ID: 1118320994

View in Genome Browser
Species Human (GRCh38)
Location 14:64753375-64753397
Sequence AGCCCTCGGGGCTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118320988_1118320994 -9 Left 1118320988 14:64753361-64753383 CCATCATGCCAAGTAGCCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1118320994 14:64753375-64753397 AGCCCTCGGGGCTGGCCCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 341
1118320986_1118320994 13 Left 1118320986 14:64753339-64753361 CCAGAACTGGAGATAGGCTTTCC 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1118320994 14:64753375-64753397 AGCCCTCGGGGCTGGCCCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 341
1118320987_1118320994 -8 Left 1118320987 14:64753360-64753382 CCCATCATGCCAAGTAGCCCTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1118320994 14:64753375-64753397 AGCCCTCGGGGCTGGCCCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118320994 Original CRISPR AGCCCTCGGGGCTGGCCCAG AGG Intronic