAATGATTCTGG - Intergenic
971489130 4:27192506-27192528 GAAGCTAGTGGAAATGGACTAGG - Intergenic
989411815 5:41128016-41128038 GCAGCAATAGGAAATGCACCAGG + Intergenic
990034051 5:51298065-51298087 CCAGCTAGTGCAAAAAAACCAGG + Intergenic
994587912 5:101734383-101734405 GAAGCTGGTGGAAGTGAATCTGG + Intergenic
996679099 5:126211045-126211067 GGTGCTAGTGGAAATGAGCCTGG + Intergenic
996828003 5:127707286-127707308 TAAGCTAATGGAAATGATCCAGG + Intergenic
1001475896 5:172050480-172050502 CCAGGTAGTCGAAATGAGCCTGG + Intronic
1003017834 6:2482267-2482289 GCAGCTACTGCAAAGGAACGTGG - Intergenic
1004315257 6:14581269-14581291 GAAGCAGGTGGAAATGAACTGGG - Intergenic
1011876449 6:91967598-91967620 GGAGCTAGGGAAAATGAACCAGG - Intergenic
1013188846 6:107784944-107784966 GGTGCTAGTGGACATGACCCTGG + Intronic
1016493923 6:144637781-144637803 CCAGCAAGTGTAAATGAGCCTGG - Intronic
1018066873 6:160130875-160130897 GGCGCTTGTGGAAATGCACCAGG + Intronic
1020006940 7:4788241-4788263 GCAGGTATTGGAAAAGACCCTGG - Exonic
1022273078 7:28829410-28829432 GTAGCTAGTGGAGCTCAACCAGG + Intergenic
1023078568 7:36506681-36506703 GCAGCTAGGGGCAAGGACCCTGG + Intergenic
1023207851 7:37770338-37770360 GCAGGTAGAGGCAATGAACCTGG - Intronic
1023670467 7:42570998-42571020 GCTGCTGGTGGAGATGAAGCTGG - Intergenic
1030582722 7:111379569-111379591 GAATATAGTGGAAAGGAACCAGG + Intronic
1031069190 7:117143057-117143079 GCAGGAAGAGTAAATGAACCTGG + Intronic
1038071477 8:24019031-24019053 GCACCTAGTAGAAATGCAACTGG + Intergenic
1040579521 8:48685909-48685931 GCAGCTGGTGATAGTGAACCAGG - Intergenic
1042227206 8:66523179-66523201 GCAGATGGGGGAAATGAAACAGG - Intergenic
1047393429 8:124473156-124473178 GCAGTTTGGGGAAATTAACCCGG + Intergenic
1048218032 8:132514619-132514641 ACAGCTAGAGGGAAGGAACCTGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1053729092 9:41034381-41034403 CAGGCTAGTGGAAATGAACTTGG - Intergenic
1054699420 9:68397702-68397724 CAGGCTAGTGGAAATGAACTTGG + Intronic
1055513809 9:77018435-77018457 GCAGCTGCGGGAAATGCACCCGG + Intergenic
1056946303 9:91000286-91000308 GCAGCTCTGGGAAATGAGCCGGG + Intergenic
1057464549 9:95300802-95300824 GCAGCTAGTGTAAATGATGGTGG - Intronic
1186472814 X:9834506-9834528 GCAGCTCGTGGAACTTCACCTGG + Intronic
1188202981 X:27316148-27316170 GTATCTAGTGGAAAGGAACAAGG - Intergenic
1190026034 X:46924009-46924031 GCAGCTAGGGTAAAGGAACATGG - Intronic
1196308594 X:114133936-114133958 GCAGAGAGTGGGAATTAACCTGG + Intergenic
1201463766 Y:14257213-14257235 GCTGCCAGTGGATATAAACCAGG + Intergenic